"
Team:Paris Bettencourt/Project/Interlab Study
From 2014.igem.org
| Line 93: | Line 93: | ||
#separation { | #separation { | ||
height : 100px; | height : 100px; | ||
| - | width : | + | width : 20%; |
margin-left : 20%; | margin-left : 20%; | ||
} | } | ||
| Line 129: | Line 129: | ||
<div> | <div> | ||
<h6>Second device</h6> | <h6>Second device</h6> | ||
| + | <div id=image2><img id=image1 src="https://static.igem.org/mediawiki/2014/0/02/Device_2.png"><p id=definition>Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/</p></div> | ||
<p><u>BBa_J23101 + BBa_E0240</u> (B0032-E0040-B0010-B0012), in the <u>pSB1C3</u> vector.</p> | <p><u>BBa_J23101 + BBa_E0240</u> (B0032-E0040-B0010-B0012), in the <u>pSB1C3</u> vector.</p> | ||
<p>Selection marker : Chloramphenicol</p> | <p>Selection marker : Chloramphenicol</p> | ||
| Line 137: | Line 138: | ||
<li> BBa_E0240 (in pSB1C3): Plate 2, Well 24B</li> | <li> BBa_E0240 (in pSB1C3): Plate 2, Well 24B</li> | ||
</ul> | </ul> | ||
| - | |||
</div> | </div> | ||
<div id=separation></div> | <div id=separation></div> | ||
<div> | <div> | ||
<h6>Third device*</h6> | <h6>Third device*</h6> | ||
| + | <div id=image2><img id=image1 src="https://static.igem.org/mediawiki/2014/d/d9/Device_3.png"><p id=definition>Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/</br></p></div> | ||
<p><i>*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 missmatched basepairs.</i></p> | <p><i>*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 missmatched basepairs.</i></p> | ||
<p><u>BBa_J23115 + BBa_E0240</u> (B0032-E0040-B0010-B0012), in the <u>pSB1C3</u> vector.</p> | <p><u>BBa_J23115 + BBa_E0240</u> (B0032-E0040-B0010-B0012), in the <u>pSB1C3</u> vector.</p> | ||
| Line 151: | Line 152: | ||
<li> BBa_E0240 (in pSB1C3): Plate 2, Well 24B </li> | <li> BBa_E0240 (in pSB1C3): Plate 2, Well 24B </li> | ||
</ul> | </ul> | ||
| - | |||
</div> | </div> | ||
</body> | </body> | ||
</html> | </html> | ||
Revision as of 15:03, 22 August 2014
iGEM 2014 Measurement Interlab Study
iGEM Paris Bettencourt team participates in the Interlab study
"The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. Can you measure fluorescence somewhere in your lab? Then this is the perfect study for you! Even if your lab or the organisms you work with mean that you can’t measure GFP from the specific devices, we want every team to be able to participate: email measurement at igem dot org and we will work out an alternative."
First device
Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/
BBa_I20260 (J23101-B0032-E0040-B0010-B0012) in the pSB3K3 vector.
Selection marker : Kanamycin
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc
- 2012 BioBrick Kit location
- BBa_I20260: Plate 2, Well 17F
Second device
Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/
BBa_J23101 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.
Selection marker : Chloramphenicol
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc
- 2014 Biobrick Kit locations
- BBa_K823005 (BBa_J23101 in pSB1C3): Plate 1, Well 20K
- BBa_E0240 (in pSB1C3): Plate 2, Well 24B
Third device*
Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/
*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 missmatched basepairs.
BBa_J23115 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.
Selection marker : Chloramphenicol
Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc (missmatched basepairs compared to real BBa_J23115 are underlined)
- 2014 Biobrick Kit locations
- BBa_K823012 (BBa_J23115 in pSB1C3): Plate 1, Well 22I
- BBa_E0240 (in pSB1C3): Plate 2, Well 24B
