Team:DTU-Denmark/Achievements/Parts

Main Contribution

Our main part contribution is the Spinach2.1 BioBricks (BBa_K1330000 & BBa_K1330001). Spinach is an RNA aptamer, developed at Cornell University, that binds and activates a fluorophore called DFHBI. Spinach2 is an improved version of Spinach with increased fluorescence. Spinach2 has not been included in any BioBrick until now.

The Spinach2 sequence contains an internal SpeI site, which makes it incompatible with the iGEM assembly standard. To overcome this we predicted several mutations that should not affect folding, and synthesized these mutated versions of the sequence. One of these mutated sequences, Spinach2.1, was confirmed to have fluorescence comparable to the original Spinach2.

Spinach2:   GATGTAACTGAATGAAATGGTGAAGGACGGGTCCAGTAGGCTGCTTCGGCAGCCTACTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTTACATC
Spinach2.1: GATGTATCTGAATGAAATGGTGAAGGACGGGTCCAGTAGGCTGCTTCGGCAGCCTACTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGATACATC

The sequences of Spinach2 and Spinach2.1 are shown above. The SpeI site is highlighted in blue. The two point mutations we introduced are highlighted in red.

Figure 1 shows predicted folding of Spinach2 and Spinach2.1 and Figure 2 shows the results of our comparison of the two sequences.

Figure 1: Predicted folding of Spinach2 and Spinach2.1. The blue circle shows the the bases that were exchanged in Spinach2.1.

To increase the stability of the Spinach2.1 RNA-aptamer our BioBrick contains the sequence flanked by a human tRNA_Lys³. We have submitted two versions of our Spinach2.1 BioBrick:

• BBa_K1330000 contains the Spinach2.1 tRNA_Lys³ complex in backbone pSB1C3.
• BBa_K1330001 contains the Spinach2.1 tRNA_Lys³ complex followed by terminator BBa_B0052 in backbone pSB1C3.

BBa_K1330000 can be used for reporter fusions. The fused mRNA product can be used both as a characterisation standard for the promoter, but can also be used to calculate the concentration of the fused transcript.

BBa_K1330001 can be used as stand-alone to characterise promoter activity. The submitted BioBrick contains one mismatch in the tRNA scaffold, the brick has not been tested with this mismatch, but we expect the mismatch wont affect the function of Spinach2.1.
To be safe we recommend that BBa_K1330000 is used and ligated with a terminator if needed.

Additional Parts

In addition to our main contributions we decided to streamline the Anderson promoter library, as only 15 of the 20 promoters were distributed in the standard backbone pSB1C3. We were successful in cloning 4 of the 5 missing promoters into pSB1C3 and have submitted these parts as:

• BBa_K1330002 contains the promoter BBa_J23105
• BBa_K1330003 contains the promoter BBa_J23110
• BBa_K1330004 contains the promoter BBa_J23112
• BBa_K1330005 contains the promoter BBa_J23116

Technical University of Denmark
Department of Systems Biology
Søltofts Plads 221
2800 Kgs. Lyngby
Denmark
+45 45 25 25 25
dtuigem14@gmail.com .

• Recent changes
• What links here
• Related changes
• Special pages
• My preferences

• Printable version
• Permanent link
• Privacy policy
• Disclaimers