By Yicong Tao

Plasmid used: pBX-084 PB5-HS4-TRE-mCherrynuc-2A-BlaloxN-GpA-HS4-PB3 (from Wei Huang’s lab). Total length is 6843bp.

Point mutation primer design:
Forward(5’-3’): cagcccatggttttcttctgcattacggggccg 33nt
Reverse(5’-3’): cggccccgtaatgcagaagaaaaccatgggctg 33nt
The primer pair is intended to eliminate the BbsI site in the mCherry because we need to use BbsI to insert our gRNA into our plasmid. Designed by Agilent Technologies point-mutation primer online design tools. The primers are complement with each other.

Agilent's Pointmutation method

8.13~8.14

PCR reaction

(12:06~14:XX 13th Aug, about 2h)

300ul, 50ul/reaction:

PCR reaction conditions:

DpnI digestion

(13 Aug 15:05~19:06)

Add 1ul DpnI directly to the amplification system

Digest 4h

No termination

Stored at -20℃

Nanodrop test after digestion

Bacteria transformation

(2014.8.13 22:08~2014.8.14 14:50)

Procedures:

1. Immediately, place the tubes on ice, allow cell to thaw on ice, 10 min
2. Check the cell to see if they have thawed, gently flick the cells 1-2 times to evenly resuspend the cells.
3. Divide the competent cells into 6 tubes,50μL each tube, Mark them with 58, 60, 61, 62, 63, 65. Keep the bacteria in ice during the procedure.
4. Add 5μL plasmid to each tube, shaking slightly
5. Incubate on ice for 30min
6. Heat shock, 42°C, 90s.
7. Keep on ice, 2 min
8. Add 200μl SOC medium to each tube, incubate 37°C, 200rpm, 45min
9. Centrifuge, 4000rmp, 5min, RT. Discard most of the medium and reserve 50μL. Resuspend.
10. Add 50μL bacteria to amp LB agar plate, distribute.
11. Incubate the plates at 37°C, 16 hours.

Results:

For all 6 groups, no colony forms.

Gel electrophoresis

Making the agarose gel (1%)

Adding samples

DNA marker (Takara DL5000, diluted): 10ul

Results:

The result of electrophoresis is not clear, so I redid the gel electrophoresis with the same sample.

No wanted band (6843bp) is observed.

Discussion:

1. PCR failed, so improving PCR conditions is the first choice. Try extending PCR cycles, denaturation time, annealing time and final extension time.
2. Do reaction termination after DpnI enzyme digestion (80℃ 20min) next time because reactive enzyme may binding to the DNA substrate and interfere the transformation efficiency.
3. The concentration of template DNA is also very essential, so using 2-step concentration ladder next time.

Agilent's Pointmutation method II

8.15

PCR

(23:35 14th Aug-08:30 15th Aug), about 2h. Next morning, check PCR machine was not at 4℃ hold conditions, and the heating stand was not cold
200ul, 50ul/reaction:

PCR reaction conditions:

Nanodrop test

Gel electrophoresis

Making the agarose gel (1%)

Adding samples

DNA marker (Takara DL5000, diluted): 10ul

Results:

Analysis: The band was in 2000bp location, which is far away from the original plasmid length (6800bp), which meant PCR didn’t got complete plasmid.
The possible reason might be:

1. The primer forms dimers which strong influence the efficiency of PCR (The smallest band is very light).
2. DNA is a double helix, which means the plasmid double strand can also anneal with each other. The elongation time was very long, which left enough time for the plasmid double strand to anneal with each other and prohibit the PCR process.

Solution:

1. Redesign the primer so that the primer pairs are not totally complementary with each other. Put the point mutation point near the 5’ end.
2. Use other PCR methods.

So I decided to change the PCR method.

2-pair primers PCR

I had two pairs of primers: one is for mCherry (called A), another is for point mutation (called B). I then used the forward primer of A to pair with the reverse primer of B, so did the forward primer of B with the reverse primer of A. Thus, I would get 2 short segments which had a small complementary region. Then, I added the two segments together and let them do PCR using each other as the template and primer in order to get the final whole length PCR product.
mCherry primer design:
Forward(5’-3’): TCGTTTAGTGAACCGTCAG 19nt
Reverse(5’-3’): cgaggaattcctattaTTCCTCTGCCCTCACTAG 34nt

PCR

50ul, 25ul/reaction:
Reaction 1:

Reaction 2:

PCR reaction conditions:

Gel electrophoresis

Making the agarose gel (1%)

Adding samples

DNA marker (Takara DL5000, diluted): 30ul

Results:
A2: reaction 1 (A: mCherry primer F; 2: Pointmutation Primer R)
1B: reaction 2 (B: mCherry primer R; 1: Pointmutation Primer F)

Analysis:
The predicting results is 448bp band in A2 and 372bp band in 1B (almost equally separate the mCherry). But the band in A2 was in 800bp and no band is observed in 1B. The possible reasons might be:

1. I added wrong primer pairs: two mCherry primers for A2 and two pointmutation primers for 1B. So that in A2 I got mCherry and in 1B I got primer dimer.
2. The elongation time might be too long.

So I redid the 2-pari primers PCR with modified PCR reaction conditions.

PCR II

Reaction conditions:

Gel electrophoresis: Results:
No band is observed.
Analysis:

1. The elongation time might be too short…
2. The annealing time for 1B might be wrong.

2-pari primers PCR II

8.16 10:25am~11.25am
I set a temperature gradient (45, 48, 51, 54, 57, 60℃) without shortening the elongation time.

PCR

150ul, 25ul/reaction: Reaction 1:

Reaction 2:

PCR reaction conditions:

Gel electrophoresis

11:50am ~12:25pm
Unfortunately, only in A2 did I observe the band. I doubt the annealing temperature was not high enough because strong primer dimers forms in 1B group. So I redid the 2-pair primers PCR again with even higher temperature gradient (62,63,64,65,66,67℃).

Gel electrophoresis II

Results: Only vague bands were observed in A2. Still no distinct bands observed in 1B. Analysis:

1. The reverse primer of pointmutation might be very easy to form dimer with the forward primer of mCherry, which led to the failure of PCR.
2. The compatibility of the two separate primers might be very bad.

I decided to try another methods.