Escherichia coli strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B E.coli were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GenArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.

Luria Broth Miller (LB) and LB Agar were purchased from ????, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.

Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM.

Cloning of pSB-AraC-pBAD

The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on the image below (left hand side, add legend, add figure number). The primers used during this procedure were as follows:

• Forward: TACTAGTAGCGGCCGCTGCAG
• Reverse: GCTAGCCCAAAAAAACGGGTATGGAG

The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B E.coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.

Cloning of pSB-LacI-pLAC

Assembly of Acs elements

The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B E.coli using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5 ml LB were inoculated with a freshly growing colony and grown overnight at 37°C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.

In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, the vector backbone (pSB1C3), AcsA and AcsB were submitted to SpeI/PstI, XbaI/SpeI and XbaI/PstI double digests, respectively, to later yield pSB-AcsAB. AcsC, AcsD were digested in a similar manner, and would be cloned into pSB1C3 to yield pSB-AcsCD. Prior to ligation, the vector backbone was dephosphorylated using AP phosphorylase (Roche). A three-part ligation was then set up, keeping equimolar ratios amongst all three parts, and incubated at 4 degrees overnight. The resulting ligation mix was transformed using the NEB High Efficiency Transformation protocol into NEB 10B cells (New England Biolabs), which were in turn plated and incubated overnight at 37 degrees. 5ml LB supplied with 50ug/ml Chloramphenicol were inoculated with a selection of colonies for further.

The pSB-AraC-pBAD construct was assembled as described in Materials and Methods. As a preliminary verification step, a restriction analysis was carried out using XbaI and PstI, and results were visualized on a 1% Agarose Gel. A 2-band pattern was obtained, indicating the presence of a ~2kb DNA fragment potentially corresponding to the pSB1C3 vector backbone, and a ~1kb fragment corresponding to the AraC and pBAD elements being cloned. Final confirmation of successful cloning was obtained by gene sequencing of the part in question, using the BioBrick Verification Primers, shown below: (refer to the “Sequencing” section to find a compilation of all confirmed parts)

• Verification Primer Forward: T GCC ACC TGA CGT CTA AGA A
• Verification Primer Reverse: ATT ACC GCC TTT GAG TGA GC