|
|
Line 1: |
Line 1: |
- | <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
| + | /*This is wetlab2*/ |
- | <html xmlns=" http://www.w3.org/1999/xhtml">
| + | |
- | <head>
| + | |
- | <meta http-equiv="Content-Type" content="text/html; charset=gb2312" />
| + | |
- | <title>LZU-China 2014</title>
| + | |
- | <style type="text/css">
| + | |
- | | + | |
- | body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}
| + | |
- | img{border:0px;}
| + | |
- | .picList{width:100%;float:left;}
| + | |
- | .picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}
| + | |
- | .picList .col img,.col a{position:absolute;top:0px;left:0px;}
| + | |
- | .picList .col img{width:100%;}
| + | |
- | .picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}
| + | |
- | .msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}
| + | |
- | | + | |
- | .picList2{width:100%;float:left;}
| + | |
- | .picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}
| + | |
- | .picList2 .col img,.col a{position:absolute;top:0px;left:0px;}
| + | |
- | .picList2 .col img{width:100%;}
| + | |
- | .picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}
| + | |
- | .msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}
| + | |
- | | + | |
- | .picList3{width:100%;float:left;}
| + | |
- | .picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}
| + | |
- | .picList3 .col img,.col a{position:absolute;top:0px;left:0px;}
| + | |
- | .picList3 .col img{width:100%;}
| + | |
- | .picList3 .col a{
| + | |
- | display:block;
| + | |
- | width:580;
| + | |
- | height:377px;
| + | |
- | top:357px;
| + | |
- | background:rgba(0,0,0,0.7);
| + | |
- | color:white;
| + | |
- | font-style:normal;
| + | |
- | line-height:25px;
| + | |
- | padding:10px;
| + | |
- | opacity:0.8;
| + | |
- | text-decoration:none;
| + | |
- | }
| + | |
- | .msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}
| + | |
- | | + | |
- | .picList4{width:100%;float:left;}
| + | |
- | .picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}
| + | |
- | .picList4 .col img,.col a{position:absolute;top:0px;left:0px;}
| + | |
- | .picList4 .col img{width:100%;}
| + | |
- | .picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}
| + | |
- | .msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}
| + | |
- | | + | |
- | .picList5{width:100%;float:left;}
| + | |
- | .picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}
| + | |
- | .picList5 .col img,.col a{position:absolute;top:0px;left:0px;}
| + | |
- | .picList5 .col img{width:100%;}
| + | |
- | .picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}
| + | |
- | .msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}
| + | |
- | | + | |
- | .picList6{width:100%;float:left;}
| + | |
- | .picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}
| + | |
- | .picList6 .col img,.col a{position:absolute;top:0px;left:0px;}
| + | |
- | .picList6 .col img{width:100%;}
| + | |
- | .picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}
| + | |
- | .msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}
| + | |
- | | + | |
- | .picList7{width:100%;float:left;}
| + | |
- | .picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}
| + | |
- | .picList7 .col img,.col a{position:absolute;top:0px;left:0px;}
| + | |
- | .picList7 .col img{width:100%;}
| + | |
- | .picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}
| + | |
- | .msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}
| + | |
- | | + | |
- | .picList8{width:100%;float:left;}
| + | |
- | .picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}
| + | |
- | .picList8 .col img,.col a{position:absolute;top:0px;left:0px;}
| + | |
- | .picList8 .col img{width:100%;}
| + | |
- | .picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}
| + | |
- | .msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}
| + | |
- | | + | |
- | *{margin:0px;padding:0px;} | + | |
- | body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}
| + | |
- | b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}
| + | |
- | #accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}
| + | |
- | #accordian li {width:50px; height:300px; float:left;
| + | |
- | -moz-transition: 0.7s;
| + | |
- | -ms-transition: 0.7s;
| + | |
- | -o-transition: 0.7s;
| + | |
- | -webkit-transition: 0.7s;
| + | |
- | transition: 0.7s;
| + | |
- | }
| + | |
- | #accordian div {width:530px; height:300px; position:relative;}
| + | |
- | #accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;
| + | |
- | }
| + | |
- | #accordian div span a {color:#fff;}
| + | |
- | #accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}
| + | |
- | #accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);
| + | |
- | transform: rotate(-90deg);
| + | |
- | transform-origin:bottom left;
| + | |
- | -ms-transform: rotate(-90deg);
| + | |
- | -ms-transform-origin:bottom left;
| + | |
- | -webkit-transform: rotate(-90deg);
| + | |
- | -webkit-transform-origin:bottom left;
| + | |
- | -moz-transform: rotate(-90deg);
| + | |
- | -moz-transform-origin:bottom left;
| + | |
- | -o-transform: rotate(-90deg);
| + | |
- | -o-transform-origin:bottom left;
| + | |
- | }
| + | |
- | #accordian li div > a b {*left:0;}
| + | |
- | #accordian li img {display:block; float:left;}
| + | |
- | #accordian li.p1 {width:530px;}
| + | |
- | #accordian li.p1 div span {bottom:0;}
| + | |
- | #accordian li a.a1 {background:#b33866; border-left:1px solid #682;}
| + | |
- | #accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}
| + | |
- | #accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}
| + | |
- | #accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}
| + | |
- | #accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}
| + | |
- | #p1:target ~ #accordian li {width:50px;}
| + | |
- | #p1:target ~ #accordian li div span {bottom:300px;}
| + | |
- | #p1:target ~ #accordian li.p1 {width:530px;}
| + | |
- | #p1:target ~ #accordian li.p1 div span {bottom:0;}
| + | |
- | #p2:target ~ #accordian li {width:50px;}
| + | |
- | #p2:target ~ #accordian li div span {bottom:300px;}
| + | |
- | #p2:target ~ #accordian li.p2 {width:530px;}
| + | |
- | #p2:target ~ #accordian li.p2 div span {bottom:0;}
| + | |
- | #p3:target ~ #accordian li {width:50px;}
| + | |
- | #p3:target ~ #accordian li div span {bottom:300px;}
| + | |
- | #p3:target ~ #accordian li.p3 {width:530px;}
| + | |
- | #p3:target ~ #accordian li.p3 div span {bottom:0;}
| + | |
- | #p4:target ~ #accordian li {width:50px;}
| + | |
- | #p4:target ~ #accordian li div span {bottom:300px;}
| + | |
- | #p4:target ~ #accordian li.p4 {width:530px;}
| + | |
- | #p4:target ~ #accordian li.p4 div span {bottom:0;}
| + | |
- | #p5:target ~ #accordian li {width:50px;}
| + | |
- | #p5:target ~ #accordian li div span {bottom:300px;}
| + | |
- | #p5:target ~ #accordian li.p5 {width:530px;}
| + | |
- | #p5:target ~ #accordian li.p5 div span {bottom:0;}
| + | |
- | | + | |
- | | + | |
- | #contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/
| + | |
- | | + | |
- | .firstHeading {
| + | |
- | width: 975px;
| + | |
- | margin: 0px auto;
| + | |
- | padding-top: 100px;
| + | |
- | margin-bottom: 20px;
| + | |
- | font-family: Georgia, Times, "Times New Roman", serif;
| + | |
- | }
| + | |
- | | + | |
- | h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}
| + | |
- | | + | |
- | #top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/
| + | |
- | background-color: #383838;
| + | |
- | border: 0 none;
| + | |
- | height: 14px;
| + | |
- | z-index: 100;
| + | |
- | top: 0;
| + | |
- | position: fixed;
| + | |
- | width: 975px;
| + | |
- | left: 50%;
| + | |
- | margin-left: -487px;
| + | |
- | }
| + | |
- | | + | |
- | #top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/
| + | |
- | background-color: #383838;
| + | |
- | height: 14px;
| + | |
- | display: block;
| + | |
- | z-index: 10;
| + | |
- | position: fixed;
| + | |
- | width: 100%;
| + | |
- | top: 0;
| + | |
- | }
| + | |
- | | + | |
- | #menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/
| + | |
- | color: #727272;
| + | |
- | text-decoration: none;
| + | |
- | background-color: transparent;
| + | |
- | }
| + | |
- | | + | |
- | body {
| + | |
- | background-color: #fff;
| + | |
- | }
| + | |
- | | + | |
- | #globalWrapper, #content { /*-- changes default wiki settings --*/
| + | |
- | width: 100%;
| + | |
- | height: 100%;
| + | |
- | border: 0px;
| + | |
- | background-color: transparent;
| + | |
- | margin: 0px;
| + | |
- | padding: 0px;
| + | |
- | }
| + | |
- | | + | |
- | html, body, .wrapper { /*-- changes default wiki settings --*/
| + | |
- | width: 100%;
| + | |
- | height: 100%;
| + | |
- | background-color: transparent;
| + | |
- | }
| + | |
- | | + | |
- | #contentcontainer { /*-- creates container for all content on page --*/
| + | |
- | font-family: Arial, Helvetica, sans-serif;
| + | |
- | font-weight: normal;
| + | |
- | font-size: 14px;
| + | |
- | color: #414141;
| + | |
- | width: 960px;
| + | |
- | margin-left: auto;
| + | |
- | margin-right: auto;
| + | |
- | background-color: #transparent;
| + | |
- | margin-top: 0px;
| + | |
- | }
| + | |
- | | + | |
- | .sidemenu, .sidemenu li {
| + | |
- | list-style-type: none;
| + | |
- | list-style-image: none;
| + | |
- | font-family: verdana;
| + | |
- | text-decoration: none;
| + | |
- | color:#000;
| + | |
- | font-size: 14px;
| + | |
- | }
| + | |
- | | + | |
- | .sidemenu li {display: block;}
| + | |
- | | + | |
- | .sidemenu a {
| + | |
- | text-decoration:none;
| + | |
- | color: #000;
| + | |
- | display: block;
| + | |
- | width: 180px;
| + | |
- | height: 100%;
| + | |
- | padding: 3px 5px;
| + | |
- | transition: .25s ease-in-out;
| + | |
- | -moz-transition: .25s ease-in-out;
| + | |
- | -webkit-transition: .25s ease-in-out;
| + | |
- | }
| + | |
- | | + | |
- | .sidemenu a.greyout { color: #909090; }
| + | |
- | | + | |
- | .sidemenu a:hover {
| + | |
- | color:#666;
| + | |
- | background-color: #d9f5aa;
| + | |
- | }
| + | |
- | | + | |
- | .sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}
| + | |
- | .sub-sidemenu a {color: #666;}
| + | |
- | | + | |
- | div.underconst
| + | |
- | {
| + | |
- | padding:10px;
| + | |
- | border-radius:5px;
| + | |
- | background-color:pink;
| + | |
- | text-align:center;
| + | |
- | }
| + | |
- | | + | |
- | a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}
| + | |
- | | + | |
- | .contentpara {margin-bottom: 30px;}
| + | |
- | | + | |
- | span.email{font-family: monospace; font-weight: normal;}
| + | |
- | | + | |
- | fieldset {border: 1px solid #337f53;}
| + | |
- | | + | |
- | .greyout {color: #A0A0A0;}
| + | |
- | .highlightme {background-color: #FFFF00;}
| + | |
- | | + | |
- | #alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}
| + | |
- | #annContainer {margin-left: 8px;}
| + | |
- | #newsContainer {border: 1px solid #ccc;}
| + | |
- | | + | |
- | .newsTitle {
| + | |
- | display: block;
| + | |
- | color: #414141;
| + | |
- | font-size: 25px;
| + | |
- | font-family: Georgia, Times, "Times New Roman", serif;
| + | |
- | padding: 10px 15px 5px 10px;
| + | |
- | border-bottom: 1px solid #ccc;
| + | |
- | margin-bottom: 0px;
| + | |
- | }
| + | |
- | | + | |
- | .newsItem {
| + | |
- | border-bottom: 1px solid #ccc;
| + | |
- | display: block;
| + | |
- | padding: 5px 15px 0px 10px;
| + | |
- | margin-bottom: 0px;
| + | |
- | }
| + | |
- | | + | |
- | .newsItem h3 {
| + | |
- | width: auto;
| + | |
- | display: inline;
| + | |
- | font-size: 14px;
| + | |
- | font-family: Arial, Helvetica, sans-serif;
| + | |
- | padding: 0px;
| + | |
- | margin: 0px;
| + | |
- | }
| + | |
- | | + | |
- | .newsItem img {
| + | |
- | float: right;
| + | |
- | clear: right;
| + | |
- | width: 80px;
| + | |
- | padding-left: 15px;
| + | |
- | display: inline-block;
| + | |
- | }
| + | |
- | | + | |
- | .newsItem .newsDate {
| + | |
- | font-style: italic;
| + | |
- | font-size: 14px;
| + | |
- | display: inline-block;
| + | |
- | color: #999;
| + | |
- | float: right;
| + | |
- | padding: 0px 0px 10px 15px;
| + | |
- | }
| + | |
- | | + | |
- | .newsItem p, .newsItem ul, .newsItem li {
| + | |
- | padding: 0px;
| + | |
- | margin-left: 20px;
| + | |
- | font-size: 12px;
| + | |
- | line-height: 1.2;
| + | |
- | }
| + | |
- | | + | |
- | .newsItem p {margin-top: 10px;}
| + | |
- | | + | |
- | .annItem {
| + | |
- | border: 2px solid #49b677;
| + | |
- | display: block;
| + | |
- | padding: 0px 15px 10px 10px;
| + | |
- | margin-bottom: 18px;
| + | |
- | position: relative;
| + | |
- | height: 160px;
| + | |
- | vertical-align: middle;
| + | |
- | }
| + | |
- | | + | |
- | .annItem .annCentered {
| + | |
- | display: table-cell;
| + | |
- | vertical-align: middle;
| + | |
- | height: 160px;
| + | |
- | }
| + | |
- | | + | |
- | .annCentered h3 {
| + | |
- | padding: 0px;
| + | |
- | display: block;
| + | |
- | margin-left: auto;
| + | |
- | margin-right: auto;
| + | |
- | text-align: center;
| + | |
- | }
| + | |
- | | + | |
- | .annItem ul, .annItem li {padding: 0px; margin: 0px;}
| + | |
- | .annItem li {list-style: none; margin: 5px}
| + | |
- | | + | |
- | @charset "utf-8";
| + | |
- | body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{
| + | |
- | margin:0;
| + | |
- | padding:0;
| + | |
- | font-size: 14px;
| + | |
- | text-align: left;
| + | |
- | }
| + | |
- | html{background-color:#e9ecec}
| + | |
- | table{table-layout:fixed;border-collapse:collapse}
| + | |
- | section,article,aside,header,footer,nav,dialog,figure{display:block}
| + | |
- | .clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}
| + | |
- | body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}
| + | |
- | h1,h2,h3,h4,h5,h6{font-size:100%}
| + | |
- | address,cite,dfn,em,var{font-style:normal}
| + | |
- | code,kbd,pre,samp{font-family:courier new,courier,monospace}
| + | |
- | small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}
| + | |
- | a:hover{text-decoration:underline;color:#06C}
| + | |
- | sup{vertical-align:text-top}
| + | |
- | sub{vertical-align:text-bottom}
| + | |
- | legend{color:#000}
| + | |
- | fieldset,img{border:0 none}
| + | |
- | button,input,select,textarea{font-size:100%}
| + | |
- | table{
| + | |
- | border-collapse:collapse;
| + | |
- | border-spacing:0;
| + | |
- | text-align: center;
| + | |
- | }
| + | |
- | input:focus{outline:none}
| + | |
- | .hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}
| + | |
- | .f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}
| + | |
- | .hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}
| + | |
- | .hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}
| + | |
- | .hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}
| + | |
- | .hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}
| + | |
- | .hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}
| + | |
- | .hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}
| + | |
- | .hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}
| + | |
- | .hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}
| + | |
- | .hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}
| + | |
- | .hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}
| + | |
- | .hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}
| + | |
- | .hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}
| + | |
- | .hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}
| + | |
- | .hd-main .navs .def-nav .app-url .arrow{left:140px}
| + | |
- | .hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}
| + | |
- | .hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}
| + | |
- | .hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}
| + | |
- | .hd-main .navs .app-url .li:hover{background-color:#e0e1e5}
| + | |
- | .hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}
| + | |
- | .hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}
| + | |
- | .hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}
| + | |
- | .hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}
| + | |
- | .hd-main .navs .app-url .note .icon{background-position:-150px 0}
| + | |
- | .hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}
| + | |
- | .hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}
| + | |
- | .hd-main .navs .app-url .youxi .icon{background-position:-300px 0}
| + | |
- | .hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}
| + | |
- | .hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}
| + | |
- | .hd-main .navs .pulldown-nav{position:relative}
| + | |
- | .hd-main .navs .pulldown-nav em{
| + | |
- | position:absolute;
| + | |
- | display:block;
| + | |
- | left:99px;
| + | |
- | top:18px;
| + | |
- | height:12px;
| + | |
- | width:12px;
| + | |
- | font-size:0;
| + | |
- | background-position:-89px -45px
| + | |
- | }
| + | |
- | .hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}
| + | |
- | .hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}
| + | |
- | .hd-main .navs .current:hover{color:#ECECEC}
| + | |
- | .hd-main .navs .current .hover{background-color:#dedede;color:#333;}
| + | |
- | .hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}
| + | |
- | .hd-main .info a{color:#d8d8d8}
| + | |
- | .hd-main .info a:hover{color:#FFF;text-decoration:underline}
| + | |
- | .hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}
| + | |
- | .hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}
| + | |
- | .hd-main .info .has-pulldown{padding-right:28px}
| + | |
- | .hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}
| + | |
- | .hd-main .info .no-separate{border:none}
| + | |
- | .hd-main .info .user-name{position:relative;padding-left:24px}
| + | |
- | .hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}
| + | |
- | .hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}
| + | |
- | .hd-main .info .user-name .is-vip{background-position:-89px -68px}
| + | |
- | .hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/
| + | |
- | .hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}
| + | |
- | .hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/
| + | |
- | .hd-main .info .user-info .arrow{left:70px;*left:-32px}
| + | |
- | .hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}
| + | |
- | .hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}
| + | |
- | .hd-main .info .more-info .content{height:150px}
| + | |
- | .hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}
| + | |
- | .hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}
| + | |
- | .hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}
| + | |
- | .hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}
| + | |
- | .hd-main .info .more-info{right:0}
| + | |
- | .hd-main .info .more-info .arrow{left:94px;*left:-8px}
| + | |
- | #apDiv1 {
| + | |
- | position:absolute;
| + | |
- | left:3px;
| + | |
- | top:4px;
| + | |
- | width:100%;
| + | |
- | height:900px;
| + | |
- | z-index:0;
| + | |
- | background-color: #66CCFF;
| + | |
- | }
| + | |
- | /*<![CDATA[*/
| + | |
- | body {
| + | |
- | margin:0;
| + | |
- | padding:0 10px 0 10px;
| + | |
- | border:0;
| + | |
- | height:100%;
| + | |
- | overflow:auto;
| + | |
- | background-color: #FFF;
| + | |
- | }
| + | |
- | #menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}
| + | |
- | * html #menu {position:absolute; right:16px; top:0;}/*only for ie*/
| + | |
- | html {overflow:auto !important; overflow:hidden;}
| + | |
- | | + | |
- | #apDiv2 {
| + | |
- | position:absolute;
| + | |
- | left:0;
| + | |
- | top:50px;
| + | |
- | width:100%;
| + | |
- | height:265px;
| + | |
- | z-index:0;
| + | |
- | background-color: #187BDB;
| + | |
- | }
| + | |
- | #apDiv3 {
| + | |
- | position:absolute;
| + | |
- | left:0px;
| + | |
- | top:328px;
| + | |
- | width:100%;
| + | |
- | height:150px;
| + | |
- | z-index:0;
| + | |
- | }
| + | |
- | #apDiv3 table tr td p {
| + | |
- | font-size: 15px;
| + | |
- | text-align: left;
| + | |
- | }
| + | |
- | #apDiv4 {
| + | |
- | position:absolute;
| + | |
- | left:0;
| + | |
- | top:9704px;
| + | |
- | width:100%;
| + | |
- | height:56px;
| + | |
- | z-index:0;
| + | |
- | }
| + | |
- | #apDiv5 {
| + | |
- | position:absolute;
| + | |
- | left:0;
| + | |
- | top:6288px;
| + | |
- | width:100%;
| + | |
- | height:25;
| + | |
- | z-index:1;
| + | |
- | background-color: #5FC1C5;
| + | |
- | }
| + | |
- | #apDiv3 div {
| + | |
- | font-size: 46px;
| + | |
- | text-align: center;
| + | |
- | }
| + | |
- | #apDiv4 table tr td div {
| + | |
- | font-size: 45px;
| + | |
- | color: #000;
| + | |
- | text-align: left;
| + | |
- | }
| + | |
- | #apDiv4 table tr td table tr td {
| + | |
- | font-size: 16px;
| + | |
- | line-height: 30px;
| + | |
- | }
| + | |
- | body,td,th {
| + | |
- | color: #000;
| + | |
- | }
| + | |
- | #apDiv6 {
| + | |
- | position:absolute;
| + | |
- | left:575px;
| + | |
- | top:6177px;
| + | |
- | width:220px;
| + | |
- | height:221px;
| + | |
- | z-index:2;
| + | |
- | }
| + | |
- | #apDiv2 table tr td p {
| + | |
- | font-size: 45px;
| + | |
- | text-align: center;
| + | |
- | color: #FFF;
| + | |
- | font-weight: bold;
| + | |
- | }
| + | |
- | #apDiv7 {
| + | |
- | position:absolute;
| + | |
- | left:50%;
| + | |
- | top:226px;
| + | |
- | width:257px;
| + | |
- | height:151px;
| + | |
- | z-index:auto;
| + | |
- | }
| + | |
- | #apDiv3 div {
| + | |
- | font-size: 14px;
| + | |
- | }
| + | |
- | #apDiv8 {
| + | |
- | position:absolute;
| + | |
- | left:0;
| + | |
- | top:680px;
| + | |
- | width:100%;
| + | |
- | height:470px;
| + | |
- | z-index:0;
| + | |
- | }
| + | |
- | #apDiv4 table tr td table tr td p {
| + | |
- | font-size: 18px;
| + | |
- | line-height: 32px;
| + | |
- | }
| + | |
- | #apDiv8 table tr td table tr td {
| + | |
- | font-size: 45px;
| + | |
- | }
| + | |
- | #apDiv8 table tr td table tr td p {
| + | |
- | font-size: 18px;
| + | |
- | line-height: 31px;
| + | |
- | }
| + | |
- | #apDiv9 {
| + | |
- | position:absolute;
| + | |
- | left:0px;
| + | |
- | top:6251px;
| + | |
- | width:100%;
| + | |
- | height:55px;
| + | |
- | z-index:4;
| + | |
- | }
| + | |
- | #apDiv9 table tr td table tr td table tr td {
| + | |
- | font-size: 35px;
| + | |
- | }
| + | |
- | #apDiv9 table tr td table tr td table tr td p {
| + | |
- | font-size: 18px;
| + | |
- | line-height: 31px;
| + | |
- | }
| + | |
- | #apDiv4 table tr td table tr td div div {
| + | |
- | font-size: 15px;
| + | |
- | }
| + | |
- | #apDiv4 table tr td table tr td table tr td {
| + | |
- | font-size: 15px;
| + | |
- | }
| + | |
- | #apDiv4 table tr td table tr td table tr td {
| + | |
- | font-size: 15px;
| + | |
- | }
| + | |
- | #apDiv8 table tr td table tr td table tr td {
| + | |
- | font-size: 18px;
| + | |
- | }
| + | |
- | #apDiv10 {
| + | |
- | position:absolute;
| + | |
- | left:0;
| + | |
- | top:6956px;
| + | |
- | width:1004px;
| + | |
- | height:539px;
| + | |
- | z-index:5;
| + | |
- | }
| + | |
- | #apDiv9 table tr td table tr td table tr td table tr td {
| + | |
- | font-size: 18px;
| + | |
- | }
| + | |
- | #apDiv11 {
| + | |
- | position:absolute;
| + | |
- | left:0;
| + | |
- | top:7440px;
| + | |
- | width:100%;
| + | |
- | height:140px;
| + | |
- | z-index:5;
| + | |
- | }
| + | |
- | #apDiv11 table tr td table tr td {
| + | |
- | font-size: 35px;
| + | |
- | }
| + | |
- | #apDiv11 table tr td table tr td p {
| + | |
- | font-size: 18px;
| + | |
- | line-height: 32px;
| + | |
- | }
| + | |
- | #apDiv11 table tr td table tr td table tr td {
| + | |
- | font-size: 18px;
| + | |
- | }
| + | |
- | #apDiv3 table tr td {
| + | |
- | font-size: 18px;
| + | |
- | line-height: 32px;
| + | |
- | }
| + | |
- | #apDiv8 table tr td table tr td div {
| + | |
- | text-align: center;
| + | |
- | }
| + | |
- | #apDiv8 table tr td table tr td div {
| + | |
- | }
| + | |
- | </style>
| + | |
- | </head>
| + | |
- | | + | |
- | <body id="" class="">
| + | |
- | <div id="apDiv2">
| + | |
- | <table width="100%" border="0" >
| + | |
- | <tr>
| + | |
- | <td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/9/99/9.notebook.top.jpg/800px-9.notebook.top.jpg" width="1366" height="270" /></p></td>
| + | |
- | <td width="100%" height="199" bgcolor="#187ADB"> </td>
| + | |
- | </tr>
| + | |
- | <tr>
| + | |
- | <td height="70"> </td>
| + | |
- | </tr>
| + | |
- | </table>
| + | |
- | </div>
| + | |
- | <div id="apDiv3">
| + | |
- | <table width="100%" border="0">
| + | |
- | <tr>
| + | |
- | <td width="25%"> </td>
| + | |
- | <td><p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> "Rome was not built in a day." No matter which group we belong to, we took our work for almost a whole year. What did we do on earth? This notebook will show you in detail.</p>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <div><a href="https://2014.igem.org/Team:LZU-China/Notebook"><img src="https://static.igem.org/mediawiki/2014/8/8f/Z.wabb%281%29.png" width="214" height="99" /></a> <a href="https://2014.igem.org/Team:LZU-China/NotebookB"><img src="https://static.igem.org/mediawiki/2014/e/e6/Z.wabb%282%29.png" width="215" height="99" /></a><a href="https://2014.igem.org/Team:LZU-China/NotebookC"><img src="https://static.igem.org/mediawiki/2014/0/0e/Z.wabb%283%29.png" width="212" height="99" /></a></div>
| + | |
- | <p> </p></td>
| + | |
- | <td width="25%"> </td>
| + | |
- | </tr>
| + | |
- | </table>
| + | |
- | <p> </p>
| + | |
- | </div>
| + | |
- | <p> </p>
| + | |
- | <table width="100%" border="0" align="center">
| + | |
- | <tr>
| + | |
- | <td width="20%"> </td>
| + | |
- | </tr>
| + | |
- | <tr>
| + | |
- | <td width="20%"> </td>
| + | |
- | </tr>
| + | |
- | <tr>
| + | |
- | <td width="20%"> </td>
| + | |
- | </tr>
| + | |
- | </table>
| + | |
- | </div>
| + | |
- | <div id="apDiv5">
| + | |
- | <table width="1365" border="0"">
| + | |
- | <tr>
| + | |
- | <td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td>
| + | |
- | </tr>
| + | |
- | </table>
| + | |
- | </div>
| + | |
- | <div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div>
| + | |
- | <div id="apDiv8">
| + | |
- | <p> </p>
| + | |
- | <table width="100%" border="0">
| + | |
- | <tr>
| + | |
- | <td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p> </p>
| + | |
- | <p> </p>
| + | |
- | <table width="100%" border="0" >
| + | |
- | <tr>
| + | |
- | <td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" > THE NOTEBOOK OF WET LAB GROUP A</td>
| + | |
- | </tr>
| + | |
- | </table></td>
| + | |
- | </tr>
| + | |
- | <tr>
| + | |
- | <td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><table width="100%" border="0">
| + | |
- | <tr>
| + | |
- | <td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"> </td>
| + | |
- | <td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%"><p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> 2014.5.16-5.23<br />
| + | |
- | The pre-experience of the growth of three strains(<em>Shewanella onedensis,</em> <em>Pseudomonas aeruginosa </em>and LZU-3, which is separated in Li’s lab )in different PNP concentration and Cr(VI) concentration.</p>
| + | |
- | <p> </p>
| + | |
- | <p> <img src="https://static.igem.org/mediawiki/2014/f/f5/Z.da1.png" width="700" height="173" /></p>
| + | |
- | <div><img src="file:///E|/[iGEM]/wiki/2014logomin.png" width="358" height="40" /></div>
| + | |
- | <p> </p>
| + | |
- | <p> <img src="file:///E|/https://static.igem.org/mediawiki/2014/e/e0/Partpic2.png" width="301" height="251" /></p>
| + | |
- | <div><img src="file:///E|/[iGEM]/wiki/partpic2.png" width="301" height="251" /></div>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> 2014.5.24-5.31<br />
| + | |
- | Measurement for three strains’(<em>Shewanella onedensis,</em> <em>Pseudomonas aeruginosa </em>and LZU-3, which is separated in Li’s lab ) Cr(VI) reduction activity.</p>
| + | |
- | <div><img src="file:///E|/[iGEM]/wiki/dblbluebar.jpg" alt="" width="1365" height="463" /></div>
| + | |
- | <p> </p>
| + | |
- | <p> <img src="https://static.igem.org/mediawiki/2014/thumb/d/dc/Z.a2.png/463px-Z.a2.png" width="467" height="605" /></p>
| + | |
- | <p> </p>
| + | |
- | <p> 2014.6.1-2014.6.8<br />
| + | |
- | 1.Another measurement for three strains’(as above said) Cr(VI) reduction activity.</p>
| + | |
- | <p> <img src="https://static.igem.org/mediawiki/2014/a/a6/Z.a3.png" width="569" height="482" /></p>
| + | |
- | <p> </p>
| + | |
- | <p> 2.Construction of the phylogeny tree containing the LZU-3 </p>
| + | |
- | <p> <img src="https://static.igem.org/mediawiki/2014/5/52/Z.4.png" width="654" height="503" /></p>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> 2014.6.8-2014.7.24<br />
| + | |
- | The PCR cycling for BBa_I723020 and BBa_I723133</p>
| + | |
- | <p> </p>
| + | |
- | <p> 1. The primers(synthesized by BGI,shenzhen)</p>
| + | |
- | <p> 1.1 Promoter of BBa_I723133 <br />
| + | |
- | The forward primer (5’ TATACTAGTCTGGGGCGAGAGGCGACGAC 3’) contained a SpeI cutsite <br />
| + | |
- | The reverse primer (5’ GGGGAATTCTAGAATGTGGGCTGCTTGGTG 3’) contained a EcoRI and XbaI cutsite. <br />
| + | |
- | 2313bp</p>
| + | |
- | <p> 1.2 BBa_I723020<br />
| + | |
- | The forward primer (5’GGTGCTGCAGACTAGTATTGAAGGGTCACCACTATTTTTATTTTA 3’) containes SpeI and PstI cutsites <br />
| + | |
- | the reverse primer (5’ ATGAATTCTCTAGACCTGCTGGAGGGCGTGAAC 3’) containes EcoRI and XbaI cutsites. <br />
| + | |
- | 340bp</p>
| + | |
- | <p> </p>
| + | |
- | <p> 2.The PCR system</p>
| + | |
- | <p> 0.2μL ExTaq.<br />
| + | |
- | 1μL bacterial liquid<br />
| + | |
- | 1μL dNTP<br />
| + | |
- | 1μL forward primer<br />
| + | |
- | 1μL reverse primer<br />
| + | |
- | 2.5μL 10x Buffer<br />
| + | |
- | 18.5μL ddH2O</p>
| + | |
- | <p> </p>
| + | |
- | <p> 2014.7.31-8.1<br />
| + | |
- | Pre-experience for the function of BBa_K381001.<br />
| + | |
- | BBa_K381001 transformation to E.coli DH5 alpha<br />
| + | |
- | There are two groups to test the green fluorescence under microscope:<br />
| + | |
- | (These groups' total sizes are all 20μL, had been shaken for 2hours before observation,400x)<br />
| + | |
- | a.bacterial liquid with 10mM PNP concentration.<br />
| + | |
- | b.bacterial liquid with 20mM PNP concentration.<br />
| + | |
- | </p>
| + | |
- | <p> <img src="https://static.igem.org/mediawiki/2014/2/2d/Z.5.png" width="704" height="307" /></p>
| + | |
- | <p> </p>
| + | |
- | <p> 2014.8.2-2014.8.6<br />
| + | |
- | Pre-experience for the function of BBa_K381001.<br />
| + | |
- | BBa_K381001 transformation to E.coli DH5 alpha<br />
| + | |
- | There are four groups to test the green fluorescence under microscope:<br />
| + | |
- | (These groups' total sizes are all 20μL, had been shaken for 2hours before observation,1000x)<br />
| + | |
- | a.bacterial liquid with 10mM PNP concentration.b.<br />
| + | |
- | b.bacterial liquid with ddH2O<br />
| + | |
- | c.bacterial liquid with 10mM KNO3<br />
| + | |
- | d.bacterial liquid with 10mM KCl.<br />
| + | |
- | </p>
| + | |
- | <p> <img src="https://static.igem.org/mediawiki/2014/4/41/Z.a6.png" width="455" height="340" /></p>
| + | |
- | <p> </p>
| + | |
- | <p> 2014.8.25-9.21<br />
| + | |
- | 1.Construction of BBa_K1523101<br />
| + | |
- | </p>
| + | |
- | <p> <img src="https://static.igem.org/mediawiki/2014/2/28/Z.a7.png" width="489" height="90" /></p>
| + | |
- | <p> </p>
| + | |
- | <p> The size of the whole part is about 3700bp(without plasmid), we test the assembling result by PCR(sense:5'---TTCCCATCTATAATCCTCCCTGATTCTTCG---3';anti-sense:5'---GAATTCTCTAGATTACAACTGTTGTTCAAGCTGTT---3'). From the gel picture we can see the size is right.</p>
| + | |
- | <p> <img src="https://static.igem.org/mediawiki/2014/c/cf/Z.a8.png" width="643" height="305" /></p>
| + | |
- | <p> </p>
| + | |
- | <p> 2.Construction of BBa_K1523024(yieF) and BBa_K1523005(chrR)</p>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> 2014.9.21-10.2<br />
| + | |
- | Construction of BBa_K1523021(<em>nahR</em>), K1523022(<em>nahE</em>) and K1523023(<em>nahG</em>).</p>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <p> </p>
| + | |
- | <p>
| + | |
- | <p>
| + | |
- | <p>
| + | |
- | <p>
| + | |
- | <p>
| + | |
- | <p>
| + | |
- | <p> </td>
| + | |
- | <td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%"> </td>
| + | |
- | </tr>
| + | |
- | </table></td>
| + | |
- | </tr>
| + | |
- | <tr>
| + | |
- | <td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><p> </p>
| + | |
- | <p> </p></td>
| + | |
- | </tr>
| + | |
- | </table>
| + | |
- | </div>
| + | |
- | <div >
| + | |
- | <div style=" height:890px;"> </div>
| + | |
- | <div id="menu">
| + | |
- | <script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script>
| + | |
- | <script type="text/javascript">
| + | |
- | $(document).ready(function(){
| + | |
- | $(".def-nav,.info-i").hover(function(){
| + | |
- | $(this).find(".pulldown-nav").addClass("hover");
| + | |
- | $(this).find(".pulldown").show();
| + | |
- | },function(){
| + | |
- | $(this).find(".pulldown").hide();
| + | |
- | $(this).find(".pulldown-nav").removeClass("hover");
| + | |
- | });
| + | |
- | });
| + | |
- | </script>
| + | |
- | <div class="hd-main clearfix" id="header">
| + | |
- | <a class="logo" href="https://2014.igem.org/Team:LZU-China"></a>
| + | |
- | <div class="navs">
| + | |
- | <a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a>
| + | |
- | <span class="separate"></span>
| + | |
- | <div class="def-nav current has-pulldown-special">
| + | |
- | <a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a>
| + | |
- | <div class="pulldown app-url">
| + | |
- | <div class="content">
| + | |
- | <a class="li disk" href="https://2014.igem.org/Team:LZU-China/background">
| + | |
- | <span class="icon"></span>
| + | |
- | <span class="text">Background</span>
| + | |
- | </a>
| + | |
- | <a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab">
| + | |
- | <span class="icon"></span>
| + | |
- | <span class="text">Wet Lab</span>
| + | |
- | </a>
| + | |
- | <a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab">
| + | |
- | <span class="icon"></span>
| + | |
- | <span class="text">Dry Lab</span>
| + | |
- | </a>
| + | |
- | <a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts">
| + | |
- | <span class="icon"></span>
| + | |
- | <span class="text">Parts</span>
| + | |
- | </a>
| + | |
- | <a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab">
| + | |
- | <span class="icon"></span>
| + | |
- | <span class="text">Interlab</span>
| + | |
- | </a>
| + | |
- | <a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future">
| + | |
- | <span class="icon"></span>
| + | |
- | <span class="text">Future Work</span>
| + | |
- | </a>
| + | |
- | </div>
| + | |
- | </div>
| + | |
- | </div>
| + | |
- | <span class="separate"></span>
| + | |
- | <a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a>
| + | |
- | <span class="separate"></span>
| + | |
- | <a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a>
| + | |
- | <span class="separate"></span>
| + | |
- | <a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a>
| + | |
- | </div>
| + | |
- | <div class="info">
| + | |
- | <ul>
| + | |
- | <li class="info-i user-name has-pulldown">
| + | |
- | <em class="f-icon pull-arrow"></em>
| + | |
- | <a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a>
| + | |
- | <span class="name top-username">Our Team</span>
| + | |
- | <div class="pulldown user-info">
| + | |
- | <em class="arrow"></em>
| + | |
- | <div class="content">
| + | |
- | <span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span>
| + | |
- | <span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span>
| + | |
- | <span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span>
| + | |
- | <span class="separate-li no-height"></span>
| + | |
- | <span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span>
| + | |
- | <span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span>
| + | |
- | <span class="separate-li no-height"></span>
| + | |
- | </div>
| + | |
- | </div>
| + | |
- | </li>
| + | |
- | <li class="info-i no-separate default-text has-pulldown">
| + | |
- | <em class="f-icon pull-arrow"></em>
| + | |
- | <span class="more" hideFocus="hideFocus">More</span>
| + | |
- | <div class="pulldown more-info">
| + | |
- | <em class="arrow"></em>
| + | |
- | <div class="content">
| + | |
- | <span class="separate-li no-height"></span>
| + | |
- | <span class="li"><a href="">Team Profile</a></span>
| + | |
- | <span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span>
| + | |
- | <span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span>
| + | |
- | </div>
| + | |
- | </div>
| + | |
- | </li>
| + | |
- | </ul>
| + | |
- | </div>
| + | |
- | </div>
| + | |
- | <div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';">
| + | |
- | <div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';">
| + | |
- | </div>
| + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | </div>
| + | |
- | </div>
| + | |
- | </body>
| + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | <script type="text/javascript">
| + | |
- | function MM_showHideLayers() { //v9.0
| + | |
- | var i,p,v,obj,args=MM_showHideLayers.arguments;
| + | |
- | for (i=0; i<(args.length-2); i+=3)
| + | |
- | with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];
| + | |
- | if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }
| + | |
- | obj.visibility=v; }
| + | |
- | }
| + | |
- | </script>
| + | |