Team:USyd-Australia/Notebook/Primers

From 2014.igem.org

(Difference between revisions)
Line 39: Line 39:
|iGEM1410 || TGACACCTTGCCCTTTTTTGCCG || 60.9C || Amplification of iGEM-IntI1 gBlock reverse primer
|iGEM1410 || TGACACCTTGCCCTTTTTTGCCG || 60.9C || Amplification of iGEM-IntI1 gBlock reverse primer
|-
|-
-
|iGEM1411 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ||  
+
|iGEM1411 || GTTTTTTTGGATGGAGTGAAACGATGGCGATTG || 61.7C || Gblock primers for IntI1 in pSAM-R
|-
|-
-
|iGEM1412 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ||  
+
|iGEM1412 || TGACACCTTGCCCTTTTTTG || 53.9C || Gblock primers for IntI1 in pSAM-R
|-
|-
-
|iGEM1413 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ||  
+
|iGEM1413 || GACATTGCCGTCACTGCGTC || 59.1C || Junction primers for IntI1 in pSAM-R
|-
|-
-
|iGEM1414 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ||  
+
|iGEM1414 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || || Junction primers for IntI1 in pSAM-R
|-
|-
-
|iGEM1415 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ||  
+
|iGEM1415 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || || Junction primers for IntI1 in pSAM-R
|-
|-
-
|iGEM1416 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ||  
+
|iGEM1416 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || || Junction primers for IntI1 in pSAM-R
|-
|-
|iGEM1417 || AAATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAG || 67.6C || Linearisation of pSB1C3, containing full BioBrick prefix and suffix
|iGEM1417 || AAATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAG || 67.6C || Linearisation of pSB1C3, containing full BioBrick prefix and suffix
Line 67: Line 67:
|iGEM1424 || AATGTAATTCAGCTCCGCCATC|| 55.5C || lacI-Plac-attI LHJ-R left hand junction reverse primer (use with iGEM16)
|iGEM1424 || AATGTAATTCAGCTCCGCCATC|| 55.5C || lacI-Plac-attI LHJ-R left hand junction reverse primer (use with iGEM16)
|-
|-
-
|iGEM1425 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ||  
+
|iGEM1425 || AAATCTAGATGGCGCGGCTTAACTCAGGTGTTAGGCTTAGGAGGCTCAAGTATGGGCAT || 70.7C || For making aacC1 gene cassettes from Tn1696. Use with iGEM1426.
|-
|-
-
|iGEM1426 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ||  
+
|iGEM1426 || AAAACTAGTGGCGTCGGCTTGGACGAATTGTTAGGCTTAGGTGGCGGTACTTGGGTC || 71.4C || For making aacC1 gene cassettes from Tn1696. Use with iGEM1425.
|-
|-
-
|iGEM1427 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ||  
+
|iGEM1427 || TTTTCTAGAGTTTGATGTTATGGAGCAGCAACG || 60.2C || For making aacC1 gene cassettes from Tn1696. Use with iGEM1428. Alternative to iGEM1424.
|-
|-
-
|iGEM1428 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ||  
+
|iGEM1428 || TTTACTAGTGCAAAAAGGCAGCAATTATGAGCC || 60.9C || For making aacC1 gene cassettes from Tn1696. Use with iGEM1427. Alternative to iGEM1426.
 +
|-
 +
|NVC71 || CTAAGAATCCATAGTCCAACTCC || 52.4C || aadB gene, rvs primer for junction screen
 +
|-
 +
|NVC92b || CACGCAAGACCTCAACCTTTTCC || 58.6C || aadB gene, rvs primer for junction screen
 +
|-
 +
|NVC158 || GATACCTTGTGCGGCTATGTCTG || 57.6C || pUS41/44, left of cloning site
 +
|-
 +
|NVC159 || GCCGCCTTGGGCCGGGTGATGTC || 69.2C || pUS41/44, right of cloning site
|}
|}
</center>
</center>
{{Team:USyd-Australia/Footer}}
{{Team:USyd-Australia/Footer}}

Revision as of 10:28, 4 October 2014

iGEM_Link


Primers


Name Sequence (5'-3') Theoretical Tm Purpose
iGEM16 GAGTGCCACCTGACGTCTAAGAAACC 60.9C For BioBrick sequencing, amplification by PCR, or junction PCR. Alternative to iGEM [http://parts.igem.org/Part:BBa_G00100 VF2] primer
iGEM25 CCCTGATTCTGTGGATAACCGTATTACCG 60.0C For BioBrick sequencing, amplification by PCR, or junction PCR. Alternative to iGEM [http://parts.igem.org/Part:BBa_G00101 VR] primer
iGEM1401 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
iGEM1402 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
iGEM1403 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
iGEM1404 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
iGEM1405 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
iGEM1406 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
iGEM1407 CTATATCTATGATCTCGCAGTCTCC 53.8C PCR primers over the junction between aacC1 (G block) and pSB1C3 vector, for validation of successful G block insertion by PCR screening
iGEM1408 GCCTTTTGCTCACATGTTCTTTC 55.2C PCR primers over the junction between aacC1 (G block) and pSB1C3 vector, for validation of successful G block insertion by PCR screening
iGEM1409 GTTTTTTTGGATGGAGTGAAACGATGGCGATTG 61.7C Amplification of iGEM-IntI1 gBlock forward primer
iGEM1410 TGACACCTTGCCCTTTTTTGCCG 60.9C Amplification of iGEM-IntI1 gBlock reverse primer
iGEM1411 GTTTTTTTGGATGGAGTGAAACGATGGCGATTG 61.7C Gblock primers for IntI1 in pSAM-R
iGEM1412 TGACACCTTGCCCTTTTTTG 53.9C Gblock primers for IntI1 in pSAM-R
iGEM1413 GACATTGCCGTCACTGCGTC 59.1C Junction primers for IntI1 in pSAM-R
iGEM1414 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Junction primers for IntI1 in pSAM-R
iGEM1415 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Junction primers for IntI1 in pSAM-R
iGEM1416 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Junction primers for IntI1 in pSAM-R
iGEM1417 AAATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAG 67.6C Linearisation of pSB1C3, containing full BioBrick prefix and suffix
iGEM1418 AAACTCTAGAAGCGGCCGCGAATTCCAGAAATCATCCTTAGC 66.9C Linearisation of pSB1C3, containing full BioBrick prefix and suffix
iGEM1419 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
iGEM1420 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
iGEM1421 GGGAATTCAAATCTAGAGACACCATCG 57.1C Amplification of LacI-Plac-AttI gBlock forward primer
iGEM1422 CCTGCAGTTTACTAGTTTTGCCTAACTTTGTTTTAG 59.4C Amplification of LacI-Plac-AttI gBlock forward primer
iGEM1423 CAGGCTTTACACTTTATGCTTCCG 56.3C lacI-Plac-attI RHJ-F right hand junction forward primer (use with iGEM25)
iGEM1424 AATGTAATTCAGCTCCGCCATC 55.5C lacI-Plac-attI LHJ-R left hand junction reverse primer (use with iGEM16)
iGEM1425 AAATCTAGATGGCGCGGCTTAACTCAGGTGTTAGGCTTAGGAGGCTCAAGTATGGGCAT 70.7C For making aacC1 gene cassettes from Tn1696. Use with iGEM1426.
iGEM1426 AAAACTAGTGGCGTCGGCTTGGACGAATTGTTAGGCTTAGGTGGCGGTACTTGGGTC 71.4C For making aacC1 gene cassettes from Tn1696. Use with iGEM1425.
iGEM1427 TTTTCTAGAGTTTGATGTTATGGAGCAGCAACG 60.2C For making aacC1 gene cassettes from Tn1696. Use with iGEM1428. Alternative to iGEM1424.
iGEM1428 TTTACTAGTGCAAAAAGGCAGCAATTATGAGCC 60.9C For making aacC1 gene cassettes from Tn1696. Use with iGEM1427. Alternative to iGEM1426.
NVC71 CTAAGAATCCATAGTCCAACTCC 52.4C aadB gene, rvs primer for junction screen
NVC92b CACGCAAGACCTCAACCTTTTCC 58.6C aadB gene, rvs primer for junction screen
NVC158 GATACCTTGTGCGGCTATGTCTG 57.6C pUS41/44, left of cloning site
NVC159 GCCGCCTTGGGCCGGGTGATGTC 69.2C pUS41/44, right of cloning site

With thanks to: