|
|
| Line 154: |
Line 154: |
| | <div id="neiyes"></div> | | <div id="neiyes"></div> |
| | <div id="neiyez"> | | <div id="neiyez"> |
| - | <h3 style="padding-left:20px">1.Primer Design</h3> | + | <h3 style="padding-left:20px">1.PCR amplification</h3> |
| - | <p style="padding-left:20px">Strategies for designing primers for target genes.<br> | + | <p style="padding-left:20px">① PCR amplification of amilCP (BBa_K592009)<br> |
| - | Several software programs are available for sequence analysis and primer design，such as . These can be used to ensure that the primer sequences have the following general characteristics:</p>
| + | Primers: <br> |
| - | <p style="padding-left:20px">① Are 18–30 bases long ( if the PCR enzyme is Taq DNA Polymerase; this number may change for enzymes with greater heat stability) . Longer primers give more specificity but tend to anneal with lower efficiency, leading to decreased yield.<br> | + | Sense: GGGCCCATGAGTGTGATCGCTAAACAAAT<br> |
| - | ② Contain no internal secondary structure.<br>
| + | Antisense: GGTACCAAGCTTAGGCGACCACAGGTTTG</p> |
| - | ③ Have G/C content between 40% and 60%. <br>
| + | <p style="padding-left:20px">① PCR amplification of amilCP ( BBa_K592009)<br> |
| - | ④ Have a balanced distribution of G/C and A/T rich domains.<br>
| + | Primers: <br> |
| - | ⑤ Are not complementary to each other at their 3´ ends and are not self complementary.<br>
| + | Sense: GGGCCCATGAGTGTGATCGCTAAACAAAT<br> |
| - | ⑥ Have a melting temperature (Tm) that allows annealing to occur between 55° and 65°C.</p>
| + | Antisense: GGTACCAAGCTTAGGCGACCACAGGTTTG<br>Reaction system: </p> |
| - | <h3 style="padding-left:20px">2.Expression vector construction</h3>
| + | <p style=" text- align: center"><img src=" https:// static. igem. org/mediawiki/2014/e/e7/ 2014NEAU_data- img_A1.jpg"></p> |
| - | <p style=" padding- left: 20px" >2.1 PCR system<br><img src=" http:// nd. cn. usa.wakelion.net/ data- img/pro1.jpg"> <br>All reagents are provided by TAKARA.</p> | + | <p style="padding-left:20px">PCR condition :<br><img src=" https:// static. igem. org/mediawiki/2014/e/e7/ 2014NEAU_data- img_A2.jpg"></p> |
| - | <p style="padding-left:20px"> 2.2Basic PCR condition<br><img src=" http:// nd. cn. usa.wakelion.net/ data- img/pro2.jpg"> <br>Time of annealing and elongation can be adjusted appropriately depending on the length of gene amplified .</p> | + | <p style="padding-left:20px">② PCR amplification of cjBlue (BBa_K592011)<br>Primers: <br> |
| - | <p style="padding-left:20px">2.3Purification of PCR product<br>After separation on 0.9% agarose gel, the PCR product was purified using TIANgel Midi Purification Kit according to the manual. </p> | + | Sense: GAATTCGGTAGCGGCTCCGGAAGCGGTTCCGGCAGCatggcttccaaaataagcg<br> |
| - | <p style=" padding- left: 20px" >2.4“A” adjunction of target genes<br><img src=" http:// nd. cn. usa.wakelion.net/ data-img/ pro3.jpg"></p> | + | Antisense: GGTACCAAGCTTAGGCGACCACAGGTTTG<br> |
| - | <p style="padding-left:20px">2.5TA ligation<br><img src="http://nd.cn.usa.wakelion.net/data-img/pro4.jpg"><br>16 ℃ for 4 hours.</p> | + | Reaction system: </p> |
| - | <p style=" padding- left: 20px" >2.6DNA Ligation<br><img src=" http:// nd. cn. usa.wakelion.net/ data-img/ pro5.jpg"> <br>16 ℃ overnight.</p> | + | <p style=" text- align: center"><img src=" https:// static. igem. org/ mediawiki/ 2014/e/e7/2014NEAU_data-img_A3.jpg"></p> |
| - | <p style="padding-left:20px">2.7Transformation of E. coli<br> | + | <p style="padding-left:20px">PCR condition</p> |
| - | ① Prepare LB Agar plates, autoclave, cool agar to 42º C, add antibiotics (ampicillin (100 mg/L) and kanamycin (100 mg/L)), pour liquid agar into 4 plates, and let agar harden for 1-2 hours. <br>
| + | <p style=" text- align: center"><img src=" https:// static. igem. org/mediawiki/ 2014/ e/e7/2014NEAU_data-img_A4.jpg"></p> |
| - | ② Thaw competent cells (DH5α) slowly on ice<br>
| + | <p style="padding-left:20px">③ PCR amplification of GlaA3<br>Primers: <br> |
| - | ③ Add 50 µL competent cells (DH5α) and 1 µL plasmid into sterile eppendorf tube and incubate on ice for 30 min.<br>
| + | Sense: AGATCT ACAATCAATCCATTTCGCTATAG<br> |
| - | ④ Place cells in water bath and rapidly raise temperature to 42° C for 90 seconds (water bath), and cool cells on ice for 2 min immediately.<br>
| + | Antisense: TCTAGA CATAAGGCGGGTTCACATC<br> |
| - | ⑤ Add the transformation mixture into 800 μL LB broth in sterile culture tube, grow cells with shaking (200 rpm) for 1 hour at 37° C.<br>
| + | Reaction system: </p> |
| - | ⑥ Spread 100 µL of cells onto LB agar plate (previously prepared and containing ampicillin and kanamycin) and let cells grow 24 hours at 37° C.<br>
| + | <p style="padding-left:20px"></p> |
| - | </p>
| + | <p style="padding-left:20px"></p> |
| - | <p style="padding-left:20px">2.8Extraction of plasmid<br>EasyPure Plasmid MiniPrep Kit (TransGen Co.) was used to extract plasmid. Details can be found from the manual. </p>
| + | <p style="padding-left:20px"></p> |
| - | <p style="padding-left:20px">2.9Identification of E. coli transformants<br>Restriction enzyme digestion<br><img src="http://nd.cn.usa.wakelion.net/data-img/pro6.jpg"><br>37° C for 3 hours.</p> | + | <p style="padding-left:20px"></p> |
| - | <p style="padding-left:20px">2.10Sequencing and sequence analysis<br>Plasmid was submitted to BGI Co. for sequencing. The result was analyzed using DNAman and BLAST. </p> | + | <p style="padding-left:20px"></p> |
| - | <h3 style="padding-left:20px">3. Genetic transformation of Aspergilus niger mediated by Agrobacterium tumefaciens</h3>
| + | <p style="padding-left:20px"></p> |
| - | <p style="padding-left:20px">3.1 Preparation of Agrobacterium competent cells <br> | + | <p style="padding-left:20px"></p> |
| - | ① Inoculate 5 ml YEB containing Rifampicin (50 mg/L) with a single colony of Agrobacterium (AGL) from a plate streaked out from a glycerol stock. Grow at 28℃ with shaking for about 1-2 days.<br>
| + | |
| - | ② The evening before preparing competent cells, use 300 µl of the preculture to inoculate 300 ml YEB containing 50 mg/L Rifampicin. Grow at 28℃ with shaking to an OD600 of 0.7-0.8.<br>
| + | |
| - | ③ Chill cells on wet ice for 30 min. Then distribute cell suspension into 50-ml Falcon tubes on ice. Centrifuge for 10 min at 3000 rpm in centrifuge cooled to 4℃. Decant the supernatant.<br>
| + | |
| - | ④ First wash with CaCl2 (20 mM). Add about 5 ml ice-cold 20 mM CaCl2 to each tube and resuspend cells by gentle vortexing. Centrifuge and decant supernatant as in step3.<br>
| + | |
| - | ⑤ Second wash with CaCl2 (20 mM). <br>
| + | |
| - | ⑥ Wash with 10% glycerol. Add about 5 ml ice-cold 10% glycerol to the tube and resuspend cells by gentle vortexing. Add ice-cold 10% glycerol to the tube to total volume of 20 ml, up and down several times. Centrifuge as in step 3. Carefully remove as much of the supernatant as possible by pepetting. Resuspend cell pellet in a total of 1.5 ml ice-cold 10% glycerol by vortexing.<br>
| + | |
| - | ⑦ Dispense 45 µl aliquots of the cell suspension into chilled 0.5 ml tubes and freeze in liquid nitrogen. Store at -80℃. </p>
| + | |
| - | <p style="padding-left:20px">3.2Transformation of Agrobacterium by freeze-thaw method<br> | + | |
| - | ① Add 1.0 μL recombinant plasmid DNA into 50 μL Agrobacterium competent cells, mixed gently, and incubate on ice for 5 min.
| + | |
| - | ② Place the mixture into liquid nitrogen for 8 min and put it into 37 ℃ water bath immediately.<br>
| + | |
| - | ③ Add the transformation mixture into 800 μL YEB liquid in sterile culture tube, grow cells with shaking (200 rpm) for 5 hours at 28 °C.<br>
| + | |
| - | ④ Spread 100 µL of cells onto YEB agar plate (previously prepared and containing Rifampicin (50 mg/L) and Kanamycin (100 mg/L)) and let cells grow 2-3 days at 28 °C.</p>
| + | |
| - | <p style="padding-left:20px">3.3Identification of Agrobacterium transformants by PCR<br> | + | |
| - | Agrobacterium transformants was identified using the gene-specific PCR primers. Single Agrobacterium colonies were used as PCR templates with water as a negative control and plasmid as positive control. </p>
| + | |
| - | <p style="padding-left:20px">3.4Transformation of Aspergillus Niger mediated by Agrobacterium<br> | + | |
| - | | + | |
| - | ① Positive transformants were inoculated to liquid YEB medium containing Rifampicin (50mg/L) and Kanamycin (100mg/L) and shaking cultured at 28℃ 200rpm overnight.<br>
| + | |
| - | ② Fresh Agrobacterium solution was inoculated into YEB lipid medium (containing Rifampicin 50mg/L) at the ratio of 1：10 and cultured at 28℃ with shaking to an OD600 of 0.8 -1.0. <br>
| + | |
| - | ③ 200 μL of Aspergillus Niger strain cultured in liquid PDA medium for 4 d and 100μL Agrobacterium solution were mixed in 1.5 mL EP tubes, and the mixture was centrifuged at 2400×g for 5 min. <br>
| + | |
| - | ④ Discard the supernatant, and the residues of Aspergillus niger and Agrobacterium were resuspended by 100 μL liquid PDA medium and mixed well.<br>
| + | |
| - | ⑤ The mixture was coated on cellophane which was laid on solid PDA medium (containing Acetosyringone, AS, 200 μM) and cultured at 28℃ for 2-3 d.</p>
| + | |
| - | <p style="padding-left:20px">3.5Screening of Aspergillus niger transformants<br> | + | |
| - | ① Cellophane laid on PDA co-culture medium was transferred to solid PDA screening medium which contained Hygromycin B (200 mM) and Cefotaxime Sodium (500 mM) and cultured at 32℃ for more than a week untill a significant growth of resistant colonies can be observed clearly. <br>
| + | |
| - | ② Resistant colonies were inoculated to 20 mL liquid PDA medium containing Hygromycin B (200 mM) for secondary screening. <br>
| + | |
| - | ③ Genomic DNA of Aspergillus niger mycelium after two times screening was extracted (Method was based on RESEARCH OF PEPA GENE FROM ASPERGILLUS USAMII EXPRESSION IN ASPERGILLUS NIGER, Shuoran Li, 2012), and PCR method was used to screen the positive transformants.</p>
| + | |
| - | | + | |
| | </div> | | </div> |
| | <div id="neiyex"></div> | | <div id="neiyex"></div> |
"
