Growth experiments were conducted with fusaric acid concentrations ranging from 0 to 250 ug/ml were performed on Eschericia coli (Strains DH5alfa, BL21 and JM109), Bacillus subtilis and Pseudomonas putida. After 18 hours of incubation at 37 degress celcius, OD 600 measurements were taken.

                                                       

                                                       <figure>
                                                       <img src="" width="800px">
                                                       <figcaption>
                                                       Both B. subtilis and all of the E. coli strains show a strong response to increasing doses of fusaric acid in the medium. P. putida, however, does not show any decrease in growth for the concentrations used. Therefore another experiment was done with higher concentrations for P. putida.
                                                       </figcaption>
                                                       </figure>
                                                       

NOTE: After ordering new fusaric acid later in the project, it was found out that the fusaric acid used in this experiment was not the same strength, with the old one most likely being (partially) degraded. Therefore data from this experiment is not used.

                                                       </p>

</dd>

Since some soil bacteria are known to be able to degrade fusaric acid (FA), a HPLC experiment was started to test P. putida(PP) for fusaric acid degradation and carbon utilization. M9 media was used with glucose/fusaric acid(250ug/ml) or both as a carbon source.

For the HPLC the following settings were used.

• Column: Polaris C18A
• Eluent: Acetonitril
• Temperature: 35 degrees Celsius
• Flow speed: 0.5 ml/min
• Detection: UV (260 - 280nm)

                                                       <figure>
                                                       <img src="" width="800px">
                                                       <figcaption>
                                                       Left: The HPLC method used delivered a good calibration curve, but peak resolvance was not optimal, with the FA peak having overlap with several smaller peaks in the samples with P. putida. Therefore it was decided to repeat the experiment to improve the HPLC method. </br>
                                                       Right: Initial results on fusaric acid breakdown showed signs of breakdown, but because peak resolvance was not optimal and the measurements were not done in duplo more data was needed to draw conclusions.                                                      
                                                       </figcaption>
                                                       </figure>
                                                       													

Based on the initial results a more elaborate experiment was started in duplo. Six samples would be grown in duplo:

• A. Negative control for growth on M9 without carbon source. (PP+, Glucose-, FA-)
• B. Positive control for growth on M9 with carbon source (glucose).(PP+, Glucose+, FA-)
• C. Positive control for growth on M9 with carbon source and fusaric acid. (PP+, Glucose+, FA-)
• D. Test for PP growth on FA as carbon source.(PP+, Glucose-, FA+)
• E. E. Negative control for contamination and FA stability. (PP+, Glucose-, FA-)
• F. Negative control for contamination. (PP-, Glucose+, FA-)

                                                   </dd>

<a>Growth experiments</a></dt>




Using an automated platereader, time based growth was measured on P. putida, to see the response to different concentrations of fusaric acid.

                                                       <figure>
                                                       <img src="" width="800px">
                                                       <figcaption>
                                                       P. putida growth followed for 12 hours grown in LB medium. The OD was measured every 15 minutes at 600nm. Plates were incubated shaking at 30 degrees Celsius. Concentrations of fusaric acid are noted in the legend in ug/ml. </br>
                                                       At concentrations higher then 500 P. putida ceases to grow.
                                                       </figcaption>
                                                       </figure>
                                                       </dd>

</dl>

</div>

August

<a>Isolation of genes</a></dt>

All gene clusters were isolated using <a href="https://static.igem.org/mediawiki/2014/e/eb/Wageningen_UR_protocols_Pcr.pdf"target="_blank" class="soft_link">PCR</a>. The following primers were used. Temperatures were calculated using <a href="http://tmcalculator.neb.com/" class="soft_link" target="blank">NEB Tm Calculator</a>

P. putida PP1263-1266

• FP: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGATGCCGCGTCGCATCATC
• RP: GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATCAACCTTCGCCAGGCTTGAC

Klebsiella oxycota FDT-123

• FP: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGATGCTCGCCTATTACGTTGC
• RP: GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTACTATGGGTGGATAGCCTGAGC

Stenotrophomonas maltophilia FuaABC

• FP: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGATTGATTGTCATTGTAGCGAAATTC
• RP: GTTTCTTCCTGCAGCGGCCGCTACTAGTACGGTAATTTCCTGAACAGAC

Pseudomonas cepacia FusABCDE

• FP: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGGGAGAAAATCATGCAGTCTC
• RP: GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATTACGACTTCTTCTGCTTGTCC

                                                   </dd>

<a>Transformations</a></dt>

                                                   </dd>



</div>






</div>

</div>