Team:Paris Bettencourt/Project/Interlab Study

First device

Geneious version 7.0.6 created by Biomatters. Available from ​http://www.geneious.com/​​

BBa_I20260 (J23101-B0032-E0040-B0010-B0012) in the pSB3K3 vector.

Selection marker : Kanamycin

Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc

2012 BioBrick Kit location
• BBa_I20260: Plate 2, Well 17F

I followed iGEM Distribution Kit instructions to extract DNA from the Biobrick Plate 2, Well 17F (2012) and then Heat Shock transformation of E.coli
For successful Kanymycin plates I prepared glycerol stock and labbeled it G.22.

Second device

Geneious version 7.0.6 created by Biomatters. Available from ​http://www.geneious.com/​​

BBa_J23101 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.

Selection marker : Chloramphenicol

Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc

2014 Biobrick Kit locations
• BBa_K823005 (BBa_J23101 in pSB1C3): Plate 1, Well 20K
• BBa_E0240 (in pSB1C3): Plate 2, Well 24B

I followed iGEM Distribution Kit instructions to extract DNA from the Biobrick BBa_K823005 and BBa_E0240 and then Heat Shock transformation of E.coli
For successful Chloramphenicol plates, form single colonies I prepared liquid cultures overnight. I used 750uL of the liquid cultures for aglycerol stock . I used remaining 4,25 mL to make minipreps . I measured DNA content with the nanodrop.
Digestion analysis:
- 5 ug plasmid
- 5 ul FD Buffer
- 2.5 uL SpeI + 2.5 uL PstI (BBa_K823005) / 2.5 uL XbeI + 2.5 uL PstI (BBa_E0240)
- complete with H2O
(Final volume of 50 uL)

We made an eletrophoresis gel to check the fragments (the bands at around 876 bp for GFP and 2100 bp for the promoter + backbone)and then extract BBa_E0240 with Gel extraction kit. For the plasmid with the promoter I used a PCR purification kit.
I introduced the GFP fragment to the Plasmid + backbone using ligation kit.
I transformed the ligation product following Heat Shock transformation of E.coli.
I have put a single colony into a liquid culture with the appropriate antibiotic and the next day I prepared a glycerol stock .

Third device*

Geneious version 7.0.6 created by Biomatters. Available from ​http://www.geneious.com/​​

*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 missmatched basepairs.

BBa_J23115 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.

Selection marker : Chloramphenicol

Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc (missmatched basepairs compared to real BBa_J23115 are underlined)

2014 Biobrick Kit locations
• BBa_K823012 (BBa_J23115 in pSB1C3): Plate 1, Well 22I
• BBa_E0240 (in pSB1C3): Plate 2, Well 24B

In order to prepare the third device we proceed exactly in the same way as for the Device 2, except we used BBa_K823012 instead of BBa_K823005

Results

Sequencing

First device

Promoter sequence : tttacagctagctcagtcctaggtattatgctagc

Second device

Promoter sequence :

Third device

Promoter sequence :

OD600 and fluorescence measure over 20h

Samples preparation: Single colonies were inoculated in 5mL LB broth with appropriate antibiotic and grown to saturation overnight (16h) at 37°C with shaking (220 rpm).
Samples were diluted 100x (50um in 5 mL LB with appropriate antibiotic) and incubated for 2h at 37°C prior to measurement.

Control:
• LB broth with antibiotics (chloramphenicol/kanamycin)- no fluorescence
• NEB turbo without fluorescence - no fluorescence, no cells

Measurment Greiner 96 plates were loaded with 150um of cells in LB and 30um mineral oil Cells have been diluted prior to measurement as described above. Background absorbance and fluorescence was determined from LB control.
Data from the top row were excluded due to the likely evaporation and artefacts (edge effects).

Mean OD600 absorbance measured over 20h. Background absorbance (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for each sample).

Mean of green fluorescence for three devices and NEB turbo cells.
Background fluorescence (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for Devices 1, 2, 3 and 6 replicates for NEB).

Mean of green fluorescence divided by optical density 600 for three devices and NEB turbo cells.
Background fluorescence (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for Devices 1, 2, 3 and 6 replicates for NEB).