Team:BYU Provo/Parts

From 2014.igem.org

(Difference between revisions)
Line 207: Line 207:
       <td>Plasmid</td>
       <td>Plasmid</td>
       <td>Jordan Berg</td>
       <td>Jordan Berg</td>
-
           <td>Please refer to part description found at parts.igem.org for full sequence and plasmid schematic.
+
           <td>Please refer to part description found at <a href="http://parts.igem.org/Part:BBa_K1356000">parts.igem.org</a> for full sequence and plasmid schematic.
<!--CTAGATCCGCGCGAGCAGGGGAAATTGACGGAAAA
<!--CTAGATCCGCGCGAGCAGGGGAAATTGACGGAAAA
       CCTATACCGGCCAGCAACAGGAATGCCGTAAGCAGCCG
       CCTATACCGGCCAGCAACAGGAATGCCGTAAGCAGCCG
Line 254: Line 254:
         <td>The TolB signaling sequence was synthesized using RNA primers overlap-extension PCR owing it the signaling sequence's large size. The mutation was done through mutagenic PCR.</td>
         <td>The TolB signaling sequence was synthesized using RNA primers overlap-extension PCR owing it the signaling sequence's large size. The mutation was done through mutagenic PCR.</td>
</tr>
</tr>
 +
 +
<tr>
 +
    <td><!--ENTER PART NAME--></td>
 +
    <td>BBa_K1356001</td>
 +
      <td></td>
 +
      <td>Plasmid</td>
 +
      <td><!--ENTER NAME--></td>
 +
          <td>Please refer to part description found at <a href="http://parts.igem.org/Part:BBa_K1356001">parts.igem.org</a> for full sequence and plasmid schematic.
 +
<!--ENTER SEQUENCE HERE AND KEEP NOTE TAGS--></td>
 +
        <td><!--ENTER PART DESCRIPTION--></td>
 +
        <td><!--ENTER DESIGN CONSIDERATIONS--></td>
 +
</tr>
 +
 +
<tr>
 +
    <td><!--ENTER PART NAME--></td>
 +
    <td>BBa_K1356002</td>
 +
      <td></td>
 +
      <td>Plasmid</td>
 +
      <td><!--ENTER NAME--></td>
 +
          <td>Please refer to part description found at <a href="http://parts.igem.org/Part:BBa_K1356002">parts.igem.org</a> for full sequence and plasmid schematic.
 +
<!--ENTER SEQUENCE HERE AND KEEP NOTE TAGS--></td>
 +
        <td><!--ENTER PART DESCRIPTION--></td>
 +
        <td><!--ENTER DESIGN CONSIDERATIONS--></td>
 +
</tr>
 +
<tr>
<tr>
     <td>Nitrite Reductase (<i>nirS</i>) from <i>Pseudomonas aeruginosa</i> PAO1</td>
     <td>Nitrite Reductase (<i>nirS</i>) from <i>Pseudomonas aeruginosa</i> PAO1</td>
Line 262: Line 287:
           <td>Please refer to part description found at <a href="http://parts.igem.org/Part:BBa_K1356003">parts.igem.org</a> for full sequence and plasmid schematic.
           <td>Please refer to part description found at <a href="http://parts.igem.org/Part:BBa_K1356003">parts.igem.org</a> for full sequence and plasmid schematic.
<!--ATGCCATTTGGCAAGCCACTGGTGGGCACCTTGCTCGCCTCGCTGACGCTGCTGGGCCTGGCCACCGCTCACGCCAAGGACGACATGAAAGCCGCCGAGCAATACCAGGGTGCCGCTTCCGCCGTCGATCCCGCTCACGTGGTGCGCACCAACGGTGCCCCCGACATGAGTGAAAGCGAGTTCAACGAGGCCAAGCAGATCTACTTCCAACGCTGCGCCGGTTGCCACGGCGTCCTGCGCAAGGGCGCCACCGGCAAGCCGCTGACCCCGGACATCACCCAGCAACGCGGCCAGCAATACCTGGAAGCGCTGATCACCTACGGCACCCCGCTGGGCATGCCGAACTGGGGCAGCTCCGGCGAGCTGAGCAAGGAACAGATCACCCTGATGGCCAAGTACATCCAGCACACCCCGCCGCAACCGCCGGAGTGGGGCATGCCGGAGATGCGCGAATCGTGGAAGGTGCTGGTGAAGCCGGAGGACCGGCCGAAGAAACAGCTCAACGACCTCGACCTGCCCAACCTGTTCTCGGTGACCCTGCGCGACGCCGGGCAGATCGCCCTGGTCGACGGCGACAGCAAGAAGATCGTCAAGGTCATCGATACCGGCTATGCCGTGCATATCTCGCGGATGTCCGCTTCCGGCCGCTACCTGCTGGTGATCGGCCGCGACGCGCGGATCGACATGATCGACCTGTGGGCCAAGGAGCCGACCAAGGTCGCCGAGATCAAGATCGGCATCGAGGCGCGCTCGGTGGAAAGCTCCAAGTTCAAGGGCTACGAGGACCGCTACACCATCGCCGGCGCCTACTGGCCGCCGCAGTTCGCGATCATGGACGGCGAGACCCTGGAACCGAAGCAGATCGTCTCCACCCGCGGCATGACCGTAGACACCCAGACCTACCACCCGGAACCGCGCGTGGCGGCGATCATCGCCTCCCACGAGCACCCCGAGTTCATCGTCAACGTGAAGGAGACCGGCAAGGTCCTGCTGGTCAACTACAAGGATATCGACAACCTCACCGTCACCAGCATCGGTGCGGCGCCGTTCCTCCACGACGGCGGCTGGGACAGCAGCCACCGCTACTTCATGACCGCCGCCAACAACTCCAACAAGGTTGCCGTGATCGACTCCAAGGACCGTCGCCTGTCGGCCCTGGTCGACGTCGGCAAGACCCCGCACCCGGGGCGTGGCGCCAACTTCGTGCATCCCAAGTACGGCCCGGTGTGGAGCACCAGCCACCTGGGCGACGGCAGCATCTCGCTGATCGGCACCGATCCGAAGAACCATCCGCAGTACGCCTGGAAGAAAGTCGCCGAACTACAGGGCCAGGGCGGCGGCTCGCTGTTCATCAAGACCCATCCGAAGTCCTCGCACCTCTACGTCGACACCACCTTCAACCCCGACGCCAGGATCAGCCAGAGCGTCGCGGTGTTCGACCTGAAGAACCTCGACGCCAAGTACCAGGTGCTGCCGATCGCCGAATGGGCCGATCTCGGCGAAGGCGCCAAGCGGGTGGTGCAGCCCGAGTACAACAAGCGCGGCGATGAAGTCTGGTTCTCGGTGTGGAACGGCAAGAACGACAGCTCCGCGCTGGTGGTGGTGGACGACAAGACCCTGAAGCTCAAGGCCGTGGTCAAGGACCCGCGGCTGATCACCCCGACCGGTAAGTTCAACGTCTACAACACCCAGCACGACGTGTACTGA--></td>
<!--ATGCCATTTGGCAAGCCACTGGTGGGCACCTTGCTCGCCTCGCTGACGCTGCTGGGCCTGGCCACCGCTCACGCCAAGGACGACATGAAAGCCGCCGAGCAATACCAGGGTGCCGCTTCCGCCGTCGATCCCGCTCACGTGGTGCGCACCAACGGTGCCCCCGACATGAGTGAAAGCGAGTTCAACGAGGCCAAGCAGATCTACTTCCAACGCTGCGCCGGTTGCCACGGCGTCCTGCGCAAGGGCGCCACCGGCAAGCCGCTGACCCCGGACATCACCCAGCAACGCGGCCAGCAATACCTGGAAGCGCTGATCACCTACGGCACCCCGCTGGGCATGCCGAACTGGGGCAGCTCCGGCGAGCTGAGCAAGGAACAGATCACCCTGATGGCCAAGTACATCCAGCACACCCCGCCGCAACCGCCGGAGTGGGGCATGCCGGAGATGCGCGAATCGTGGAAGGTGCTGGTGAAGCCGGAGGACCGGCCGAAGAAACAGCTCAACGACCTCGACCTGCCCAACCTGTTCTCGGTGACCCTGCGCGACGCCGGGCAGATCGCCCTGGTCGACGGCGACAGCAAGAAGATCGTCAAGGTCATCGATACCGGCTATGCCGTGCATATCTCGCGGATGTCCGCTTCCGGCCGCTACCTGCTGGTGATCGGCCGCGACGCGCGGATCGACATGATCGACCTGTGGGCCAAGGAGCCGACCAAGGTCGCCGAGATCAAGATCGGCATCGAGGCGCGCTCGGTGGAAAGCTCCAAGTTCAAGGGCTACGAGGACCGCTACACCATCGCCGGCGCCTACTGGCCGCCGCAGTTCGCGATCATGGACGGCGAGACCCTGGAACCGAAGCAGATCGTCTCCACCCGCGGCATGACCGTAGACACCCAGACCTACCACCCGGAACCGCGCGTGGCGGCGATCATCGCCTCCCACGAGCACCCCGAGTTCATCGTCAACGTGAAGGAGACCGGCAAGGTCCTGCTGGTCAACTACAAGGATATCGACAACCTCACCGTCACCAGCATCGGTGCGGCGCCGTTCCTCCACGACGGCGGCTGGGACAGCAGCCACCGCTACTTCATGACCGCCGCCAACAACTCCAACAAGGTTGCCGTGATCGACTCCAAGGACCGTCGCCTGTCGGCCCTGGTCGACGTCGGCAAGACCCCGCACCCGGGGCGTGGCGCCAACTTCGTGCATCCCAAGTACGGCCCGGTGTGGAGCACCAGCCACCTGGGCGACGGCAGCATCTCGCTGATCGGCACCGATCCGAAGAACCATCCGCAGTACGCCTGGAAGAAAGTCGCCGAACTACAGGGCCAGGGCGGCGGCTCGCTGTTCATCAAGACCCATCCGAAGTCCTCGCACCTCTACGTCGACACCACCTTCAACCCCGACGCCAGGATCAGCCAGAGCGTCGCGGTGTTCGACCTGAAGAACCTCGACGCCAAGTACCAGGTGCTGCCGATCGCCGAATGGGCCGATCTCGGCGAAGGCGCCAAGCGGGTGGTGCAGCCCGAGTACAACAAGCGCGGCGATGAAGTCTGGTTCTCGGTGTGGAACGGCAAGAACGACAGCTCCGCGCTGGTGGTGGTGGACGACAAGACCCTGAAGCTCAAGGCCGTGGTCAAGGACCCGCGGCTGATCACCCCGACCGGTAAGTTCAACGTCTACAACACCCAGCACGACGTGTACTGA--></td>
-
         <td>This gene codes for the nitrite reductase (<i>nirS</i>) that converts nitrite (NO2-) into nitric oxide (NO). This conversion is the first step in the denitrification pathway from nitrite (NO2-) to nitrogen gas (N2). Please refer to <a href="https://static.igem.org/mediawiki/parts/1/1c/DenitrificationSkematic2.pdf">this image</a> for a schematic of the denitrification pathway.</td>
+
         <td>This gene codes for the nitrite reductase (<i>nirS</i>) that converts nitrite (NO<sup>2-</sup>) into nitric oxide (NO). This conversion is the first step in the denitrification pathway from nitrite (NO<sup>2-</sup>) to nitrogen gas (N<sub>2</sub>). Please refer to <a href="https://static.igem.org/mediawiki/parts/1/1c/DenitrificationSkematic2.pdf">this image</a> for a schematic of the denitrification pathway.</td>
         <td>This gene was cloned from <i>Pseudomonas aeruginosa</i> PAO1 genomic DNA into pSB1C3 using the <i>Xba</i>I and <i>Spe</i>I restriction sites. Correct sequence and orientation were confirmed using 454 Pyrosequencing (BYU).</td>
         <td>This gene was cloned from <i>Pseudomonas aeruginosa</i> PAO1 genomic DNA into pSB1C3 using the <i>Xba</i>I and <i>Spe</i>I restriction sites. Correct sequence and orientation were confirmed using 454 Pyrosequencing (BYU).</td>
</tr>
</tr>
 +
<tr>
 +
    <td>Nitric oxide reductase (<i>norC</i>) from <i>Pseudomonas aeruginosa</i> PAO1</td>
 +
    <td>BBa_K1356004</td>
 +
      <td></td>
 +
      <td>Plasmid</td>
 +
      <td>Cameron Sargent</td>
 +
          <td>Please refer to part description found at <a href="http://parts.igem.org/Part:BBa_K1356004">parts.igem.org</a> for full sequence and plasmid schematic.
 +
<!--ATGTCCGAGACCTTTACCAAAGGCATGGCCAGGAACATCTATTTCGGCGGGAGTGTGTTCTTCATCCTGCTGTTCCTGGCCCTGACCTACCACACCGAGAAGACCCTGCCCGAGCGCACCAACGAGGCCGCGATGAGCGCCGCGGTGGTGCGCGGCAAGCTGGTCTGGGAACAGAACAACTGCGTCGGCTGCCACACCCTGCTCGGCGAGGGCGCCTACTTCGCGCCGGAGCTGGGCAACGTGGTCGGACGCCGTGGCGGCGAGGAGGGCTTCAACACCTTCCTCCAGGCCTGGATGAATATCCAGCCGCTGAACGTGCCGGGCCGCCGCGCCATGCCGCAGTTCCATCTCAGCGAGGGCCAGGTCGACGACCTGGCCGAGTTCCTCAAGTGGAGCTCGAAGATCGATACCAACCAATGGCCGCCGAACAAGGAGGGTTGA--></td>
 +
        <td>This gene codes for one of the nitric oxide reductase subunits (<i>norC</i>) that, in connection with the other subunit (<i>norB</i>), converts nitric oxide (NO) into nitrous oxide (N<sub>2</sub>O). This conversion is the second step in the denitrification pathway from nitrite (NO<sup>2-</sup>) to nitrogen gas (N<sub>2</sub>). Please refer to <a href="https://static.igem.org/mediawiki/parts/1/1c/DenitrificationSkematic2.pdf">this image</a> for a schematic of the denitrification pathway.</td>
 +
        <td>This gene was cloned from <i>Pseudomonas aeruginosa</i> PAO1 genomic DNA into pSB1C3 using the <i>Xba</i>I and <i>Spe</i>I restriction sites. Correct sequence and orientation were confirmed using 454 Pyrosequencing (BYU).</td>
 +
</tr>
 +
<tr>
 +
    <td>Nitric oxide reductase (<i>norB</i>) from <i>Pseudomonas aeruginosa</i> PAO1</td>
 +
    <td>BBa_K1356005</td>
 +
      <td></td>
 +
      <td>Plasmid</td>
 +
      <td>Cameron Sargent</td>
 +
          <td>Please refer to part description found at <a href="http://parts.igem.org/Part:BBa_K1356005">parts.igem.org</a> for full sequence and plasmid schematic.
 +
<!--ATGATGTCGCCCAATGGCTCCCTGAAATTCGCCTCGCAGGCGGTCGCCAAACCCTACTTCGTGTTCGCCCTGATCCTCTTCGTCGGGCAGATCCTGTTCGGCCTGATCATGGGCCTTCAGTACGTGGTCGGCGACTTCCTGTTCCCGGCGATCCCCTTCAACGTCGCGCGCATGGTGCACACCAACCTGCTGATCGTCTGGCTGCTGTTCGGCTTCATGGGCGCTGCCTACTACCTGGTGCCGGAGGAGAGCGACTGCGAGCTGTACAGCCCGAAGCTGGCCTGGATCCTGTTCTGGGTATTCGCCGCCGCCGGCGTGCTGACCATCCTCGGCTACCTGCTGGTGCCCTACGCCGGCCTGGCCAGGCTCACCGGCAACGAACTGTGGCCGACCATGGGCCGCGAGTTCCTCGAACAGCCGACCATCAGCAAGGCGGGCATCGTGATCGTCGCCCTGGGCTTCCTGTTCAAACCTCACCCGCGACAAGTTCTACTGGTGGTGGGTGGTGCACCTGTGGGTGGAAGGCGTGTGGGAACTGATCATGGGTGCGATCCTCGCCTTCGTGCTGGTGAAGATCACCACGTCGGCATGACCGTGCTGCGCGGGCGCAAGACCGCCATCAGCATGGTCCTGATGACCGGCCTGATCGGCCTCGCCCTGCTGTTCCTGTTCTCCTTCTACAACCCGGAAGGGGTCGACCGCGAGGTGATCGAGAAGTGGCTCTACGTGATCATCGCCATGGCGCTGATCAGCGGCATCATCGGCACCGGCCACCACTACTTCTGGATCGGCGTGCCCGGCTACTGGCTGTGGCTCGGCTCGGTATTCTCGGCGCTGGAGCCGCTGCCGTTCTTCGCCATGGTGCTGTTCGCCTTCAACACCATCAACCGCCGCCGCCGCCGCGACTATCCGAACCGCGCGGTCGCGCTGTGGGCCATGGGCACCACAGTGATGGCCTTCCTCGGCGCGGGAGTGTGGGGCTTCATGCATACCCTGGCGCCGGTCAACTACTACACCCACGGCACCCAGCTCACCGCCGCCCACGGCCACATGGCCTTCTATGGCGCCTACGCGATGATCGTGATGACCATCATCTCCTACGCCATGCCGCGCCTGCGCGGGATCGGCGAGGCGATGGACAACCGCTCGCAGGTCCTGGAGATGTGGGGCTTCTGGCTGATGACCGTGGCGATGGTGTTCATCACCCTGTTCCTCTCCGCGGCCGGGGTGCTACAGGTCTGGCTGCAACGGATGCCGGCGGACGGCGCGGCGATGACCTTCATGGCCACCCAGGACCAGCTGGCGATCTTCTACTGGCTGCGCGAAGGCGCCGGGGTGGTGTTCCTCATCGGCCTGGTCGCCTACCTGCTGAGCTTCCGGCGCGGCAAGGCGGCCGCCTGA--></td>
 +
        <td>This gene codes for one of the nitric oxide reductase subunits (<i>norB</i>) that, in connection with the other subunit (<i>norC</i>), converts nitric oxide (NO) into nitrous oxide (N<sub>2</sub>O). This conversion is the second step in the denitrification pathway from nitrite (NO<sup>2-</sup>) to nitrogen gas (N<sub>2</sub>). Please refer to <a href="https://static.igem.org/mediawiki/parts/1/1c/DenitrificationSkematic2.pdf">this image</a> for a schematic of the denitrification pathway.</td>
 +
        <td>This gene was cloned from <i>Pseudomonas aeruginosa</i> PAO1 genomic DNA into pSB1C3 using the <i>Xba</i>I and <i>Spe</i>I restriction sites. Correct sequence and orientation were confirmed using 454 Pyrosequencing (BYU). The original sequence contained <i>Pst</i>I sites starting at bases 115 and 1,231. These sequences were changed to CTTCAG and CTACAG, respectively, using site-specific mutagenesis; the mutant sites were verified to code for the same amino acids. Mutagenesis was also confirmed using 454 Pyrosequencing (BYU). </td>
 +
</tr>
-
 
+
<tr>
 +
    <td>Nitrous oxide reductase (<i>nosZ</i>) from <i>Pseudomonas aeruginosa</i> PAO1</td>
 +
    <td>BBa_K1356006</td>
 +
      <td></td>
 +
      <td>Plasmid</td>
 +
      <td>Cameron Sargent</td>
 +
          <td>Please refer to part description found at <a href="http://parts.igem.org/Part:BBa_K1356006">parts.igem.org</a> for full sequence and plasmid schematic.
 +
<!--ATGAGCGACGACACGAAAAGCCCCCACGAAGAAACCCACGGCCTGAACCGCCGCGGCTTCCTCGGCGCCTCGGCGCTGACCGGAGCCGCCGCCCTGGTTGGCGCCAGCGCCCTGGGCAGCGCGGTGGTCGGCCGCGAGGCCCGGGCCGCGGGCAAGGGCGAGCGCAGCAAGGCCGAGGTCGCCCCCGGCGAACTGGATGAGTACTACGGGTTCTGGAGCGGCGGACATTCCGGCGAAGTACGCGTGCTCGGCGTGCCGTCGATGCGCGAGCTGATGCGCATACCGGTGTTCAACGTCGACTCGGCCACCGGCTGGGGCCTGACCAACGAGAGCAAGCGGGTCCTCGGCGACAGCGCGCGCTTCCTCAACGGCGACTGCCACCATCCGCACATCTCGATGACCGACGGCAAGTACGACGGCAAGTACCTGTTCATCAACGACAAGGCCAACAGCCGGGTCGCGCGCATCCGCCTGGACGTCATGAAATGCGACCGCATCGTCACCATTCCCAACGTCCAGGCGATCCACGGCCTGCGCCTGCAAAAGGTGCCGCATACCCGCTACGTGTTCTGCAACGCCGAGTTCATCATCCCCCATCCCAACGACGGCTCGACCTTCGACCTGTCCGGCGACAACGCCTTCACCCTGTACAACGCCATCGACGCCGAGACCATGGAAGTGGCCTGGCAGGTGATCGTCGACGGCAACCTCGACAACACCGACATGGACTACAGCGGCAGGTTCGCCGCCTCCACCTGCTACAACTCGGAGAAGGCCGTCGACCTCGGCGGCATGATGCGCAACGAGCGCGACTGGGTGGTGGTGTTCGACATCCCGCGCATCGAGGCCGAGATCAAGGCGAAGCGCTTCGTCACCCTCGGCGACTCGAAGGTGCCGGTGGTCGACGGCCGGCGCAAGGACGGCAAGGACAGCCCGGTGACCCGCTACATCCCGGTACCGAAGAACCCCCACGGGCTGAACACCTCGCCGGACGGCAAGTACTTCATCGCCAACGGCAAGCTCTCGCCGACCTGCACCATGATCGCCATCGAGCGCCTCGGCGACCTGTTCGCCGGCAAGCTGGCCGACCCGCGCGACGTGGTGGTGGGCGAGCCGGAACTGGGCCTCGGCCCGCTGCACACCACTTTCGATGGCCGAGGCAACGCCTATACCACGCTGTTCATCGACAGCCAGTTGGTGAAGTGGAACCTGGCCGACGCGGTGCGCGCCTACAAGGGCGAGAAGGTCGACTACATCCGCCAGAAACTCGACGTGCAGTACCAGCCGGGGCACAACCACGCCACCCTGTGCGAGACCAGCGAAGCCGACGGCAAGTGGATCGTGGTGCTCAGCAAGTTCTCCAAGGACCGCTTCCTGCCCACCGGTCCGCTGCACCCGGAGAACGACCAGTTGATCGACATTTCCGGCGAGGAAATGAAGCTGGTCCACGACGGCCCGACCTTCGCCGAACCGCACGATTGCATCCTCGCCCGCCGCGACCAGATCAAGACCCGCAAGATCTGGGACCGCAAGGACCCGTTCTTCGCCGAGACGGTCAAGCGCGCGGAAAAGGACGGCATCGACCTGATGAAGGACAACAAGGTCATCCGCGAGGGCAACAAGGTCCGCGTCTACATGGTCTCGATGGCGCCCTCCTTCGGCCTCACCGAGTTCAAGGTGAAGCAGGGCGACGAAGTCACCGTGACCATCACCAACCTCGACGAGATCGAGGACGTGACCCACGGCTTCGTCATGGTCAACCACGGCGTCTGCATGGAGATCAGCCCGCAACAGACCTCGTCGATCACCTTCGTCGCCGATAAGCCCGGGGTGCACTGGTACTACTGCAGCTGGTTCTGCCACGCCCTGCACATGGAAATGTGCGGGCGGATGCTGGTGGAAAAGGCTTGA--></td>
 +
        <td>This gene codes for the nitrous oxide reductase (<i>nosZ</i>) that converts nitrous oxide (N<sub>2</sub>O) into nitrogen gas (N<sub>2</sub>). This conversion is the third and final step in the denitrification pathway from nitrite (NO<sup>2-</sup>) to nitrogen gas (N<sub>2</sub>). Please refer to <a href="https://static.igem.org/mediawiki/parts/1/1c/DenitrificationSkematic2.pdf">this image</a> for a schematic of the denitrification pathway.</td>
 +
        <td>This gene was cloned from <i>Pseudomonas aeruginosa</i> PAO1 genomic DNA into pSB1C3 using the <i>Xba</i>I and <i>Spe</i>I restriction sites. Correct sequence and orientation were confirmed using 454 Pyrosequencing (BYU). This sequence contains a <i>Pst</i>I site starting at base 1845.</td>
 +
</tr>

Revision as of 04:05, 9 October 2014


BYU 2014 Team Parts



Click here to edit this page!

Home Team Official Team Profile Project Parts Modeling Notebook Safety Attributions

Parts Submitted to the Registry

What information do I need to start putting my parts on the Registry?

An important aspect of the iGEM competition is the use and creation of standard biological parts. Each team will make new parts during iGEM and will submit them to the Registry of Standard Biological Parts. The iGEM software provides an easy way to present the parts your team has created. The "groupparts" tag will generate a table with all of the parts that your team adds to your team sandbox.

Note that if you want to document a part you need to document it on the Registry, not on your team wiki. Future teams and other users and are much more likely to find parts on the Registry than on your team wiki.

Remember that the goal of proper part documentation is to describe and define a part, so that it can be used without a need to refer to the primary literature. Registry users in future years should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.

When should you put parts into the Registry?

As soon as possible! We encourage teams to start completing documentation for their parts on the Registry as soon as you have it available. The sooner you put up your parts, the better recall you will have of all details surrounding your parts. Remember you don't need to send us the DNA to create an entry for a part on the Registry. However, you must send us the sample/DNA before the Jamboree. Only parts for which you have sent us samples/DNA are eligible for awards and medal requirements.

The information needed to initially create a part on the Registry is:

  1. Part Name
  2. Part type
  3. Creator
  4. Sequence
  5. Short Description (60 characters on what the DNA does)
  6. Long Description (Longer description of what the DNA does)
  7. Design considerations

We encourage you to put up much more information as you gather it over the summer. If you have images, plots, characterization data and other information, please also put it up on the part page. Check out part BBa_K404003 for an excellent example of a highly characterized part.

You can add parts to the Registry at our Add a Part to the Registry link.

2014 BYU iGEM Parts Database
Part NameiGEM Database Part IDGrose Lab Part IDPart typeCreatorSequenceDescriptionDesign considerations
Alpha Amylase with Signaling Sequence and PstI Site Removed BBa_K1356000 Plasmid Jordan Berg Please refer to part description found at parts.igem.org for full sequence and plasmid schematic. This is the alpha amylase taken from part BBa_K1195001. Attached to it is a TolB signaling sequence meant to all the gene product to be expressed extracellularly in N. multiformis in the break down of biofilm in wastewater treatment plants. Additionally, the PstI site originally found in the BBa_K1195001 part was removed using site-directed mutagenesis. The restriction site was changed from "CTGCAG" to "CTCCAG". This gene is located in the standard iGEM pSB1C3 plasmid backbone. The TolB signaling sequence was synthesized using RNA primers overlap-extension PCR owing it the signaling sequence's large size. The mutation was done through mutagenic PCR.
BBa_K1356001 Plasmid Please refer to part description found at parts.igem.org for full sequence and plasmid schematic.
BBa_K1356002 Plasmid Please refer to part description found at parts.igem.org for full sequence and plasmid schematic.
Nitrite Reductase (nirS) from Pseudomonas aeruginosa PAO1 BBa_K1356003 Plasmid Cameron Sargent Please refer to part description found at parts.igem.org for full sequence and plasmid schematic. This gene codes for the nitrite reductase (nirS) that converts nitrite (NO2-) into nitric oxide (NO). This conversion is the first step in the denitrification pathway from nitrite (NO2-) to nitrogen gas (N2). Please refer to this image for a schematic of the denitrification pathway. This gene was cloned from Pseudomonas aeruginosa PAO1 genomic DNA into pSB1C3 using the XbaI and SpeI restriction sites. Correct sequence and orientation were confirmed using 454 Pyrosequencing (BYU).
Nitric oxide reductase (norC) from Pseudomonas aeruginosa PAO1 BBa_K1356004 Plasmid Cameron Sargent Please refer to part description found at parts.igem.org for full sequence and plasmid schematic. This gene codes for one of the nitric oxide reductase subunits (norC) that, in connection with the other subunit (norB), converts nitric oxide (NO) into nitrous oxide (N2O). This conversion is the second step in the denitrification pathway from nitrite (NO2-) to nitrogen gas (N2). Please refer to this image for a schematic of the denitrification pathway. This gene was cloned from Pseudomonas aeruginosa PAO1 genomic DNA into pSB1C3 using the XbaI and SpeI restriction sites. Correct sequence and orientation were confirmed using 454 Pyrosequencing (BYU).
Nitric oxide reductase (norB) from Pseudomonas aeruginosa PAO1 BBa_K1356005 Plasmid Cameron Sargent Please refer to part description found at parts.igem.org for full sequence and plasmid schematic. This gene codes for one of the nitric oxide reductase subunits (norB) that, in connection with the other subunit (norC), converts nitric oxide (NO) into nitrous oxide (N2O). This conversion is the second step in the denitrification pathway from nitrite (NO2-) to nitrogen gas (N2). Please refer to this image for a schematic of the denitrification pathway. This gene was cloned from Pseudomonas aeruginosa PAO1 genomic DNA into pSB1C3 using the XbaI and SpeI restriction sites. Correct sequence and orientation were confirmed using 454 Pyrosequencing (BYU). The original sequence contained PstI sites starting at bases 115 and 1,231. These sequences were changed to CTTCAG and CTACAG, respectively, using site-specific mutagenesis; the mutant sites were verified to code for the same amino acids. Mutagenesis was also confirmed using 454 Pyrosequencing (BYU).
Nitrous oxide reductase (nosZ) from Pseudomonas aeruginosa PAO1 BBa_K1356006 Plasmid Cameron Sargent Please refer to part description found at parts.igem.org for full sequence and plasmid schematic. This gene codes for the nitrous oxide reductase (nosZ) that converts nitrous oxide (N2O) into nitrogen gas (N2). This conversion is the third and final step in the denitrification pathway from nitrite (NO2-) to nitrogen gas (N2). Please refer to this image for a schematic of the denitrification pathway. This gene was cloned from Pseudomonas aeruginosa PAO1 genomic DNA into pSB1C3 using the XbaI and SpeI restriction sites. Correct sequence and orientation were confirmed using 454 Pyrosequencing (BYU). This sequence contains a PstI site starting at base 1845.




Retrieved from "http://2014.igem.org/Team:BYU_Provo/Parts"