Team:DTU-Denmark/Achievements/Parts

Our main part contribution is the Spinach2 BioBrick (BBa_xxx). Spinach is an RNA aptamer, developed at Cornell University, that binds and activates a fluorophore called DFHBI. Spinach2 is an improved version of Spinach with increased fluorescence. Spinach2 has not been included in any BioBrick until now.

The Spinach2 sequence contains an internal SpeI site, which makes it incompatible with the iGEM assembly standard. To overcome this we predicted several mutations that should not affect folding, and synthesized these mutated versions of the sequence. One of these mutated sequences, Spinach2.1, was confirmed to have fluorescence comparable to the original Spinach2.

Spinach2:   GATGTAACTGAATGAAATGGTGAAGGACGGGTCCAGTAGGCTGCTTCGGCAGCCTACTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTTACATC
Spinach2.1: GATGTATCTGAATGAAATGGTGAAGGACGGGTCCAGTAGGCTGCTTCGGCAGCCTACTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGATACATC

The sequences of Spinach2 and Spinach2.1 are shown above. The SpeI site is highlighted in blue. The two point mutations we introduced are highlighted in red.

[Image of the predicted folding of Spinach2 and Spinach2.1]

[Data on in vitro fluorescence comparisons of Spinach2 and Spinach2.1]

Our BioBrick contains the Spinach2.1 sequence flanked by a human tRNALys3 and followed by terminator BBa_B0052. This BioBrick can be combined with various promoters using Standard Assembly, allowing for rapid assays of different promoters’ activities.