"
Team:Paris Bettencourt/Project/TMAU
From 2014.igem.org
| Line 205: | Line 205: | ||
<div id=part1 class=project> | <div id=part1 class=project> | ||
<p class=text2> | <p class=text2> | ||
| - | <img src='https://static.igem.org/mediawiki/2014/6/69/Juanmtest_pb.jpg' > | + | <img src='https://static.igem.org/mediawiki/2014/6/69/Juanmtest_pb.jpg' > <br> <br> |
</p> | </p> | ||
<h6>Aims and Achievement</h6><br> | <h6>Aims and Achievement</h6><br> | ||
Revision as of 18:05, 16 October 2014
Something Fishy
| BACKGROUND Trimethylamine (TMA) is produced by bacteria in the human gut and degraded in the liver by a flavin-containing monooxygenase 3 (FMO3). Trimethylaminuria, or Fish Odor Syndrome, is a rare genetic disease caused by inactivating mutations in the FMO3 gene. Consequently, TMA accumulates in sweat, saliva, and urine, causing a strong fish odor. Patients suffer no other serious symptoms. |
AIMS TMA is also processed by the trimethylamine monooxygenase (Tmm) of Ruegeria pomeroyi, an enzyme similar to human FMO3. If we express this enzyme in human skin bacteria, it should remove TMM from sweat and reduce its unpleasant odor. TMM-expressing bacteria in a cream or spray might be used by trimethylaminuria patients as a stable, inexpensive treatment. |
RESULTS We successfully cloned the gene TMM into two vectors, the standard pSB1C3 and pSEVA351, a vector with an independent origin of replication. pSEVA is able to replicate in many different bacterial strains, including C. striatum, a skin bacteria. Our biobrick was sent to the registry and accepted under the code BBa_K1403015. We successfully characterized the activity of the enzyme and quantified it by a colorimetric assay and confirmed the degradation of trimethylamine by gas chromatography and mass spectrophotometry. |
| Aims and Achievement | Introduction | Results | Methods | References |
Aims and Achievement
Ruegeria pomeroyi, a bacteria member of the Rhodobacteraceae genus, produces an enzyme called trimethylamine monooxygenase thanks to the tmm(trimethylamine mono-oxygenase) gene. As FMO3, this enzyme degrades trimethylamine into trimethylamine-N-oxide but is adapted to a bacterial expression. The project aims at cloning tmm into E.coli and then into Corynebacterium striatum, one of the most common bacteria of the skin. The new strain would be integrated to the skin microbiome and would suppress the fish odor.
Introduction
Trimethylamine (TMA) is produced in the intestine by Desulfovibrio desulfuricans by fermentation of choline. In healthy patients, the fmo gene allows the degradation of TMA in the liver into a non-volatile compound, TMA oxide. But a mutation in the fmo3 sequence is most of the time the cause of TMAU: TMA is not degraded and is then excreted in sweat, saliva and urine leading to a strong fish odor. The patients are otherwise healthy but the disease affect their social relationships and can lead to depression. There is currently no cure for this metabolic disorder. Some treatments, often focused on restricting diet, tend to lower the symptoms.
Results
After cloning tmm into a Biobrick vector (pSB1C3), the construct was successfully expressed in E. coli. TMM activity was found in E. coli pSB1C3-TMM (tmm+) but not in E. coli pSB1C3 (tmm-). TMM does not only degrade trimethylamine into trimethylamine-N-oxide, but also converts indole into indigo. To measure the activity of TMM, the growth medium was supplemented with tryptophan, a precursor of indole, which is the substrate of TMM. After 14h of culture, cells were pelleted, washed twice with sterile water, resuspended in DMSO and sonicated. TMM activity was determined by measuring the absorbance spectrum of bacterial extractions. Peaks at 620 nm were found in tmm+ cultures supplemented with tryptophan, which was identified as indigo according to absorbance spectrum analysis.
Methods
tmm was cloned in a standard biobrick vector (pSB1C3) using XbaI and HindIII restriction sites. The set of primers used for PCR (Forward: CTTCTAGAGCTGACAGCTAGCTCAGTCC Reverse: TACTAGTATCAGTGGTGATGGTGATGATG) allowed us to use BLABLABLA as restriction enzymes. The vector and the PCR product were digested for 2h at 37°C and ligated 1h at 22°C, and overnight at 4°C using a 1:3 vector:insert ratio. Chemically competent NEB turbo strain of E.coli was transformed using Heat Shock transformation protocol. TMM does not only degrade trimethylamine into trimethylamine-N-oxide, but also converts indole into indigo. Thus, TMM-expressing E.coli are blue. Analytical digestion was performed using Thermo Scientific GeneJET Plasmid Miniprep Kit after overnight culture in LB/medium, digestion with BLA and BLABLA and electrophoresis using 0.5X TBE and 1% agarose gels. The presence of bands at 1.5kb (the length of tmm) confirmed the presence of tmm in the new strain. Another strain of E.coli was also created using pSEVA315 plasmid which is a shuttle vector that can be cloned in other genders of bacteria. Measurement of TMM activity was performed on TMM-expressing E.coli using the isolation of indigo protocol inspired of Choi H.S., Kim J.K et al. (2003).
References
- ref1- ref2
+33 1 44 41 25 22/25
paris-bettencourt-igem@googlegroups.com 
