Team:BYU Provo/Parts
From 2014.igem.org
Line 139: | Line 139: | ||
<table border="4" align="center" style="margin-top:10px; margin-left:35px; margin-right:35px"> | <table border="4" align="center" style="margin-top:10px; margin-left:35px; margin-right:35px"> | ||
- | <thead><th colspan="8" align="center">2014 BYU | + | <thead><th colspan="8" align="center">2014 BYU iGEM Parts Database</th></thead> |
- | <tr><td>Part Name</td><td> | + | <tr><td>Part Name</td><td>iGEM Database Part ID</td><td>Grose Lab Part ID</td><td>Part type</td><td>Creator</td><td>Sequence</td><td>Description</td><td>Design considerations</td> |
<!--<tr> | <!--<tr> | ||
<td>Amylase Forward Primer (Signaling Sequence)</td> | <td>Amylase Forward Primer (Signaling Sequence)</td> | ||
Line 207: | Line 207: | ||
<td>Plasmid</td> | <td>Plasmid</td> | ||
<td>Jordan Berg</td> | <td>Jordan Berg</td> | ||
- | <td>Please refer to part description found at parts.igem.org for full sequence and plasmid schematic | + | <td>Please refer to part description found at parts.igem.org for full sequence and plasmid schematic. |
<!--CTAGATCCGCGCGAGCAGGGGAAATTGACGGAAAA | <!--CTAGATCCGCGCGAGCAGGGGAAATTGACGGAAAA | ||
CCTATACCGGCCAGCAACAGGAATGCCGTAAGCAGCCG | CCTATACCGGCCAGCAACAGGAATGCCGTAAGCAGCCG | ||
Line 251: | Line 251: | ||
ACGGCGGCAGCGTCAGCGTGTGGGTTATCGAAGAGGTG | ACGGCGGCAGCGTCAGCGTGTGGGTTATCGAAGAGGTG | ||
ATTTAA--></td> | ATTTAA--></td> | ||
- | <td>This is the alpha amylase taken from part BBa_K1195001. Attached to it is a TolB signaling sequence meant to all the gene product to be expressed extracellularly in <em>N. multiformis</em> in the break down of biofilm in wastewater treatment plants. Additionally, the PstI site originally found in the BBa_K1195001 part was removed using site-directed mutagenesis. The restriction site was changed from "CTGCAG" to "CTCCAG". This gene is located in the standard | + | <td>This is the alpha amylase taken from part BBa_K1195001. Attached to it is a TolB signaling sequence meant to all the gene product to be expressed extracellularly in <em>N. multiformis</em> in the break down of biofilm in wastewater treatment plants. Additionally, the PstI site originally found in the BBa_K1195001 part was removed using site-directed mutagenesis. The restriction site was changed from "CTGCAG" to "CTCCAG". This gene is located in the standard iGEM pSB1C3 plasmid backbone.</td> |
<td>The TolB signaling sequence was synthesized using RNA primers overlap-extension PCR owing it the signaling sequence's large size. The mutation was done through mutagenic PCR.</td> | <td>The TolB signaling sequence was synthesized using RNA primers overlap-extension PCR owing it the signaling sequence's large size. The mutation was done through mutagenic PCR.</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>Nitrite Reductase (<i>nirS</i>) from <i>Pseudomonas aeruginosa</i> PAO1</td> | ||
+ | <td>BBa_K1356003</td> | ||
+ | <td></td> | ||
+ | <td>Plasmid</td> | ||
+ | <td>Cameron Sargent</td> | ||
+ | <td>Please refer to part description found at <a href="http://parts.igem.org/Part:BBa_K1356003">parts.igem.org</a> for full sequence and plasmid schematic. | ||
+ | <!--ATGCCATTTGGCAAGCCACTGGTGGGCACCTTGCTCGCCTCGCTGACGCTGCTGGGCCTGGCCACCGCTCACGCCAAGGACGACATGAAAGCCGCCGAGCAATACCAGGGTGCCGCTTCCGCCGTCGATCCCGCTCACGTGGTGCGCACCAACGGTGCCCCCGACATGAGTGAAAGCGAGTTCAACGAGGCCAAGCAGATCTACTTCCAACGCTGCGCCGGTTGCCACGGCGTCCTGCGCAAGGGCGCCACCGGCAAGCCGCTGACCCCGGACATCACCCAGCAACGCGGCCAGCAATACCTGGAAGCGCTGATCACCTACGGCACCCCGCTGGGCATGCCGAACTGGGGCAGCTCCGGCGAGCTGAGCAAGGAACAGATCACCCTGATGGCCAAGTACATCCAGCACACCCCGCCGCAACCGCCGGAGTGGGGCATGCCGGAGATGCGCGAATCGTGGAAGGTGCTGGTGAAGCCGGAGGACCGGCCGAAGAAACAGCTCAACGACCTCGACCTGCCCAACCTGTTCTCGGTGACCCTGCGCGACGCCGGGCAGATCGCCCTGGTCGACGGCGACAGCAAGAAGATCGTCAAGGTCATCGATACCGGCTATGCCGTGCATATCTCGCGGATGTCCGCTTCCGGCCGCTACCTGCTGGTGATCGGCCGCGACGCGCGGATCGACATGATCGACCTGTGGGCCAAGGAGCCGACCAAGGTCGCCGAGATCAAGATCGGCATCGAGGCGCGCTCGGTGGAAAGCTCCAAGTTCAAGGGCTACGAGGACCGCTACACCATCGCCGGCGCCTACTGGCCGCCGCAGTTCGCGATCATGGACGGCGAGACCCTGGAACCGAAGCAGATCGTCTCCACCCGCGGCATGACCGTAGACACCCAGACCTACCACCCGGAACCGCGCGTGGCGGCGATCATCGCCTCCCACGAGCACCCCGAGTTCATCGTCAACGTGAAGGAGACCGGCAAGGTCCTGCTGGTCAACTACAAGGATATCGACAACCTCACCGTCACCAGCATCGGTGCGGCGCCGTTCCTCCACGACGGCGGCTGGGACAGCAGCCACCGCTACTTCATGACCGCCGCCAACAACTCCAACAAGGTTGCCGTGATCGACTCCAAGGACCGTCGCCTGTCGGCCCTGGTCGACGTCGGCAAGACCCCGCACCCGGGGCGTGGCGCCAACTTCGTGCATCCCAAGTACGGCCCGGTGTGGAGCACCAGCCACCTGGGCGACGGCAGCATCTCGCTGATCGGCACCGATCCGAAGAACCATCCGCAGTACGCCTGGAAGAAAGTCGCCGAACTACAGGGCCAGGGCGGCGGCTCGCTGTTCATCAAGACCCATCCGAAGTCCTCGCACCTCTACGTCGACACCACCTTCAACCCCGACGCCAGGATCAGCCAGAGCGTCGCGGTGTTCGACCTGAAGAACCTCGACGCCAAGTACCAGGTGCTGCCGATCGCCGAATGGGCCGATCTCGGCGAAGGCGCCAAGCGGGTGGTGCAGCCCGAGTACAACAAGCGCGGCGATGAAGTCTGGTTCTCGGTGTGGAACGGCAAGAACGACAGCTCCGCGCTGGTGGTGGTGGACGACAAGACCCTGAAGCTCAAGGCCGTGGTCAAGGACCCGCGGCTGATCACCCCGACCGGTAAGTTCAACGTCTACAACACCCAGCACGACGTGTACTGA--></td> | ||
+ | <td>This gene codes for the nitrite reductase (<i>nirS</i>) that converts nitrite (NO2-) into nitric oxide (NO). This conversion is the first step in the denitrification pathway from nitrite (NO2-) to nitrogen gas (N2). Please refer to <a href="https://static.igem.org/mediawiki/parts/1/1c/DenitrificationSkematic2.pdf">this image</a> for a schematic of the denitrification pathway.</td> | ||
+ | <td>This gene was cloned from <i>Pseudomonas aeruginosa</i> PAO1 genomic DNA into pSB1C3 using the <i>Xba</i>I and <i>Spe</i>I restriction sites. Correct sequence and orientation were confirmed using 454 Pyrosequencing (BYU).</td> | ||
</tr> | </tr> | ||
Revision as of 03:46, 9 October 2014
BYU 2014 Team Parts |
||||||||||||
| ||||||||||||
Parts Submitted to the Registry |
What information do I need to start putting my parts on the Registry? |
|||||||||||
An important aspect of the iGEM competition is the use and creation of standard biological parts. Each team will make new parts during iGEM and will submit them to the Registry of Standard Biological Parts. The iGEM software provides an easy way to present the parts your team has created. The "groupparts" tag will generate a table with all of the parts that your team adds to your team sandbox. Note that if you want to document a part you need to document it on the Registry, not on your team wiki. Future teams and other users and are much more likely to find parts on the Registry than on your team wiki. Remember that the goal of proper part documentation is to describe and define a part, so that it can be used without a need to refer to the primary literature. Registry users in future years should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more. When should you put parts into the Registry?As soon as possible! We encourage teams to start completing documentation for their parts on the Registry as soon as you have it available. The sooner you put up your parts, the better recall you will have of all details surrounding your parts. Remember you don't need to send us the DNA to create an entry for a part on the Registry. However, you must send us the sample/DNA before the Jamboree. Only parts for which you have sent us samples/DNA are eligible for awards and medal requirements. |
The information needed to initially create a part on the Registry is:
We encourage you to put up much more information as you gather it over the summer. If you have images, plots, characterization data and other information, please also put it up on the part page. Check out part BBa_K404003 for an excellent example of a highly characterized part. You can add parts to the Registry at our Add a Part to the Registry link. |
2014 BYU iGEM Parts Database | |||||||
---|---|---|---|---|---|---|---|
Part Name | iGEM Database Part ID | Grose Lab Part ID | Part type | Creator | Sequence | Description | Design considerations |
Alpha Amylase with Signaling Sequence and PstI Site Removed | BBa_K1356000 | Plasmid | Jordan Berg | Please refer to part description found at parts.igem.org for full sequence and plasmid schematic. | This is the alpha amylase taken from part BBa_K1195001. Attached to it is a TolB signaling sequence meant to all the gene product to be expressed extracellularly in N. multiformis in the break down of biofilm in wastewater treatment plants. Additionally, the PstI site originally found in the BBa_K1195001 part was removed using site-directed mutagenesis. The restriction site was changed from "CTGCAG" to "CTCCAG". This gene is located in the standard iGEM pSB1C3 plasmid backbone. | The TolB signaling sequence was synthesized using RNA primers overlap-extension PCR owing it the signaling sequence's large size. The mutation was done through mutagenic PCR. | |
Nitrite Reductase (nirS) from Pseudomonas aeruginosa PAO1 | BBa_K1356003 | Plasmid | Cameron Sargent | Please refer to part description found at parts.igem.org for full sequence and plasmid schematic. | This gene codes for the nitrite reductase (nirS) that converts nitrite (NO2-) into nitric oxide (NO). This conversion is the first step in the denitrification pathway from nitrite (NO2-) to nitrogen gas (N2). Please refer to this image for a schematic of the denitrification pathway. | This gene was cloned from Pseudomonas aeruginosa PAO1 genomic DNA into pSB1C3 using the XbaI and SpeI restriction sites. Correct sequence and orientation were confirmed using 454 Pyrosequencing (BYU). |