"
Team:Paris Bettencourt/Project/Interlab Study
From 2014.igem.org
Marguerite (Talk | contribs) |
Marguerite (Talk | contribs) |
||
| Line 97: | Line 97: | ||
#devices { | #devices { | ||
width : 100%; | width : 100%; | ||
| - | height : | + | height : 1600px; |
display : inline-block; | display : inline-block; | ||
} | } | ||
| Line 214: | Line 214: | ||
<b>Device 2</b><br><br> | <b>Device 2</b><br><br> | ||
BBa_J23101 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.<br> Selection marker : Chloramphenicol<br> Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc<br> 2014 Biobrick Kit locations<br> BBa_K823005 (BBa_J23101 in pSB1C3): Plate 1, Well 20K<br> BBa_E0240 (in pSB1C3): Plate 2, Well 24B<br><br> | BBa_J23101 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.<br> Selection marker : Chloramphenicol<br> Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc<br> 2014 Biobrick Kit locations<br> BBa_K823005 (BBa_J23101 in pSB1C3): Plate 1, Well 20K<br> BBa_E0240 (in pSB1C3): Plate 2, Well 24B<br><br> | ||
| - | We followed iGEM Distribution Kit instructions to extract DNA from the Biobrick BBa_K823005 and BBa_E0240 and then Heat Shock transformation of E.coli | + | We followed <a href=kit>iGEM Distribution Kit instructions</a> to extract DNA from the Biobrick BBa_K823005 and BBa_E0240 and then <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1">Heat Shock transformation of <i>E.coli</i></a>. For successful Chloramphenicol plates, form single colonies we prepared liquid cultures overnight. We used 750uL of the liquid cultures for a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stock</a> . We used remaining 4,25 mL to make <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot4"> minipreps</a>. We measured DNA content with the nanodrop.<br><br> |
| - | For successful Chloramphenicol plates, form single colonies we prepared liquid cultures overnight. We used 750uL of the liquid cultures for | + | |
Digestion analysis: <br> | Digestion analysis: <br> | ||
- 5 ug plasmid<br> | - 5 ug plasmid<br> | ||
| Line 222: | Line 221: | ||
- complete with H2O<br> | - complete with H2O<br> | ||
(Final volume of 50 uL)<br><br> | (Final volume of 50 uL)<br><br> | ||
| - | We made an eletrophoresis gel to check the fragments (the bands at around 876 bp for GFP and 2100 bp for the promoter + backbone) and then extract BBa_E0240 with Gel extraction kit. For the plasmid with the promoter | + | We made an eletrophoresis gel to check the fragments (the bands at around 876 bp for GFP and 2100 bp for the promoter + backbone) and then extract BBa_E0240 with Gel extraction kit. For the plasmid with the promoter we used a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot5">PCR purification kit</a>. We introduced the GFP fragment to the Plasmid + backbone through ligation of the sticky ends SpeI and XbeI. Quantified DNA in two parts with nanodrop. The amount of vector: insert has been calculated with Promega calculator. <br><br> |
5X Ligase Reaction Buffer 4 μl<br> | 5X Ligase Reaction Buffer 4 μl<br> | ||
Insert: Vector Molar Ratio 1:1, 1:3, 1:5<br> | Insert: Vector Molar Ratio 1:1, 1:3, 1:5<br> | ||
| Line 230: | Line 229: | ||
Incubate at 22°C for 1h<br> | Incubate at 22°C for 1h<br> | ||
16°C overnight<br><br> | 16°C overnight<br><br> | ||
| - | We transformed the ligation product following Heat Shock transformation of E.coli. We have put a single colony into a liquid culture with the appropriate antibiotic and the next day We prepared a glycerol stock .<br><br> | + | We transformed the ligation product following <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1"> Heat Shock transformation of <i>E.coli</i></a>. We have put a single colony into a liquid culture with the appropriate antibiotic and the next day We prepared a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stock</a> .<br><br> |
<b>Device 3</b><br><br> | <b>Device 3</b><br><br> | ||
Revision as of 13:57, 4 October 2014
The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. Can you measure fluorescence somewhere in your lab? Then this is the perfect study for you! |
Even if your lab or the organisms you work with mean that you can’t measure GFP from the specific devices, we want every team to be able to participate: email measurement at igem dot org and we will work out an alternative. |
| Devices | Sequencing | Fluorescence |
Devices
Device 1
BBa_I20260 (J23101-B0032-E0040-B0010-B0012) in the pSB3K3 vector.
Selection marker : Kanamycin
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc
2012 BioBrick Kit location
BBa_I20260: Plate 2, Well 17F
We followed iGEM Distribution Kit instructions to extract DNA from the Biobrick Plate 2, Well 17F (2012) and then Heat Shock transformation of E.coli. For successful Kanymycin plates we prepared glycerol stock and labbeled it G.22.
Device 2
BBa_J23101 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.
Selection marker : Chloramphenicol
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc
2014 Biobrick Kit locations
BBa_K823005 (BBa_J23101 in pSB1C3): Plate 1, Well 20K
BBa_E0240 (in pSB1C3): Plate 2, Well 24B
We followed iGEM Distribution Kit instructions to extract DNA from the Biobrick BBa_K823005 and BBa_E0240 and then Heat Shock transformation of E.coli. For successful Chloramphenicol plates, form single colonies we prepared liquid cultures overnight. We used 750uL of the liquid cultures for a glycerol stock . We used remaining 4,25 mL to make minipreps. We measured DNA content with the nanodrop.
Digestion analysis:
- 5 ug plasmid
- 5 ul FD Buffer
- 2.5 uL SpeI + 2.5 uL PstI (BBa_K823005) / 2.5 uL XbeI + 2.5 uL PstI (BBa_E0240)
- complete with H2O
(Final volume of 50 uL)
We made an eletrophoresis gel to check the fragments (the bands at around 876 bp for GFP and 2100 bp for the promoter + backbone) and then extract BBa_E0240 with Gel extraction kit. For the plasmid with the promoter we used a PCR purification kit. We introduced the GFP fragment to the Plasmid + backbone through ligation of the sticky ends SpeI and XbeI. Quantified DNA in two parts with nanodrop. The amount of vector: insert has been calculated with Promega calculator.
5X Ligase Reaction Buffer 4 μl
Insert: Vector Molar Ratio 1:1, 1:3, 1:5
Total DNA 0.01-0.1 μg
T4 DNA Ligase 1 uL
Autoclaved distilled water to 25uL
Incubate at 22°C for 1h
16°C overnight
We transformed the ligation product following Heat Shock transformation of E.coli. We have put a single colony into a liquid culture with the appropriate antibiotic and the next day We prepared a glycerol stock .
Device 3
*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 missmatched basepairs.
BBa_J23115 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.
Selection marker : Chloramphenicol
Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc (missmatched basepairs compared to real BBa_J23115 are underlined)
2014 Biobrick Kit locations
BBa_K823012 (BBa_J23115 in pSB1C3): Plate 1, Well 22I
BBa_E0240 (in pSB1C3): Plate 2, Well 24B
In order to prepare the third device we proceed exactly in the same way as for the Device 2, except we used BBa_K823012 instead of BBa_K823005
Sequencing
Lorem ipsum dolor sit amet, consectetur adipiscing elit. Nullam bibendum purus eu neque finibus, eget pellentesque sapien viverra. Vestibulum ultrices posuere tempor. Maecenas ultrices sodales magna ac placerat. Sed a ex dignissim, ornare metus non, malesuada arcu. Etiam ullamcorper odio leo, at molestie eros sollicitudin in. Morbi aliquam scelerisque facilisis. Aenean tincidunt aliquam erat, quis ullamcorper nulla accumsan ac. Proin interdum nibh quam, in lacinia ipsum dignissim at. Nunc elementum lacus sed purus pharetra tincidunt. Sed ac velit vel turpis pulvinar accumsan ut in mauris. Praesent ac dapibus dui. Nullam finibus turpis et turpis sagittis congue.
OD600 and fluorescence measure over 20h
Lorem ipsum dolor sit amet, consectetur adipiscing elit. Sed sit amet laoreet metus, ac viverra dolor. Sed et orci imperdiet sem vulputate ultricies. Aliquam erat volutpat. Cras semper ex non odio aliquet, eget feugiat eros tempor. Integer hendrerit odio et bibendum maximus. Duis scelerisque lacus in odio faucibus fringilla. Nulla eleifend aliquet molestie. Morbi aliquam rhoncus efficitur. Proin consectetur augue aliquam risus convallis egestas. Nunc viverra felis non nibh consequat, nec faucibus ipsum rutrum. Proin placerat faucibus libero vitae dapibus.
