"
Team:BYU Provo/Notebook/Auxotrophy/julyaug
From 2014.igem.org
| Line 1: | Line 1: | ||
{{CSS/Main}} | {{CSS/Main}} | ||
| - | + | {{BYU1}} | |
Revision as of 20:53, 15 October 2014
BYU 2014 Notebook |
||||||||||||
| ||||||||||||
Week of July 11
July 7
(TR,CB) We began the cloning process over again with recreating the front and back halves of our insert via PCR using the Phusion polymerase.
July 8
(TR) Ran our PCR product out on a gel and found the PCR was unsuccessful yesterday. Will redo tomorrow.
July 9
(TR,CB) Again performed PCR to make our front and back halves, this time using q5 as our DNA polymerase. Running it on a gel afterward, we found we were successful. There was a band in both lanes at about the 500bp mark, just what we were looking for.
Week of July 18
July 14
(TR,CB) We took our PCR products and did a SOEing PCR reaction with q5 as the polymerase again.
July 16
(TR,CB) Took our SOEing PCR product and our vector and ran them on a low melt agarose gel at 80V for 1hr. Then cut out the bands for our insert and the vector (pSR47s plasmid).
Week of July 25
July 21
(TR,CB) When looking at our Common Procedures, we realized that we were not supposed to run our SOEing PCR product and vector on a low melt gel without first doing a restriction digest. We are going to try and save our product by doing the restriction digest by melting the insert at 65 degrees C and using that.
July 23
(TR,CB) Ran 5 ul of our restriction digest recovery on a gel and found that it didn't show up with anything. We will have to redo the SOEing PCR again. We are still having troubles getting the N multiformis to grow so we couldn't conjugate yet anyway.
Week of August 1
July 28
(TR,CB) Took the front and back halves of our insert and attempted to SOE them together again using q5 as polymerase. There is some talk now about where we are going to get the N multiformis from. Apparently a professor up at Utah State has worked with it and recommends we try either N europaea or N eutropha. She will grow all 3 and send them via same day delivery.
July 29
(TR) I ran the product from Monday on a gel and found our PCR didn't work this time.
July 30
(TR,CB) We began the process of researching about N europaea and N eutropha. Both would be easier to work with because they can withstand transformation through electroporation and N multiformis can't.
Week of August 8
Aug 4
(TR,CB) We received word that the N europaea is not growing, but the other two are, so we refined our research to just N eutropha. Using metacyc.org in conjunction with NCBI, we found that the serB gene in N eutropha would probably be the best gene to target in order to make N eutropha auxotrophic for serine.
Aug 6
(TR,CB) We did another SOEing PCR on the front and back of our N multiformis auxotrophy insert using q5.
Aug 7
(TR) I came in and checked the PCR from yesterday on a gel. It was unsuccessful again. I am not sure why it was working before but isn't now. I wonder if something happened to the PCR product we have frozen of our two halves. I am tempted to just focus on N eutropha now because we will be able to electroporate it, which will be much easier than conjugation.
Week of August 15
Aug 11
(TR,CB) The decision was made that, since we are probably not going to use N multiformis as our chassis any more, we will just focus on N eutropha for now.
Aug 13
(TR) I went ahead and designed primers to be used with N eutropha to knock out the SerB gene and hopefully make it auxotrophic for serine. Here they are;
Forward 1: overhang compatibility - bamHI - front of front 500 bp homology block
GAT - GGATCC - CGATACCTATGGGCATATTGCAG
Reverse 1: Reverse complement of ‘Forward 2’ primer (SOEing primer 2)
TCGAGACCGACGTGATTAAG - TGTATATCTGTACCTTGAAT
Forward 2: front and back of serB coding strand (SOEing primer 1)
ATTCAAGGTACAGATATACA - CTTAATCACGTCGGTCTCGA
Reverse 2: overhang compatibility - speI - reverse complement of back 500 bp homology block
ATC - ACTAGT - AGGAACGCCCCGTGATTATTGCG
Week of August 22
Aug 18
(TR,CB) We received the primers for our N eutropha auxotrophy insert, but are unable to start PCR on it because we have no template. We have decided that in the mean time, we are going to try and finish our cloning for N multiformis. We took template for N multiformis genomic DNA from a frozen stock to synthesize the 500bp front and back halves of our insert again. Then we used the Common Procedure for q5 high fidelity DNA Polymerase to do PCR.
Aug 20
(TR,CB) Ran a gel electrophoresis on Monday's PCR products. We saw that both, the front and back halves of our insert were present around the 500bp mark.
Week of August 29
Aug 25
(TR,CB) Performed SOEing PCR on the front and back halves of insert to go into pSR47s plasmid. We used the high fidelity q5 DNA polymerase.
Aug 26
(TR) Electrophoresed our SOEing PCR product. The gel came out with only a band around 500bp, so something didn't work correctly.
Aug 27
(TR,CB) Started another SOEing PCR to try and prepare the insert for cloning, using q5 DNA polymerase. Also started overnight cultures for some plasmid preps of the pSR47s plasmid, so that we have plenty of vector to work with.
Aug 28
(TR,CB) Performed a plasmid prep of the overnight cultures with pSR47s. Ran a gel electrophoresis of our PCR product and found that the SOEing didn't work again.
