Team:AMU-Poznan/Modeling
From 2014.igem.org
(Difference between revisions)
Line 57: | Line 57: | ||
</table> | </table> | ||
</div> | </div> | ||
+ | </br> Here we present Survey results and Modeling results (for Modeling results please scroll down the page)</br> | ||
- | + | <br /><h1>Survey</h1><br /><br /> | |
- | <br />Survey<br /><br /> | + | |
14.10.2014<br /> | 14.10.2014<br /> | ||
31 survey responses:<br /> | 31 survey responses:<br /> | ||
Line 86: | Line 86: | ||
<img src="https://static.igem.org/mediawiki/2014/8/89/Chart3.png" width="60%"></br> | <img src="https://static.igem.org/mediawiki/2014/8/89/Chart3.png" width="60%"></br> | ||
</br></br></br> | </br></br></br> | ||
- | Modeling | + | <h1>Modeling</h1> |
</br> | </br> | ||
<p>We decided to pay more attention to model sh-miR molecules with different RNA 2D structure prediction software (we use RNAfold in our software). Here are our results:</p> | <p>We decided to pay more attention to model sh-miR molecules with different RNA 2D structure prediction software (we use RNAfold in our software). Here are our results:</p> | ||
</br></br> | </br></br> | ||
analyzed sequence: | analyzed sequence: | ||
- | </br> | + | </br>CTAAAGAAGGTATATTGCTGTTGACAGTGAGCGACTGUUUGUAUUCGCCCUAGCGCCTGTGAAGCCACAGATGGGGCGCUAUGGCGAAUACAAACATGCC</br>TACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCA</br> |
mfold</br> | mfold</br> |
Revision as of 07:15, 15 October 2014
Survey14.10.2014 31 survey responses: what survey answerers think that RNAi is what they think that sh-miRs are what they think that shRNAs are what literature do they know about sh-miRs what they find important in bioinformatic software what they find important in sh-miR designer how long will they wait for software response survey answerers their sex and age ModelingWe decided to pay more attention to model sh-miR molecules with different RNA 2D structure prediction software (we use RNAfold in our software). Here are our results: analyzed sequence: CTAAAGAAGGTATATTGCTGTTGACAGTGAGCGACTGUUUGUAUUCGCCCUAGCGCCTGTGAAGCCACAGATGGGGCGCUAUGGCGAAUACAAACATGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCA mfold RNAstructure RNAfold RNA123 UNAfold AveRNA |