Team:Paris Bettencourt/Project/Interlab Study
From 2014.igem.org
Marguerite (Talk | contribs) |
Marguerite (Talk | contribs) |
||
Line 95: | Line 95: | ||
font-size : 16px; | font-size : 16px; | ||
} | } | ||
- | # | + | #device1 { |
width : 100%; | width : 100%; | ||
- | height : | + | height : 800px; |
display : inline-block; | display : inline-block; | ||
} | } | ||
- | # | + | #device1 p { |
display : inline-block; | display : inline-block; | ||
vertical-align : middle; | vertical-align : middle; | ||
Line 108: | Line 108: | ||
font-size : 15px; | font-size : 15px; | ||
} | } | ||
- | # | + | #device1 img { |
position : absolute; | position : absolute; | ||
width : 44%; | width : 44%; | ||
Line 117: | Line 117: | ||
#sequencing { | #sequencing { | ||
width : 100%; | width : 100%; | ||
- | height : | + | height : 1000px; |
display : inline-block; | display : inline-block; | ||
} | } | ||
Line 138: | Line 138: | ||
#fluo { | #fluo { | ||
width : 100%; | width : 100%; | ||
- | height : | + | height : 1000px; |
display : inline-block; | display : inline-block; | ||
} | } | ||
Line 202: | Line 202: | ||
<table id=tablelien> | <table id=tablelien> | ||
<tr> | <tr> | ||
- | <td><a href="# | + | <td><a href="#device1">Device 1</a></td> |
<td><a href="#">Sequencing</a></td> | <td><a href="#">Sequencing</a></td> | ||
<td><a href="#motivation">Fluorescence</a></td> | <td><a href="#motivation">Fluorescence</a></td> | ||
</tr> | </tr> | ||
</table> | </table> | ||
- | <div id= | + | <div id=device1> |
- | <h6> | + | <h6>Device 1</h6><br> |
- | + | <p><b>BBa_I20260 (J23101-B0032-E0040-B0010-B0012) in the pSB3K3 vector.<br> Selection marker : Kanamycin<br> Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc<br> 2012 BioBrick Kit location<br> BBa_I20260: Plate 2, Well 17F</b><br><br> We followed <a href=kit>iGEM Distribution Kit instructions</a> to extract DNA from the Biobrick Plate 2, Well 17F (2012) and then <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1">Heat Shock transformation of <i>E.coli</i></a>. For successful Kanymycin plates we prepared <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stock</a> and labbeled it G.22.</p> | |
- | BBa_I20260 (J23101-B0032-E0040-B0010-B0012) in the pSB3K3 vector.<br> Selection marker : Kanamycin<br> Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc<br> 2012 BioBrick Kit location<br> BBa_I20260: Plate 2, Well 17F</b><br><br> We followed <a href=kit>iGEM Distribution Kit instructions</a> to extract DNA from the Biobrick Plate 2, Well 17F (2012) and then <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1">Heat Shock transformation of <i>E.coli</i></a>. For successful Kanymycin plates we prepared <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stock</a> and labbeled it G.22.< | + | <img src=""> |
+ | </div> | ||
- | < | + | <div id=sequencing> |
- | BBa_J23101 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.<br> Selection marker : Chloramphenicol<br> Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc<br> 2014 Biobrick Kit locations<br> BBa_K823005 (BBa_J23101 in pSB1C3): Plate 1, Well 20K<br> BBa_E0240 (in pSB1C3): Plate 2, Well 24B</b><br><br> | + | <h6>Device 2</h6><br> |
+ | <p><b>BBa_J23101 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.<br> Selection marker : Chloramphenicol<br> Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc<br> 2014 Biobrick Kit locations<br> BBa_K823005 (BBa_J23101 in pSB1C3): Plate 1, Well 20K<br> BBa_E0240 (in pSB1C3): Plate 2, Well 24B</b><br><br> | ||
We followed <a href=kit>iGEM Distribution Kit instructions</a> to extract DNA from the Biobrick BBa_K823005 and BBa_E0240 and then <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1">Heat Shock transformation of <i>E.coli</i></a>. For successful Chloramphenicol plates, form single colonies we prepared liquid cultures overnight. We used 750uL of the liquid cultures for a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stock</a> . We used remaining 4,25 mL to make <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot4"> minipreps</a>. We measured DNA content with the nanodrop.<br><br> | We followed <a href=kit>iGEM Distribution Kit instructions</a> to extract DNA from the Biobrick BBa_K823005 and BBa_E0240 and then <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1">Heat Shock transformation of <i>E.coli</i></a>. For successful Chloramphenicol plates, form single colonies we prepared liquid cultures overnight. We used 750uL of the liquid cultures for a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stock</a> . We used remaining 4,25 mL to make <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot4"> minipreps</a>. We measured DNA content with the nanodrop.<br><br> | ||
Digestion analysis: <br> | Digestion analysis: <br> | ||
Line 221: | Line 223: | ||
- complete with H2O<br> | - complete with H2O<br> | ||
(Final volume of 50 uL)<br><br> | (Final volume of 50 uL)<br><br> | ||
- | We made an eletrophoresis gel to check the fragments (the bands at around 876 bp for GFP and 2100 bp for the promoter + backbone) and then extract BBa_E0240 with Gel extraction kit. For the plasmid with the promoter we used a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot5">PCR purification kit</a>. We introduced the GFP fragment to the Plasmid + backbone through ligation of the sticky ends SpeI and XbeI. Quantified DNA in two parts with nanodrop. The amount of vector: insert has been calculated with Promega calculator. <br><br> | + | We made an eletrophoresis gel to check the fragments (the bands at around 876 bp for GFP and 2100 bp for the promoter + backbone) and then extract BBa_E0240 with Gel extraction kit. For the plasmid with the promoter we used a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot5">PCR purification kit</a>. We introduced the GFP fragment to the Plasmid + backbone through ligation of the sticky ends SpeI and XbeI. Quantified DNA in two parts with nanodrop. The amount of vector: insert has been calculated with Promega calculator. <br><br>5X Ligase Reaction Buffer 4 μl<br>Insert: Vector Molar Ratio 1:1, 1:3, 1:5<br>Total DNA 0.01-0.1 μg<br>T4 DNA Ligase 1 uL<br>Autoclaved distilled water to 25uL<br>Incubate at 22°C for 1h<br>16°C overnight<br><br> |
- | 5X Ligase Reaction Buffer 4 μl<br> | + | We transformed the ligation product following <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1"> Heat Shock transformation of <i>E.coli</i></a>. We have put a single colony into a liquid culture with the appropriate antibiotic and the next day We prepared a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stock</a>.</p> |
- | Insert: Vector Molar Ratio 1:1, 1:3, 1:5<br> | + | |
- | Total DNA 0.01-0.1 μg<br> | + | |
- | T4 DNA Ligase 1 uL<br> | + | |
- | Autoclaved distilled water to 25uL<br> | + | |
- | Incubate at 22°C for 1h<br> | + | |
- | 16°C overnight<br><br> | + | |
- | We transformed the ligation product following <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1"> Heat Shock transformation of <i>E.coli</i></a>. We have put a single colony into a liquid culture with the appropriate antibiotic and the next day We prepared a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stock</a> | + | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
<img src=""> | <img src=""> | ||
</div> | </div> | ||
+ | |||
<div id=fluo> | <div id=fluo> | ||
- | <h6> | + | <h6>Device3</h6><br> |
- | + | <p><b>*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 missmatched basepairs.<br>BBa_J23115 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.<br> Selection marker : Chloramphenicol<br> Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc (missmatched basepairs compared to real BBa_J23115 are underlined)<br> 2014 Biobrick Kit locations<br> BBa_K823012 (BBa_J23115 in pSB1C3): Plate 1, Well 22I<br> BBa_E0240 (in pSB1C3): Plate 2, Well 24B</b><br><br> | |
+ | In order to prepare the third device we proceed exactly in the same way as for the Device 2, except we used BBa_K823012 instead of BBa_K823005 </p> | ||
<img src=""> | <img src=""> | ||
</div> | </div> |
Revision as of 14:25, 4 October 2014
The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. Can you measure fluorescence somewhere in your lab? Then this is the perfect study for you! |
Even if your lab or the organisms you work with mean that you can’t measure GFP from the specific devices, we want every team to be able to participate: email measurement at igem dot org and we will work out an alternative. |
Device 1 | Sequencing | Fluorescence |
Device 1
BBa_I20260 (J23101-B0032-E0040-B0010-B0012) in the pSB3K3 vector.
Selection marker : Kanamycin
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc
2012 BioBrick Kit location
BBa_I20260: Plate 2, Well 17F
We followed iGEM Distribution Kit instructions to extract DNA from the Biobrick Plate 2, Well 17F (2012) and then Heat Shock transformation of E.coli. For successful Kanymycin plates we prepared glycerol stock and labbeled it G.22.
Device 2
BBa_J23101 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.
Selection marker : Chloramphenicol
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc
2014 Biobrick Kit locations
BBa_K823005 (BBa_J23101 in pSB1C3): Plate 1, Well 20K
BBa_E0240 (in pSB1C3): Plate 2, Well 24B
We followed iGEM Distribution Kit instructions to extract DNA from the Biobrick BBa_K823005 and BBa_E0240 and then Heat Shock transformation of E.coli. For successful Chloramphenicol plates, form single colonies we prepared liquid cultures overnight. We used 750uL of the liquid cultures for a glycerol stock . We used remaining 4,25 mL to make minipreps. We measured DNA content with the nanodrop.
Digestion analysis:
- 5 ug plasmid
- 5 ul FD Buffer
- 2.5 uL SpeI + 2.5 uL PstI (BBa_K823005) / 2.5 uL XbeI + 2.5 uL PstI (BBa_E0240)
- complete with H2O
(Final volume of 50 uL)
We made an eletrophoresis gel to check the fragments (the bands at around 876 bp for GFP and 2100 bp for the promoter + backbone) and then extract BBa_E0240 with Gel extraction kit. For the plasmid with the promoter we used a PCR purification kit. We introduced the GFP fragment to the Plasmid + backbone through ligation of the sticky ends SpeI and XbeI. Quantified DNA in two parts with nanodrop. The amount of vector: insert has been calculated with Promega calculator.
5X Ligase Reaction Buffer 4 μl
Insert: Vector Molar Ratio 1:1, 1:3, 1:5
Total DNA 0.01-0.1 μg
T4 DNA Ligase 1 uL
Autoclaved distilled water to 25uL
Incubate at 22°C for 1h
16°C overnight
We transformed the ligation product following Heat Shock transformation of E.coli. We have put a single colony into a liquid culture with the appropriate antibiotic and the next day We prepared a glycerol stock.
Device3
*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 missmatched basepairs.
BBa_J23115 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.
Selection marker : Chloramphenicol
Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc (missmatched basepairs compared to real BBa_J23115 are underlined)
2014 Biobrick Kit locations
BBa_K823012 (BBa_J23115 in pSB1C3): Plate 1, Well 22I
BBa_E0240 (in pSB1C3): Plate 2, Well 24B
In order to prepare the third device we proceed exactly in the same way as for the Device 2, except we used BBa_K823012 instead of BBa_K823005