Team:AMU-Poznan/Modeling
From 2014.igem.org
(Difference between revisions)
Line 92: | Line 92: | ||
analyzed sequence: | analyzed sequence: | ||
</br>CTAAAGAAGGTATATTGCTGTTGACAGTGAGCGACTGUUUGUAUUCGCCCUAGCGCCTGTGAAGCCACAGATGGGGCGCUAUGGCGAAUACAAACATGCC</br>TACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCA</br> | </br>CTAAAGAAGGTATATTGCTGTTGACAGTGAGCGACTGUUUGUAUUCGCCCUAGCGCCTGTGAAGCCACAGATGGGGCGCUAUGGCGAAUACAAACATGCC</br>TACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCA</br> | ||
- | + | We always take first generated structure made with default options</br> | |
+ | If there is difference in algoruthm we always take RNA folding over DNA folding</br> | ||
mfold</br> | mfold</br> | ||
- | + | <img src="" width="60%"> | |
</br> | </br> | ||
RNAstructure</br> | RNAstructure</br> |
Revision as of 08:28, 15 October 2014
Survey14.10.2014 31 survey responses: what survey answerers think that RNAi is what they think that sh-miRs are what they think that shRNAs are what literature do they know about sh-miRs what they find important in bioinformatic software what they find important in sh-miR designer how long will they wait for software response survey answerers their sex and age ModelingWe decided to pay more attention to model sh-miR molecules with different RNA 2D structure prediction software (we use RNAfold in our software). Here are our results: analyzed sequence: CTAAAGAAGGTATATTGCTGTTGACAGTGAGCGACTGUUUGUAUUCGCCCUAGCGCCTGTGAAGCCACAGATGGGGCGCUAUGGCGAAUACAAACATGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCA We always take first generated structure made with default options If there is difference in algoruthm we always take RNA folding over DNA folding mfold RNAstructure RNAfold RNA123 UNAfold AveRNA |