Team:Paris Bettencourt/Project/Interlab Study

From 2014.igem.org

(Difference between revisions)
Line 4: Line 4:
<style>
<style>
body {
body {
-
width : 100%;
+
        width : 100%;
}
}
.background {
.background {
Line 14: Line 14:
height : 300px;
height : 300px;
margin-top : 40px;
margin-top : 40px;
-
background-image : url("");
+
background-image : url("https://static.igem.org/mediawiki/2014/b/ba/Smell_of_roses.png");
-
background-size : cover;
+
        background-size : cover;
background-color : transparent;
background-color : transparent;
}
}
Line 26: Line 26:
h6 {
h6 {
-
font-family : Arial;
 
-
font-size : 18px;
 
-
font-weight : bold;
 
-
margin-left : 6%;
 
-
}
 
-
h5 {
 
font-family : Arial;
font-family : Arial;
font-size : 20px;  
font-size : 20px;  
font-weight : bold;
font-weight : bold;
-
margin-left : 5%;
+
                margin-left : 5%;
}
}
#logoblanc {
#logoblanc {
Line 69: Line 63:
p {
p {
text-align : justify;
text-align : justify;
-
text-indent : 10px;
 
background-color : transparent;
background-color : transparent;
}
}
-
#fond {
+
        #fond {
-
margin-top : 0;
+
                width : 100%
-
width : 100%;
+
                height : 300px;
-
height : 300px;
+
background : rgb(225,0,112);
background : rgb(225,0,112);
-
display : table-cell;
+
        }
-
vertical-align : middle;
+
-
}
+
-
#fond p {
+
-
margin-right : 5%;
+
-
margin-left : 5%;
+
-
}
+
#headtable {
#headtable {
width : 92.5%;
width : 92.5%;
Line 89: Line 75:
text-align : center;
text-align : center;
background : rgb(225,0,112);
background : rgb(225,0,112);
-
margin-right : 3.75%;
+
                margin-right : 3.75%;
-
margin-left : 3.75%;
+
                margin-left : 3.75%;
}
}
#headtable tr td {
#headtable tr td {
Line 96: Line 82:
heigth : 100%;
heigth : 100%;
color : rgb(255,255,255);
color : rgb(255,255,255);
-
font-size : 12px;  
+
                font-size : 14px;  
}
}
#tablelien {
#tablelien {
width : 100%;
width : 100%;
-
height : 50px;
+
height : 80px;
text-align : center;
text-align : center;
}
}
Line 107: Line 93:
height : 50px;
height : 50px;
color : rgb(197,192,193);
color : rgb(197,192,193);
-
font-size : 16px;
+
                font-size : 16px;
}
}
#devices {
#devices {
width : 100%;
width : 100%;
 +
height : 500px;
display : inline-block;
display : inline-block;
}
}
-
#devices .text {
+
#devices p {
display : inline-block;
display : inline-block;
vertical-align : middle;
vertical-align : middle;
Line 119: Line 106:
width : 44%;
width : 44%;
margin-left : 5%;
margin-left : 5%;
-
font-size : 14px;
+
                font-size : 15px;
}
}
-
#devices .image {
+
#devices img {
position : absolute;
position : absolute;
width : 44%;
width : 44%;
height : 400px;
height : 400px;
-
left : 51%;
+
                left : 51%;
-
margin-top : 0px;
+
background-color : rgb(197,192,193);
background-color : rgb(197,192,193);
}
}
-
#devices .image img {
+
#aims {
width : 100%;
width : 100%;
-
height : 100%;
+
height : 500px;
 +
display : inline-block;
}
}
-
#results {
+
#aims p {
 +
display : inline-block;
 +
vertical-align : middle;
position : relative;
position : relative;
 +
width : 44%;
 +
margin-left : 5%;
 +
                font-size : 15px;
 +
 +
}
 +
#aims img {
 +
position : absolute;
 +
width : 44%;
 +
height : 400px;
 +
                left : 51%;
 +
background-color : rgb(197,192,193);
 +
}
 +
#results {
width : 100%;
width : 100%;
 +
height : 500px;
display : inline-block;
display : inline-block;
}
}
Line 144: Line 147:
width : 44%;
width : 44%;
margin-left : 5%;
margin-left : 5%;
-
font-size : 14px;
+
                font-size : 15px;
-
word-wrap: break-word;
+
}
}
-
#results div {
+
#results img {
position : absolute;
position : absolute;
width : 44%;
width : 44%;
-
height : 450px;
+
height : 400px;
-
left : 51%;
+
                left : 51%;
 +
background-color : rgb(197,192,193);
}
}
-
#results div img {
+
#motivation {
width : 100%;
width : 100%;
-
height : 95%;
+
height : 500px;
 +
display : inline-block;
}
}
-
#results div p {
+
#motivation p {
-
width : 90%;
+
display : inline-block;
 +
vertical-align : middle;
 +
position : relative;
 +
width : 44%;
 +
margin-left : 5%;
 +
                font-size : 15px;
 +
}
 +
#motivation img {
 +
position : absolute;
 +
width : 44%;
 +
height : 400px;
 +
                left : 51%;
 +
background-color : rgb(197,192,193);
}
}
#top {
#top {
Line 164: Line 180:
right : 20px;
right : 20px;
bottom : 10px;
bottom : 10px;
-
width : 20px;
+
                width : 25px;
-
height : 20px;
+
                height : 25px;
z-index : 100;
z-index : 100;
}
}
-
#top img {
+
        #top img {
-
width : 100%;
+
                width : 100%;
-
height : 100%;
+
                height : 100%;
-
}
+
        }
.nameimg {
.nameimg {
position : absolute;
position : absolute;
Line 180: Line 196:
z-index : 60;
z-index : 60;
}
}
-
.text1 {
+
        .text1 {
-
text-align : justify;
+
              text-align : justify;
-
margin-left : 5%;
+
              margin-left : 5%;
-
margin-right : 5%;
+
              margin-right : 5%;
-
}
+
        }
-
#headtable tr td b {
+
        #headtable tr td b {
-
font-size : 18px;
+
              font-size : 18px;
-
}
+
-
.definition {
+
-
font-size : 8px;
+
-
width : 100%;
+
-
}
+
-
        #divimage {
+
-
                margin-top : 200px;
+
         }
         }
-
        .separation {
 
-
                width : 100%;
 
-
                height : 300px;
 
-
      }
 
-
        .separation2 {
 
-
                width : 100%;
 
-
                height : 150px;
 
-
                background-color : rgb(255,255,255);
 
-
                z-index : 0;
 
-
      }
 
-
      #image1 {
 
-
                z-index : 100;
 
-
      }
 
</style>
</style>
<body>
<body>
-
<p id=top><a href="#topheader"><img src="https://static.igem.org/mediawiki/2014/d/d3/Arrowpb.png"></a></p>
+
<p id=top><a href="#topheader"><img src="https://static.igem.org/mediawiki/2014/4/41/Arrow.png"></a></p>
<div id="topheader">
<div id="topheader">
-
<img src="" class=nameimg>
+
<img src="https://static.igem.org/mediawiki/2014/b/b1/Smelltheroses.png" class=nameimg>
</div>
</div>
<div id=logo><img id=logoblanc src="https://static.igem.org/mediawiki/2014/7/7d/Logoblanc.png"><img id=logorose src="https://static.igem.org/mediawiki/2014/2/28/Logorose.png"></div>
<div id=logo><img id=logoblanc src="https://static.igem.org/mediawiki/2014/7/7d/Logoblanc.png"><img id=logorose src="https://static.igem.org/mediawiki/2014/2/28/Logorose.png"></div>
<div id=fond>
<div id=fond>
-
<p><b>Introduction</b></br>
+
        <table id=headtable>
-
<i>"The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. Can you measure fluorescence somewhere in your lab? Then this is the perfect study for you! Even if your lab or the organisms you work with mean that you can’t measure GFP from the specific devices, we want every team to be able to participate: email measurement at igem dot org and we will work out an alternative."</i></p>
+
<tr>
-
</div>
+
 
 +
<td><p class=text1>The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. Can you measure fluorescence somewhere in your lab? Then this is the perfect study for you! </p></td>
 +
<td><p class=text1>Even if your lab or the organisms you work with mean that you can’t measure GFP from the specific devices, we want every team to be able to participate: email measurement at igem dot org and we will work out an alternative. </p></td>
 +
</tr>
 +
</table>
 +
        </div>
<table id=tablelien>
<table id=tablelien>
<tr>
<tr>
<td><a href="#devices">Devices</a></td>
<td><a href="#devices">Devices</a></td>
-
<td><a href="#results">Results</a></td>
+
<td><a href="#">Sequencing</a></td>
-
<td><a href="#"></a></td>
+
<td><a href="#motivation">Fluorescence</a></td>
-
<td><a href="#motivation">Motivations</a></td>
+
</tr>
</tr>
</table>
</table>
<div id=devices>
<div id=devices>
-
<h5>Devices</h5>
+
<h6>Devices</h6><br>
-
<div class=image><img id=image1 src="https://static.igem.org/mediawiki/2014/9/91/Device_1.png"><p class=definition>Geneious version 7.0.6 created by Biomatters. Available from ​http://www.geneious.com/​​</p></div>
+
<p>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Ut imperdiet diam eget quam imperdiet imperdiet. Mauris dapibus risus felis, sed ornare diam accumsan aliquet. Sed eu turpis porta, porttitor tortor et, condimentum augue. Curabitur a maximus nisi. Vivamus vitae magna ex. Donec congue auctor odio vitae tempus. In a gravida neque, et tristique tortor. Phasellus a odio sit amet enim ornare lobortis. Morbi sodales, diam non rutrum aliquam, ligula mauris consectetur urna, sed interdum quam risus sit amet enim. Aenean euismod enim magna, id pretium eros molestie non. Proin rutrum lobortis leo, sit amet congue erat. Nulla congue pellentesque augue porta dignissim. Pellentesque quis ex sollicitudin, condimentum risus varius, aliquet ipsum. Ut pulvinar aliquet maximus. Praesent imperdiet interdum commodo. </p>
-
<h6>Device 1</h6>
+
<img src="">
-
<div class=text><p><u>BBa_I20260</u> (J23101-B0032-E0040-B0010-B0012) in the <u>pSB3K3</u> vector.</p>
+
</div>
-
<p>Selection marker : Kanamycin</p>
+
<div id=aims>
-
<p>Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc</p>
+
<h6>Aims</h6><br>
-
<u>2012 BioBrick Kit location</u>
+
<p>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Nullam bibendum purus eu neque finibus, eget pellentesque sapien viverra. Vestibulum ultrices posuere tempor. Maecenas ultrices sodales magna ac placerat. Sed a ex dignissim, ornare metus non, malesuada arcu. Etiam ullamcorper odio leo, at molestie eros sollicitudin in. Morbi aliquam scelerisque facilisis. Aenean tincidunt aliquam erat, quis ullamcorper nulla accumsan ac. Proin interdum nibh quam, in lacinia ipsum dignissim at. Nunc elementum lacus sed purus pharetra tincidunt. Sed ac velit vel turpis pulvinar accumsan ut in mauris. Praesent ac dapibus dui. Nullam finibus turpis et turpis sagittis congue. </p>
-
  <ul><li>BBa_I20260: Plate 2, Well 17F</li>
+
<img src="">
-
</ul>
+
-
<p> I followed <a href=kit>iGEM Distribution Kit instructions </a> to extract DNA from the Biobrick Plate 2, Well 17F (2012) and then <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1"> Heat Shock transformation of <i>E.coli</i></a></br>For successful Kanymycin plates I prepared <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stock </a> and labbeled it G.22.</p>
+
-
</div>
+
-
                <div id=divimage class=image><div class=separation2></div><img src="https://static.igem.org/mediawiki/2014/0/02/Device_2.png"><p class=definition>Geneious version 7.0.6 created by Biomatters. Available from ​http://www.geneious.com/​​</p></div>
+
-
<h6>Device 2</h6>
+
-
<div class=text>
+
-
<p><u>BBa_J23101 + BBa_E0240</u> (B0032-E0040-B0010-B0012), in the <u>pSB1C3</u> vector.</br>
+
-
Selection marker : Chloramphenicol</br>
+
-
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc</p>
+
-
<u>2014 Biobrick Kit locations</u>
+
-
  <ul><li>  BBa_K823005 (BBa_J23101 in pSB1C3): Plate 1, Well 20K</li>
+
-
  <li>  BBa_E0240 (in pSB1C3): Plate 2, Well 24B</li>
+
-
</ul>
+
-
<p> I followed <a>iGEM Distribution Kit instructions </a> to extract DNA from the Biobrick BBa_K823005 and BBa_E0240 and then <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1"> Heat Shock transformation of <i>E.coli</i></a></br>For successful Chloramphenicol plates, form single colonies I prepared liquid cultures overnight. I used 750uL of the liquid cultures for a<a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stock </a>. I used remaining 4,25 mL to make <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot4"> minipreps  </a>. I measured DNA content with the nanodrop.
+
-
</br></br><u>Digestion analysis</u>:</br>
+
-
<ul><li>- 5 ug plasmid </li>
+
-
<li>- 5 ul FD Buffer</li>
+
-
<li>- 2.5 uL SpeI + 2.5 uL PstI (BBa_K823005) / 2.5 uL XbeI + 2.5 uL PstI (BBa_E0240)</li>
+
-
<li>- complete with H2O</li></ul>
+
-
(Final volume of 50 uL)</br>
+
-
We made an eletrophoresis gel to check the fragments (the bands at around  876 bp for GFP and 2100 bp for the promoter + backbone)and then extract BBa_E0240 with Gel extraction kit. For the plasmid with the promoter I used a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot5">PCR purification kit.</a>
+
-
I introduced the GFP fragment to the Plasmid + backbone through ligation of the sticky ends SpeI and XbeI. Quantified DNA in two parts with nanodrop. The amount of  vector:insert has been calculated with Promega calculator.  
+
-
</br>
+
-
<ul><li>5X Ligase Reaction Buffer 4 μl</li>
+
-
<li>Insert: Vector Molar Ratio 1:1, 1:3, 1:5</li>
+
-
<li>Total DNA 0.01-0.1 μg</li>
+
-
<li>T4 DNA Ligase 1 uL</li>
+
-
<li>Autoclaved distilled water to 25uL</li>
+
-
<li>Incubate at 22°C for 1h</li>
+
-
<li> 16°C overnight</li></ul>
+
-
I transformed the ligation product following <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1"> Heat Shock transformation of <i>E.coli</i></a>.
+
-
I have put a single colony into a liquid culture with the appropriate antibiotic and the next day I prepared a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stock </a>.</p>
+
-
</div>
+
-
<div class=image><img src="https://static.igem.org/mediawiki/2014/d/d9/Device_3.png"><p class=definition>Geneious version 7.0.6 created by Biomatters. Available from ​http://www.geneious.com/​​</p></div>
+
-
<h6>Device 3</h6>
+
-
<div class=text>
+
-
<p><i>*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 missmatched basepairs.</i></p>
+
-
<p><u>BBa_J23115 + BBa_E0240</u> (B0032-E0040-B0010-B0012),  in the <u>pSB1C3</u> vector.</br>
+
-
Selection marker : Chloramphenicol</br>
+
-
Promoter expected sequence : tttatagctagctcag<u>t</u>cct<u>a</u>ggtacaatgctagc (missmatched basepairs compared to real BBa_J23115 are underlined)</p>
+
-
<u>2014 Biobrick Kit locations</u>
+
-
  <ul><li>  BBa_K823012 (BBa_J23115 in pSB1C3): Plate 1, Well 22I</li>
+
-
  <li>  BBa_E0240 (in pSB1C3): Plate 2, Well 24B </li>
+
-
</ul>
+
-
</br>
+
-
<p>In order to prepare the third device we proceed exactly in the same way as for the Device 2, except we used  BBa_K823012 instead of BBa_K823005</p>
+
-
</div>
+
</div>
</div>
<div id=results>
<div id=results>
-
<h5>Sequencing</h5>
+
<h6>Results</h6><br>
-
<p>We sequenced all the three devices using iGEM Verification Primers (forward). Sequences are matching expected constructs.</p>
+
<p>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Sed sit amet laoreet metus, ac viverra dolor. Sed et orci imperdiet sem vulputate ultricies. Aliquam erat volutpat. Cras semper ex non odio aliquet, eget feugiat eros tempor. Integer hendrerit odio et bibendum maximus. Duis scelerisque lacus in odio faucibus fringilla. Nulla eleifend aliquet molestie. Morbi aliquam rhoncus efficitur. Proin consectetur augue aliquam risus convallis egestas. Nunc viverra felis non nibh consequat, nec faucibus ipsum rutrum. Proin placerat faucibus libero vitae dapibus. </p>
-
<div><img src="https://static.igem.org/mediawiki/2014/0/0a/OD600_min.jpg"><p>Mean OD600 absorbance measured over 20h. Background absorbance (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for each sample).</p></div>
+
<img src="">
-
<h6>First Device</h6>
+
</div>
-
<p>Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc</br>
+
<div id=motivation>
-
Sequenced device’s promoter: TTTACAGCTAGCTCAGTCCTAGGTTATTATGCTAGC</br>
+
<h6>Motivation</h6><br>
-
Complete sequenced device:</br>
+
<p>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Nam eu justo a dolor efficitur laoreet ut at lorem. Fusce dapibus lobortis nisi vehicula porttitor. In volutpat mauris et aliquam pellentesque. Vestibulum fringilla lacus metus, ac ullamcorper lectus sagittis sed. Suspendisse congue magna sed risus molestie aliquam. Sed placerat sagittis volutpat. Phasellus id erat neque. Quisque bibendum iaculis ante et feugiat. In hac habitasse platea dictumst. Fusce placerat lorem vel felis tincidunt, in elementum odio condimentum. Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Donec tincidunt bibendum lacus non viverra. Nulla mattis, ante vitae faucibus auctor, mi purus consequat dolor, non malesuada nulla lorem ac odio. </p>
-
ATTTGTATCTTACTATAAATAGGCGTATCACGAGGCACGAAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGAGCCGCTTCTAGAGATTTACAGCTAGCTCAGTCCTAGGTTATTATGCTAGCTACTAGAGTTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAATAACCGGCCGCTGCAGTCCCGGCAAAAAAAGGGCAAAGGTGTCCACCA</p>
+
<img src="">
-
<div><img src="https://static.igem.org/mediawiki/2014/e/e7/Fluo_samples_min.jpg"><p>Mean of green fluorescence for three devices and NEB turbo cells. </br>Background fluorescence (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for Devices 1, 2, 3 and 6 replicates for NEB).</p></div>
+
-
<h6>Second Device</h6>
+
-
<p>Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc</br>
+
-
Sequenced device’s promoter: TTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGC</br>
+
-
Complete sequenced device:</br>
+
-
TTTGATAACTATAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGCTACTAGAGTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCCCGTTATGCAGGCTTCCTCGCTCACTGAATCGCTGCGCTCGGTCGTTCGGCTGCGGCGAACGGTATCAGCTCACTCAAAGGCGGTAATACCGGTTATCCCAAGAAATCAGGGGATAACCCCAGGAAAAAAACTTGGGACCAAAAGGCCACCCAAAGGGCCAGGAACCGTAAAAAAGGCCCCGTTTTCTGGGGTTTTTTCCAAAAGGCTCCGGCCCCCCTGGAAAAGACTTCAAAAATTCCGCCTTCTAATCCTAAAGGTGGGAAAACCCCCAA</p>
+
-
<div><img src="https://static.igem.org/mediawiki/2014/d/d0/Fluo_od_min.jpg"><p>Mean of green fluorescence divided by optical density 600 for three devices and NEB turbo cells. </br>Background fluorescence (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for Devices 1, 2, 3 and 6 replicates for NEB).</p></div>
+
-
<h6>Third Device</h6>
+
-
<p>Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc</br>
+
-
Sequenced promoter sequence:TTTATAGCTAGCTCAGTCCTAGGTACAATGCTAGC</br>
+
-
Complete sequence: </br>
+
-
GACTCTGATAACTATAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTTTATAGCTAGCTCAGTCCTAGGTACAATGCTAGCTACTAGAGTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCCGGGGGATAACCGCAGGAAAAAACATGTGGAGCCAAAAGGCCAACCAAAAGGCCAGGAACCGTAAAAAAGGCCCCGTTTGCTGGGGTTTTTTCCCAAGGGTCCCGCCCCCCTGGAAAAAGTTCCAA</p>
+
-
<div><img src="https://static.igem.org/mediawiki/2014/3/35/GFP.jpg"></div>
+
-
<h5>OD600 and fluorescence measure over 20h</h5>
+
-
<p><u>Samples preparation:</u> Single colonies were inoculated in 5mL LB broth with appropriate antibiotic and grown to saturation overnight (16h) at 37°C with shaking (220 rpm).
+
-
Samples were diluted 100x (50um in 5 mL LB with appropriate antibiotic) and incubated for 2h at 37°C prior to measurement.
+
-
</br></br><u>Control:</u></br>
+
-
LB broth with antibiotics (chloramphenicol/kanamycin)- no fluorescence</br>
+
-
NEB turbo without fluorescence - no fluorescence, no cells</br>
+
-
<u>Measurment</u></br>
+
-
Greiner 96 plates were loaded with 150um of cells in LB and 30um mineral oil
+
-
Cells have been diluted prior to measurement as described above.
+
-
Background absorbance and fluorescence was determined from LB control.
+
-
</br>Data from the top row were excluded due to the likely evaporation and artefacts (edge effects).
+
-
</p>
+
</div>
</div>
-
        <div class=separation></div>
 
</body>
</body>
</html>
</html>

Revision as of 13:15, 4 October 2014

The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. Can you measure fluorescence somewhere in your lab? Then this is the perfect study for you!

Even if your lab or the organisms you work with mean that you can’t measure GFP from the specific devices, we want every team to be able to participate: email measurement at igem dot org and we will work out an alternative.

Devices Sequencing Fluorescence
Devices

Lorem ipsum dolor sit amet, consectetur adipiscing elit. Ut imperdiet diam eget quam imperdiet imperdiet. Mauris dapibus risus felis, sed ornare diam accumsan aliquet. Sed eu turpis porta, porttitor tortor et, condimentum augue. Curabitur a maximus nisi. Vivamus vitae magna ex. Donec congue auctor odio vitae tempus. In a gravida neque, et tristique tortor. Phasellus a odio sit amet enim ornare lobortis. Morbi sodales, diam non rutrum aliquam, ligula mauris consectetur urna, sed interdum quam risus sit amet enim. Aenean euismod enim magna, id pretium eros molestie non. Proin rutrum lobortis leo, sit amet congue erat. Nulla congue pellentesque augue porta dignissim. Pellentesque quis ex sollicitudin, condimentum risus varius, aliquet ipsum. Ut pulvinar aliquet maximus. Praesent imperdiet interdum commodo.

Aims

Lorem ipsum dolor sit amet, consectetur adipiscing elit. Nullam bibendum purus eu neque finibus, eget pellentesque sapien viverra. Vestibulum ultrices posuere tempor. Maecenas ultrices sodales magna ac placerat. Sed a ex dignissim, ornare metus non, malesuada arcu. Etiam ullamcorper odio leo, at molestie eros sollicitudin in. Morbi aliquam scelerisque facilisis. Aenean tincidunt aliquam erat, quis ullamcorper nulla accumsan ac. Proin interdum nibh quam, in lacinia ipsum dignissim at. Nunc elementum lacus sed purus pharetra tincidunt. Sed ac velit vel turpis pulvinar accumsan ut in mauris. Praesent ac dapibus dui. Nullam finibus turpis et turpis sagittis congue.

Results

Lorem ipsum dolor sit amet, consectetur adipiscing elit. Sed sit amet laoreet metus, ac viverra dolor. Sed et orci imperdiet sem vulputate ultricies. Aliquam erat volutpat. Cras semper ex non odio aliquet, eget feugiat eros tempor. Integer hendrerit odio et bibendum maximus. Duis scelerisque lacus in odio faucibus fringilla. Nulla eleifend aliquet molestie. Morbi aliquam rhoncus efficitur. Proin consectetur augue aliquam risus convallis egestas. Nunc viverra felis non nibh consequat, nec faucibus ipsum rutrum. Proin placerat faucibus libero vitae dapibus.

Motivation

Lorem ipsum dolor sit amet, consectetur adipiscing elit. Nam eu justo a dolor efficitur laoreet ut at lorem. Fusce dapibus lobortis nisi vehicula porttitor. In volutpat mauris et aliquam pellentesque. Vestibulum fringilla lacus metus, ac ullamcorper lectus sagittis sed. Suspendisse congue magna sed risus molestie aliquam. Sed placerat sagittis volutpat. Phasellus id erat neque. Quisque bibendum iaculis ante et feugiat. In hac habitasse platea dictumst. Fusce placerat lorem vel felis tincidunt, in elementum odio condimentum. Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Donec tincidunt bibendum lacus non viverra. Nulla mattis, ante vitae faucibus auctor, mi purus consequat dolor, non malesuada nulla lorem ac odio.

Retrieved from "http://2014.igem.org/Team:Paris_Bettencourt/Project/Interlab_Study"