"
Team:BYU Provo/Notebook/Auxotrophy/febapr
From 2014.igem.org
| Line 90: | Line 90: | ||
<h2>Week of March 23rd</h2> | <h2>Week of March 23rd</h2> | ||
<h3>March 17, 2014</h3> | <h3>March 17, 2014</h3> | ||
| - | <p>--CB MM TR-- Researched articles on the environment of waste water treatment plants and the possible genes we could knock out to prepare for our presentation on <i>N.multiformis</i> metabolism optimization. | + | <p>--CB MM TR-- Researched articles on the environment of waste water treatment plants and the possible genes we could knock out to prepare for our presentation on <i>N.multiformis</i> metabolism optimization.</p> |
| + | <p>http://www.jstor.org/stable/25035171</p> | ||
| + | <p>http://www.jstor.org/stable/25034119</p> | ||
| + | <p>http://aslo.org/lo/toc/vol_17/issue_5/0749.pdf</p> | ||
| + | <p>The first paper makes leucine out to be present in both raw sewage and sewage effluent. The second paper confirms this.</p> | ||
<p>Focused our efforts on a unique gene knock out that would make <i>N. multiformis</i> reliant on the environment of the bio-reactor to grow.</p> | <p>Focused our efforts on a unique gene knock out that would make <i>N. multiformis</i> reliant on the environment of the bio-reactor to grow.</p> | ||
| + | <p>The 2 gene kill switch is a terrible idea. If any mutations are made in the kill switch, the whole thing will fail. If any mutations are made in the repressor gene, the thing will die, meaning that evolution will keep this thing having the repressor switch I guess. In the one gene kill switch model, if any mutations are made, it will also fail. So yeah, a better plan is needed. | ||
| + | That plan is….auxotrophy! We’ll have to knock a whole gene out, which will be very hard for it to replace. This gene will be something that makes an amino acid, likely. This amino acid will then be derived from the bioreactor during its normal life span, so that if it ever leaves the bioreactor, it will starve to death. Dr. Grose said that glutamine would be a good AA to try, so we’ll have to dig some and talk to the metabolic team to see what kind of glutamine needs/synthesis capabilities this thing has. | ||
| + | <p>Reading over a few articles now to see what the environment inside the bioreactor is like:</p> | ||
| + | |||
| + | |||
| + | Asparagine has two pathways to create it. Asn supposedly has function in metabolism and storage of Nitrogen. That being said, we don’t want to knock it out. | ||
| + | http://aem.asm.org/content/74/11/3559.full#ref-5 | ||
| + | |||
<h3>March 18, 2014</h3> | <h3>March 18, 2014</h3> | ||
Revision as of 17:21, 16 October 2014
BYU 2014 Notebook |
|||||||||||||
| |||||||||||||
Week of March 16th
March 12, 2014
--CB MM TR-- Researched possible kill switch options for N. multiformis. Focused on the environment of the bio-reactor to control spread of N. multiformis.
Originally we considered designing a trigger that is specific to the environment of the bioreactor that, when removed from the environment would express a gene that would kill the bacteria. However we realized that such a design would be problematic due to the high mutation rate of N. multiformis.
Week of March 23rd
March 17, 2014
--CB MM TR-- Researched articles on the environment of waste water treatment plants and the possible genes we could knock out to prepare for our presentation on N.multiformis metabolism optimization.
http://www.jstor.org/stable/25035171
http://www.jstor.org/stable/25034119
http://aslo.org/lo/toc/vol_17/issue_5/0749.pdf
The first paper makes leucine out to be present in both raw sewage and sewage effluent. The second paper confirms this.
Focused our efforts on a unique gene knock out that would make N. multiformis reliant on the environment of the bio-reactor to grow.
The 2 gene kill switch is a terrible idea. If any mutations are made in the kill switch, the whole thing will fail. If any mutations are made in the repressor gene, the thing will die, meaning that evolution will keep this thing having the repressor switch I guess. In the one gene kill switch model, if any mutations are made, it will also fail. So yeah, a better plan is needed. That plan is….auxotrophy! We’ll have to knock a whole gene out, which will be very hard for it to replace. This gene will be something that makes an amino acid, likely. This amino acid will then be derived from the bioreactor during its normal life span, so that if it ever leaves the bioreactor, it will starve to death. Dr. Grose said that glutamine would be a good AA to try, so we’ll have to dig some and talk to the metabolic team to see what kind of glutamine needs/synthesis capabilities this thing has.
Reading over a few articles now to see what the environment inside the bioreactor is like:
Asparagine has two pathways to create it. Asn supposedly has function in metabolism and storage of Nitrogen. That being said, we don’t want to knock it out. http://aem.asm.org/content/74/11/3559.full#ref-5March 18, 2014
--CB MM TR-- Reviewed all of our literature findings so far. In doing so, identified the specific focuses for our group: inserting the denitrification genes into N. multiformis, making N. multiformis more resistant to pH changes, and making N. multiformis more resistant to heavy metals.
March 19, 2014
--CB MM TR-- Presented our ideas for improving the metabolism of N. multiformis and received feedback from the class on them. Confirmed plan to insert the denitrification pathway into N. multiformis. Decided to forego other original goals and instead insert genes that would break down antibiotics.
March 20, 2014
March 21, 2014
Week of March 27th, 2014
March 24, 2014
--CB MM TR-- Continued researching auxotrophy ideas.
March 26, 2014
March 28, 2014
Week of April 5th
March 31, 2014
--CB MM TR--Drafted an email to send to NEB in order to obtain the HindIII RM genes to put into N. multiformis for prevention of lateral gene transfer.
http://blast.ncbi.nlm.nih.gov/Blast.cgi#alnHdr_490282362 : We did a protein BLAST of the gene immediately downstream from the Nmul_A0428(serA) gene and found that is most likely involved in UDP-glucose epimerase production. We could find evidence either way for how vital it is for life of the cell, so we don’t want to include our own promoter on the gene we insert using homologous recombination in case that messes up the cell and causes loss of viability.
Homologous Recombination primers:
Forward - ATGAACAAACTTGCGATTTCCACCTCGTCATTCGATGTCAGCCATAATAG + 20-25bp Promoter,SD,amp gene sequence
Reverse - 20-25bp amp gene complement + TTAACCTTTTTCCATTACACCGGCTTCGATCAATCCGCGCACCAGATTTT
April 1, 2014
--CB MM TR--Dr. Grose received an email back from the NEB representative for our area which said we could get the requested plasmid if we filled out a Materials Transfer Agreement. We decided that since we wouldn’t be able to put our work in the iGEM registry, and we should have all of our genes in the chromosome, that we are just going to forget about the lateral gene transfer prevention.
April 2, 2014
--CB MM TR--Because we are not going to be able to include our own promoter, we have decided against switching the serA gene with a gene we would need to put in anyway. Instead we are going to use an FRT protocol to just knock out the gene and then use a flippase get rid of the in between nucleotides.
http://www.ncbi.nlm.nih.gov/nuccore/NC_007614.1?report=fasta&from=474841&to=476072&strand=true : This is the Nmul_A0428 gene with 50bp up and downstream of the start and stop codons.
April 4, 2014
--CB MM TR--http://rothlab.ucdavis.edu/protocols/frt-rules.html : Looked over the FRT primer design from Rothlabs at UC Davis
Week of April 12th, 2014
April 7, 2014
--CB MM TR--Worked on our circuit design for making N multiformis auxotrophic for serine. Finalized the primer designs for our recombinase. After we have inserted the amp resistance in place of the serA gene into the chromosome, we can add a flippase to the cells, which will cut out the amp gene.
April 8, 2014
--CB MM TR--Finalized our circuit design for Wednesday. Finished finding and inserting protocols for each of the steps we are going through.
April 9, 2014
--CB MM TR--Transformed two promoters (J23115 and J23116) into DH5α E. coli by heat shock transformation. Took 3ul purified plasmid into 25ul DH5α competent cells. Kept on ice for 5 min, heat shock at 42˚C for 1 min, ice for 3 min. Added 500ul LB, incubate by aeration at 37˚C for 45 min. Plate all 500ul and incubate overnight at 37˚C. We are testing 20 different promoters from the iGEM Registry to see the activity level of each in order to decide what promoters will be bet to use for the different parts of our project.
April 11, 2014
--CB MM TR--Performed a plasmid prep of the promoter plasmids we transformed into E coli on Wednesday. Broke into groups of 2 and each group did 3 samples.
Week of April 19th
April 14, 2014
Week of April 26th
April 21, 2014
--CB MM TR--Our team prepared a semester final on our N.multiformis Serine Auxotrophy Process.
