Team:BYU Provo/Notebook/Auxotrophy/julyaug

From 2014.igem.org

(Difference between revisions)
Line 86: Line 86:
<p> (TR,CB) We still have no <i>N eutropha</i> template to work with so we are just helping other groups out this week where we can.</p>
<p> (TR,CB) We still have no <i>N eutropha</i> template to work with so we are just helping other groups out this week where we can.</p>
<h3>Aug 13</h3>
<h3>Aug 13</h3>
 +
<p> (TR) I went ahead and designed primers to be used with <i>N eutropha</i> to knock out the SerB gene and hopefully make it auxotrophic for serine.  Here they are;</p>
 +
<p>Forward 1: overhang compatibility - bamHI - front of front 500 bp homology block</p>
 +
<p>    GAT - GGATCC - CGATACCTATGGGCATATTGCAG</p>
 +
<p>Reverse 1:  Reverse complement of ‘Forward 2’ primer (SOEing primer 2)</p>
 +
<p>    TCGAGACCGACGTGATTAAG - TGTATATCTGTACCTTGAAT</p>
 +
<p>Forward 2: front and back of serB coding strand (SOEing primer 1)</p>
 +
<p>    ATTCAAGGTACAGATATACA - CTTAATCACGTCGGTCTCGA</p>
 +
<p>Reverse 2: overhang compatibility - speI - reverse complement of back 500 bp homology block</p>
 +
<p>    ATC - ACTAGT - AGGAACGCCCCGTGATTATTGCG</p>
<h2>Week of August 22</h2>
<h2>Week of August 22</h2>

Revision as of 02:16, 3 October 2014


BYU 2014 Notebook

Edit July August

Home Team Official Team Profile Project Parts Modeling Notebook Safety Attributions

Week of July 4

Week of August 15

Aug 11

(TR,CB) We still have no N eutropha template to work with so we are just helping other groups out this week where we can.

Aug 13

(TR) I went ahead and designed primers to be used with N eutropha to knock out the SerB gene and hopefully make it auxotrophic for serine. Here they are;

Forward 1: overhang compatibility - bamHI - front of front 500 bp homology block

GAT - GGATCC - CGATACCTATGGGCATATTGCAG

Reverse 1: Reverse complement of ‘Forward 2’ primer (SOEing primer 2)

TCGAGACCGACGTGATTAAG - TGTATATCTGTACCTTGAAT

Forward 2: front and back of serB coding strand (SOEing primer 1)

ATTCAAGGTACAGATATACA - CTTAATCACGTCGGTCTCGA

Reverse 2: overhang compatibility - speI - reverse complement of back 500 bp homology block

ATC - ACTAGT - AGGAACGCCCCGTGATTATTGCG

Week of August 22

Aug 18

(TR,CB) We have decided that in the mean time, while we are waiting for template for the N eutropha, we are going to try and finishing our cloning for N multiformis. We took template for N multiformis genomic DNA from a frozen stock to synthesize the 500bp front and back halves of our insert again. Then we used the Common Procedure for q5 high fidelity DNA Polymerase to do PCR.

Aug 20

(TR,CB) Ran a gel electrophoresis on Monday's PCR products. We saw that both, the front and back halves of our insert were present around the 500bp mark.

Week of August 29

Aug 25

(TR,CB) Performed SOEing PCR on the front and back halves of insert to go into pSR47s plasmid. We used the high fidelity q5 DNA polymerase.

Aug 26

(TR) Electrophoresed our SOEing PCR product. The gel came out with only a band around 500bp, so something didn't work correctly.

Aug 27

(TR,CB) Started another SOEing PCR to try and prepare the insert for cloning, using q5 DNA polymerase. Also started overnight cultures for some plasmid preps of the pSR47s plasmid, so that we have plenty of vector to work with.

Aug 28

(TR,CB) Performed a plasmid prep of the overnight cultures with pSR47s. Ran a gel electrophoresis of our PCR product and found that the SOEing didn't work again.