|
|
| Line 174: |
Line 174: |
| | 2. Do reaction termination after DpnI enzyme digestion (80℃ 20min) next time because reactive enzyme may binding to the DNA substrate and interfere the transformation efficiency. | | 2. Do reaction termination after DpnI enzyme digestion (80℃ 20min) next time because reactive enzyme may binding to the DNA substrate and interfere the transformation efficiency. |
| | 3. The concentration of template DNA is also very essential, so using 2-step concentration ladder next time. | | 3. The concentration of template DNA is also very essential, so using 2-step concentration ladder next time. |
| - |
| |
| - | 8.15
| |
| - | Redo the previous point mutation.
| |
| - | PCR (23:35 14th Aug-08:30 15th Aug, about 2h. Next morning, check PCR machine was not at 4℃ hold conditions, and the heating stand was not cold)
| |
| - | 200ul, 50ul/reaction:
| |
| - | Component Volume Final Concentration
| |
| - | Q5 master mix 2X 100ul 1X
| |
| - | DNA template (251.4ng/ul) 1.0ul (A,B), 2.0ul (C,D) 1.257ng/ul (A,B), 2.514ng/ul (C,D)
| |
| - | Primer F (50uM) 2ul 500nM
| |
| - | Primer R (50uM) 2ul 500nM
| |
| - | ddH20 95ul -
| |
| - | Total 200ul -
| |
| - | PCR reaction conditions:
| |
| - | Step Temp (℃) Time (s)
| |
| - | Initial denaturation 98 60
| |
| - | 25 cycles 98 20
| |
| - | 63 30
| |
| - | 72 420
| |
| - | Final extension 72 600
| |
| - | Hold 4 ∞
| |
| - |
| |
| - | Nanodrop test
| |
| - | Anneal Temp (℃) A B C D
| |
| - | Conc (ng/ul) 474.2 492.0 466.7 445.9
| |
| - | 260/280 1.82 1.81 1.81 1.81
| |
| - | 260/230 0.72 0.73 0.72 0.70
| |
| - |
| |
| - | Gel electrophoresis:
| |
| - | Image is lost. But the result is negative because the band size is incorrect compared with the original plasmid.
| |
| - |
| |
| - | So I decided to change the PCR method.
| |
| - |
| |
| - | 2-pair primers PCR
| |
| - | I had two pairs of primers: one is for mCherry (called A), another is for point mutation (called B). I then used the forward primer of A to pair with the reverse primer of B, so did the forward primer of B with the reverse primer of A. Thus, I would get 2 short segments which had a small complementary region. Then, I added the two segments together and let them do PCR using each other as the template and primer in order to get the final whole length PCR product.
| |
| - | mCherry primer design:
| |
| - | Forward(5’-3’): TCGTTTAGTGAACCGTCAG
| |
| - | Reverse(5’-3’): cgaggaattcctattaTTCCTCTGCCCTCACTAG
| |
| - | 50ul, 25ul/reaction:
| |
| - | Reaction 1:
| |
| - | Component Volume Final Concentration
| |
| - | Q5 master mix 2X 25ul 1X
| |
| - | pBX084 diluted (25.14ng/ul) 2.0ul 1.257ng/ul
| |
| - | mCherry Primer F (50uM) 0.5ul 500nM
| |
| - | Pointmutation Primer R (50uM) 0.5ul 500nM
| |
| - | ddH20 22ul -
| |
| - | Total 50ul -
| |
| - | Reaction 2:
| |
| - | Component Volume Final Concentration
| |
| - | Q5 master mix 2X 25ul 1X
| |
| - | pBX084 diluted (25.14ng/ul) 2.0ul 1.257ng/ul
| |
| - | mCherry Primer R (50uM) 0.5ul 500nM
| |
| - | Pointmutation Primer F (50uM) 0.5ul 500nM
| |
| - | ddH20 22ul -
| |
| - | Total 50ul -
| |
| - | PCR reaction conditions:
| |
| - | Step Temp (℃) Time (s)
| |
| - | Initial denaturation 98 60
| |
| - | 25 cycles 98 20
| |
| - | 61 15
| |
| - | 72 20
| |
| - | Final extension 72 300
| |
| - | Hold 4 ∞
| |
| - |
| |
| - | Gel electrophoresis
| |
| - | Making the agarose gel (1%)
| |
| - | Component Volume
| |
| - | TAE 25ml
| |
| - | Agarose 0.25g
| |
| - | Gene Green 0.5ul
| |
| - | Adding samples
| |
| - | Component Volume
| |
| - | PCR product 10ul
| |
| - | 6X loading dye 2ul
| |
| - | Total 12ul
| |
| - | DNA marker (Takara DL5000, diluted): 30ul
| |
| - | Results:
| |
| - | A2: reaction 1 (A: mCherry primer F; 2: Pointmutation Primer R)
| |
| - | 1B: reaction 2 (B: mCherry primer R; 1: Pointmutation Primer F)
| |
| - |
| |
| - | Analysis:
| |
| - | The predicting results is 448bp band in A2 and 372bp band in 1B (almost equally separate the mCherry). But the band in A2 was in 800bp and no band is observed in 1B. The possible reasons might be:
| |
| - | 1. I added wrong primer pairs: two mCherry primers for A2 and two pointmutation primers for 1B. So that in A2 I got mCherry and in 1B I got primer dimer.
| |
| - | 2. The elongation time might be too long.
| |
| - |
| |
| - | So I redid the 2-pari primers PCR.
| |
| - | PCR reaction conditions:
| |
| - | Step Temp (℃) Time (s)
| |
| - | Initial denaturation 98 60
| |
| - | 25 cycles 98 20
| |
| - | 61 15
| |
| - | 72 15
| |
| - | Final extension 72 120
| |
| - | Hold 4 ∞
| |
| - |
| |
| - | Gel electrophoresis:
| |
| - |
| |
| - | Results:
| |
| - | No band is observed.
| |
| - | Analysis:
| |
| - | 1. The elongation time might be too short…
| |
| - | 2. The annealing time for 1B might be wrong.
| |
| - |
| |
| - | 8.16
| |
| - | 10:25am~11.25am
| |
| - | Redid 2-pari primers PCR but I set a temperature gradient (45, 48, 51, 54, 57, 60℃) without shortening the elongation time.
| |
| - | 150ul, 25ul/reaction:
| |
| - | Reaction 1:
| |
| - | Component Volume Final Concentration
| |
| - | Q5 master mix 2X 75ul 1X
| |
| - | pBX084 diluted (25.14ng/ul) 4ul 100.56ng
| |
| - | mCherry Primer F (50uM) 2ul 333.3nM
| |
| - | Pointmutation Primer R (50uM) 2ul 333.3nM
| |
| - | ddH20 67ul -
| |
| - | Total 150ul -
| |
| - | Reaction 2:
| |
| - | Component Volume Final Concentration
| |
| - | Q5 master mix 2X 75ul 1X
| |
| - | pBX084 diluted (25.14ng/ul) 4ul 100.56ng
| |
| - | mCherry Primer R (50uM) 2ul 333.3nM
| |
| - | Pointmutation Primer F (50uM) 2ul 333.3nM
| |
| - | ddH20 67ul -
| |
| - | Total 150ul -
| |
| - | PCR reaction conditions:
| |
| - | Step Temp (℃) Time (s)
| |
| - | Initial denaturation 98 60
| |
| - | 25 cycles 98 20
| |
| - | 45, 48, 51, 54, 57, 60 15
| |
| - | 72 20
| |
| - | Final extension 72 300
| |
| - | Hold 4 ∞
| |
| - |
| |
| - | 11:50am ~12:25pm Gel electrophoresis
| |
| - |
| |
| - | Unfortunately, only in A2 did I observe the band. I doubt the annealing temperature was not high enough because strong primer dimers forms in 1B group. So I redid the 2-pair primers PCR again with even higher temperature gradient (62,63,64,65,66,67℃).
| |
| - |
| |
| - | Gel electrophoresis:
| |
| - |
| |
| - | Results:
| |
| - | Only vague bands were observed in A2. Still no distinct bands observed in 1B.
| |
| - | Analysis:
| |
| - | 1. The reverse primer of pointmutation might be very easy to form dimer with the forward primer of mCherry, which led to the failure of PCR.
| |
| - | 2. The compatibility of the two separate primers might be very bad.
| |
| - |
| |
| - | I decided to try another methods.
| |
| - |
| |
| - | Half-plasmid PCR
| |
| - | First, only add one direction primer so I could get half linear plasmid. After that, I mix the two DNA together to get the complete DNA.
| |
| - |
| |
| - | 50ul, 25ul/reaction:
| |
| - | Reaction 1
| |
| - | Component Volume Final Concentration
| |
| - | Q5 master mix 2X 25ul 1X
| |
| - | pBX084 diluted (25.14ng/ul) 0.5ul 12.57ng
| |
| - | Pointmutation Primer F (50uM) 1ul 1000nM
| |
| - | ddH20 23ul -
| |
| - | Total 49.5ul -
| |
| - | Reaction 2
| |
| - | Component Volume Final Concentration
| |
| - | Q5 master mix 2X 25ul 1X
| |
| - | pBX084 diluted (25.14ng/ul) 0.5ul 12.57ng
| |
| - | Pointmutation Primer R (50uM) 1ul 1000nM
| |
| - | ddH20 23ul -
| |
| - | Total 49.5ul -
| |
| - | PCR reaction conditions:
| |
| - | Step Temp (℃) Time (s)
| |
| - | Initial denaturation 98 60
| |
| - | 25 cycles 98 20
| |
| - | 63 15
| |
| - | 72 5min
| |
| - | Final extension 72 10min
| |
| - | Hold 4 ∞
| |
| - |
| |
| - | Double primer PCR
| |
| - | Mix the two pairs of primer together but the density of the pointmutation primer is only 1/10 of the mCherry primer. So the pointmutation primer will be consumed very quickly in the first several rounds.
| |
| - | 150ul, 25ul/reaction:
| |
| - | Component Volume Final Concentration
| |
| - | Q5 master mix 2X 75ul 1X
| |
| - | pBX084 diluted (25.14ng/ul) 1ul 25.14ng
| |
| - | mCherry Primer F&R (50uM) 2ul 6666.7nM
| |
| - | Pointmutation Primer R (50uM) 0.2ul 666.7nM
| |
| - | ddH20 69.6ul -
| |
| - | Total 150ul -
| |
| - | PCR reaction conditions:
| |
| - | Step Temp (℃) Time (s)
| |
| - | Initial denaturation 98 60
| |
| - | 25 cycles 98 20
| |
| - | 45,48,52,55,58,61 20
| |
| - | 72 20
| |
| - | Final extension 72 5min
| |
| - | Hold 4 ∞
| |
| - | The two PCR methods proceed simultaneously from 17:00 to 19:30, then reserved in 4℃.
| |
| - |
| |
| - | 8.17
| |
| - | Gel electrophoresis:
| |
| - |
| |
| - | Analysis:
| |
| - | From Double-primer PCR we got 2 (or 3?) bands. The band which had length between 500~750 were very likely to be the successfully mutated (or the original template). The band between 250~500 might be the combination product of the two primer pairs.
| |
| - | Next I would do gel extraction for the 500~750 band and do BbsI enzyme digestion to verify if the BbsI site was successfully mutated or not.
| |
| - |
| |
| - | Gel extraction (13:53~15:20):
| |
| - | Tiangen Miniprep gel extraction kit (50 rxn)
| |
| - | As the Tiangen’s protocol instructed.
| |
| - |
| |
| - | Nanodrop test (15:30)
| |
| - | Band 700bp 400bp
| |
| - | Conc (ng/ul) 54.7 73.2
| |
| - | 260/280 1.094 1.464
| |
| - | 260/230 0.634 0.445
| |
| - |
| |
| - | BbsI enzyme digestion：(15:50~20:00, 4h10min)
| |
| - | Component Volume
| |
| - | NEB BbsI enzyme 0.2ul
| |
| - | DNA (700bp band) 3ul
| |
| - | 10X NEB buffer 2.1 1ul
| |
| - | ddH20 5.8ul
| |
| - | Total 10ul
| |
| - | 75℃ 20min inactivation in dry bath
| |
| - |
| |
| - | Gel electrophoresis (23:00~23:40)：
| |
| - |
| |
| - | Analysis:
| |
| - | After enzyme digestion, the band wasn’t cut into two bands (one about 440, another about 370).
| |
| - | The next day I would do BbsI and BspEI double digestion to verify the results because BspEI would cut out a 99bp band.
| |
| - | P.S. The expected band length is 820bp, which seems to be inconsistent with the figure. However, comparing with the PCR result of mCherry, the band location seems to be the same, which means it was likely to be the problem of Marker.
| |
| - |
| |
| - | Verification of the Point mutation (mCherry BbsI site mutation) by enzyme digestion
| |
| - | By Yicong Tao
| |
| - | 2014.8.18~8.19
| |
| - |
| |
| - | 8.18
| |
| - | Enzyme digestion:
| |
| - | BbsI, BspEI double digestion (10:05~21:30)
| |
| - | Component Volume
| |
| - | BbsI 0.8ul
| |
| - | BspEI 0.2ul
| |
| - | 700bp band 3ul
| |
| - | 10X NEBuffer 3.1 1ul
| |
| - | ddH2O 5ul
| |
| - | Total 10ul
| |
| - | P.S. The activity of BbsI in NEBuffer 3.1 is only about 25%, so I increase the volumn the BbsI to 4X.
| |
| - | BspEI digestion (15:41~21:30)
| |
| - | Component Volume
| |
| - | BbsI 0.2ul
| |
| - | 700bp band 3ul
| |
| - | 10X NEBuffer 3.1 1ul
| |
| - | ddH2O 5.8ul
| |
| - | Total 10ul
| |
| - |
| |
| - | 21:40~22:40 80℃ inactivation, then immediately put into ice to avoid self-ligation.
| |
| - | 22:50~23:20 Gel electrophoresis
| |
| - |
| |
| - | Analysis:
| |
| - | The DNA might decompose due to too long inactivation time (1h at 80℃).
| |
| - | However, Le Lin and Zeng Lidan thought high temp wouldn’t make DNA decompose. It was due to putting in ice immediately that makes DNA renaturation difficult.
| |
| - | So, I decided to do enzyme digestion again without heat inactivation and do gel electrophoresis to see the results. I also will put the enzyme digestion system into 4℃ refrigerator overnight and do gel electrophoresis again the next day to verify if Le and Zeng’s idea was correct.
| |
| - |
| |
| - | 8.19
| |
| - |
| |
| - | Analysis:
| |
| - | From the gel electrophoresis result, Lin and Zeng’s idea was not correct because again no band is observed. BspEI digestion cut off a 99bp short segment and we can see the band moved quicker than BbsI band. The 273bp band was not observed in BspEI & BbsI double digestion, which means no BbsI site is in the PCR product. So the pointmutation was finally successful.
| |
| | | | |
| | | | |
By Yicong Tao
Plasmid used: pBX-084 PB5-HS4-TRE-mCherrynuc-2A-BlaloxN-GpA-HS4-PB3 (from Wei Huang’s lab). Total length is 6843bp.
Point mutation primer design:
Forward(5’-3’): cagcccatggttttcttctgcattacggggccg 33nt
Reverse(5’-3’): cggccccgtaatgcagaagaaaaccatgggctg 33nt
The primer pair is intended to eliminate the BbsI site in the mCherry because we need to use BbsI to insert our gRNA into our plasmid. Designed by Agilent Technologies point-mutation primer online design tools. The primers are complement with each other.
8.13~8.14 Agilent's Pointmutation method
PCR reaction
(12:06~14:XX 13th Aug, about 2h)
300ul, 50ul/reaction:
| Component
| Volume
| Final Concentration
|
| Q5 master mix 2X
| 150ul
| 1X
|
| DNA template (251.4ng/ul)
| 1.5ul
| 1.257ng/ul
|
| Primer F (50uM)
| 3ul
| 500nM
|
| Primer R (50uM)
| 3ul
| 500nM
|
| ddH20
| 142.5ul
| -
|
| Total
| 300ul
| -
|
PCR reaction conditions:
| Step
| Temp (℃)
| Time (s)
|
| Initial denaturation
| 98
| 60
|
| 18 cycles
| 98
| 10
|
| 58, 60, 61, 62, 63, 65
| 15
|
|
| 72
| 360
|
|
| Final extension
| 72
| 120
|
| Hold
| 4
| ∞
|
DpnI digestion
(13 Aug 15:05~19:06)
Add 1ul DpnI directly to the amplification system
Digest 4h
No termination
Stored at -20℃
Nanodrop test after digestion
| Anneal Temp (℃)
| 58
| 60
| 61
| 62
|
| Conc (ng/ul)
| 467.4
| 465.9
| 470.4
| 457.9
|
| 260/280
| 1.8
| 1.8
| 1.8
| 1.81
|
| 260/230
| 0.73
| 0.73
| 0.74
| 0.73
|
Bacteria transformation
Procedures:
- Immediately, place the tubes on ice, allow cell to thaw on ice, 10 min
- Check the cell to see if they have thawed, gently flick the cells 1-2 times to evenly resuspend the cells.
- Divide the competent cells into 6 tubes,50μL each tube, Mark them with 58, 60, 61, 62, 63, 65. Keep the bacteria in ice during the procedure.
- Add 5μL plasmid to each tube, shaking slightly
- Incubate on ice for 30min
- Heat shock, 42°C, 90s.
- Keep on ice, 2 min
- Add 200μl SOC medium to each tube, incubate 37°C, 200rpm, 45min
- Centrifuge, 4000rmp, 5min, RT. Discard most of the medium and reserve 50μL. Resuspend.
- Add 50μL bacteria to amp LB agar plate, distribute.
- Incubate the plates at 37°C, 16 hours [2014.8.13 22:08~2014.8.14 14:50].
Results:
For all 6 groups, no colony forms.
Gel electrophoresis
Making the agarose gel (1%)
Component Volume
TAE 25ml
Agarose 0.25g
Gene Green 0.5ul
Adding samples
Component Volume
PCR product 1ul
6X loading dye 2ul
TAE 9ul
Total 12ul
DNA marker (Takara DL5000, diluted): 10ul
Results:
The result of electrophoresis is not clear, so I redid the gel electrophoresis with the same sample.
No wanted band (6843bp) is observed.
Discussion:
1. PCR failed, so improving PCR conditions is the first choice. Try extending PCR cycles, denaturation time, annealing time and final extension time.
2. Do reaction termination after DpnI enzyme digestion (80℃ 20min) next time because reactive enzyme may binding to the DNA substrate and interfere the transformation efficiency.
3. The concentration of template DNA is also very essential, so using 2-step concentration ladder next time.
"
