Team:DTU-Denmark/Primers
From 2014.igem.org
(Difference between revisions)
Line 2: | Line 2: | ||
<html> | <html> | ||
- | <style> td {padding:10px; border:2px solid black} | + | <style> td {padding:10px; border:2px solid black; box-shadow: 0 0 5px black;} |
table{background-color:transparent; border-collapse: collapse;}</style> | table{background-color:transparent; border-collapse: collapse;}</style> | ||
<body> | <body> |
Revision as of 12:42, 17 October 2014
Below is a list of primers used in the experimental work
Primer name | 5'-sequence-3' | Description |
VF2 | TGCCACCTGACGTCTAAGAA | Primer for sequencing insert in standard backbone |
VR | ATTACCGCCTTTGAGTGAGC | Reverse primer for sequencing insert in standard backbone |
P3 | ATTCCGCUAAGGATGATTTCTGGAATTCGCGG | Primer attaching on backbone upstream BioBrick prefix |
P4 | ACCTTGCCCUTTTTTGCCGGACTGCAGCGGC | Primer attaching on backbone downstream BioBrick suffix |
P5 | TGGCGCCCGAACAGGGACTTGA | Reverse primer attaching upstream terminator for in vitro template amplification |
P6 | TAATACGACTCACTATAGGGAGAGCCCGGATAGCTCAGTCGGT | Primer with T7 promoter tail for in vitro transcription template aplification |
P7 | TTGCCGGACTGCAGCGGCCGCTACTAGTATGGCGCCCGAACAGGGACTT | Reverse primer attaching upstream of the terminator with a primer tail including BioBrick suffix |