Team:Wageningen UR/notebook/journal/inhibition

From 2014.igem.org

(Difference between revisions)
 
(8 intermediate revisions not shown)
Line 45: Line 45:
Fw: 5’-GTTTCTTCGAATTCGCGGCCGCTTCTAGATGAGTATCACCCAGAACG-3'<br/>
Fw: 5’-GTTTCTTCGAATTCGCGGCCGCTTCTAGATGAGTATCACCCAGAACG-3'<br/>
Rev: 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATTCATACCGTTGCTACAGG-3'
Rev: 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATTCATACCGTTGCTACAGG-3'
-
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/c/c1/Wageningen_UR_notebook_wen_06_02_14_pcr_methyl-gamma-lyase.jpg/600px-Wageningen_UR_notebook_wen_06_02_14_pcr_methyl-gamma-lyase.jpg" width="400"><figcaption></figcaption></figure>
+
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/c/c1/Wageningen_UR_notebook_wen_06_02_14_pcr_methyl-gamma-lyase.jpg/600px-Wageningen_UR_notebook_wen_06_02_14_pcr_methyl-gamma-lyase.jpg" width="400"><figcaption>PCR methionine-gamma-lyase</figcaption></figure>
</p>
</p>
  </dd>
  </dd>
Line 57: Line 57:
Fw: 5’-GTTTCTTCGAATTCGCGGCCGCTTCTAGATGGCGGAACAACTATCCACAAGTAAG<br/>
Fw: 5’-GTTTCTTCGAATTCGCGGCCGCTTCTAGATGGCGGAACAACTATCCACAAGTAAG<br/>
Rev: 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATCAGGCCTGGCGACTGGC<br/>  
Rev: 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATCAGGCCTGGCGACTGGC<br/>  
-
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/e/e6/Wageningen_UR_notebook_wen_06_10_14_pcr_pfri.jpg/600px-Wageningen_UR_notebook_wen_06_10_14_pcr_pfri.jpg" width="400"><figcaption>Extract pfrI from gel, digested it with SpeI and xbaI.  Ligated pfrI with BBa_B0034 (digested with SpeI).</figcaption></figure>
+
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/e/e6/Wageningen_UR_notebook_wen_06_10_14_pcr_pfri.jpg/600px-Wageningen_UR_notebook_wen_06_10_14_pcr_pfri.jpg" width="400"><figcaption>PCR PfrI</figcaption></figure>
 +
<p>Extract pfrI from gel, digested it with SpeI and xbaI.  Ligated pfrI with BBa_B0034 (digested with SpeI).</p>
</p>
</p>
Line 79: Line 80:
<p>Psb1T3, psb1K3 transformants were grown in 10ml and then miniprepped.<br/>
<p>Psb1T3, psb1K3 transformants were grown in 10ml and then miniprepped.<br/>
Colony PCR with methyl-γ-lyase + BBa_B0034 transformant colonies using Taq polymerase. Primers were VF2 and a reverse primer from methyl-γ-lyase.  Ran gel with 1 kb NEB ladder. Is expect a band of around 1.5 kpb to appear if there was correct insertion of the product into the plasmid.<br/>
Colony PCR with methyl-γ-lyase + BBa_B0034 transformant colonies using Taq polymerase. Primers were VF2 and a reverse primer from methyl-γ-lyase.  Ran gel with 1 kb NEB ladder. Is expect a band of around 1.5 kpb to appear if there was correct insertion of the product into the plasmid.<br/>
-
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/5/5a/Wageningen_UR_notebook_wen_06_16_14_colony_pcr_mgl.jpg/600px-Wageningen_UR_notebook_wen_06_16_14_colony_pcr_mgl.jpg" width="400"><figcaption>Sample 1, 2, 3 and 5 seem to have the correct insert. So glycerol stocks were made for sample 1 and 2.</figcaption></figure>
+
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/5/5a/Wageningen_UR_notebook_wen_06_16_14_colony_pcr_mgl.jpg/600px-Wageningen_UR_notebook_wen_06_16_14_colony_pcr_mgl.jpg" width="400"><figcaption>Colony PCR Methionine-gamma-lyase</figcaption></figure>
 +
Sample 1, 2, 3 and 5 seem to have the correct insert. So glycerol stocks were made for sample 1 and 2.
</p>
</p>
  </dd>
  </dd>
Line 96: Line 98:
<p>Sequencing data showed that Metionine-γ-lyase was inserted correctly together with Bba_b0034 (RBS), pfrI + B_0034 transformants were grown in 10 ml LB containing antibiotic and miniprepped. Plasmids were digested with EcoRI & SpeI. This was done because insert could enter in 2 ways, need to check for the correct insert.  Correct insert would give us 2132 bp and 566 bp, the incorrect insert will give us 5675 bp and 23 bp. Ran it with 1 kb NEB ladder.</p>
<p>Sequencing data showed that Metionine-γ-lyase was inserted correctly together with Bba_b0034 (RBS), pfrI + B_0034 transformants were grown in 10 ml LB containing antibiotic and miniprepped. Plasmids were digested with EcoRI & SpeI. This was done because insert could enter in 2 ways, need to check for the correct insert.  Correct insert would give us 2132 bp and 566 bp, the incorrect insert will give us 5675 bp and 23 bp. Ran it with 1 kb NEB ladder.</p>
-
<figure><img src="https://static.igem.org/mediawiki/2014/1/14/Wageningen_UR_notebook_wen_06_30_14_schematic_drawing.jpg" width="300"><figcaption></figcaption></figure>
+
<figure><img src="https://static.igem.org/mediawiki/2014/1/14/Wageningen_UR_notebook_wen_06_30_14_schematic_drawing.jpg" width="300"><figcaption>Schematic drawing of digestion and ligation strategy</figcaption></figure>
-
<figure><img src="https://static.igem.org/mediawiki/2014/b/b9/Wageningen_UR_notebook_wen_06_30_14_pfri_digest.jpg" width="400"><figcaption></figcaption></figure>
+
<figure><img src="https://static.igem.org/mediawiki/2014/b/b9/Wageningen_UR_notebook_wen_06_30_14_pfri_digest.jpg" width="400"><figcaption>PfrI digest with EcoRI & SpeI</figcaption></figure>
Line 107: Line 109:
<dt id="02w06"><a>Week 2</a></dt>
<dt id="02w06"><a>Week 2</a></dt>
<dd class="timelineEvent" id="02w06EX" style="display:none;">
<dd class="timelineEvent" id="02w06EX" style="display:none;">
-
<p>Grew <i>E. coli</i> containing SEVA plasmid 256, 581 and 434 in LB medium with correct antibiotic. Miniprepped them the day after.  Want to create SEVA plasmid that has pBBR1 ori, lacIq-Ptrc promoter and km or tet resistance. SEVA plasmids were digest with PacI and SpeI in order to get the cargo out, want to change the cargo and insert the correct cargo which is the lacIq-Ptrc (in SEVA 434) to backbones from 256 (Km resistant)0 and 581 (tet resistant). For SEVA 256 and 581 alkaline phosphatase was added in the digestion mixture. <br/></p>
+
<p>Grew <i>E. coli</i> containing SEVA plasmid 256, 581 and 434 in LB medium with correct antibiotic. Miniprepped them the day after.  Want to create SEVA plasmid that has pBBR1 ori, <i>lacIq-Ptrc</i> promoter and km or tet resistance. SEVA plasmids were digest with PacI and SpeI in order to get the cargo out, want to change the cargo and insert the correct cargo which is the lacIq-Ptrc (in SEVA 434) to backbones from 256 (Km resistant)0 and 581 (tet resistant). For SEVA 256 and 581 alkaline phosphatase was added in the digestion mixture. <br/></p>
-
<figure><img src="https://static.igem.org/mediawiki/2014/2/25/Wageningen_UR_notebook_wen_06_07_14_SEVA_plasmid.jpg" width="200"><figcaption></figcaption></figure>
+
<figure><img src="https://static.igem.org/mediawiki/2014/2/25/Wageningen_UR_notebook_wen_06_07_14_SEVA_plasmid.jpg" width="200"><figcaption>SEVA plasmid</figcaption></figure>
<p>
<p>
PCR was done with plasmid SEVA 434 using Q5 poly from NEB with primers:<br/>
PCR was done with plasmid SEVA 434 using Q5 poly from NEB with primers:<br/>
Line 116: Line 118:
Ran 5 μl of it through gel with a 1 kb plus GeneRuler ladder.
Ran 5 μl of it through gel with a 1 kb plus GeneRuler ladder.
<br/></p>
<br/></p>
-
<figure><img src="https://static.igem.org/mediawiki/2014/a/a1/Wageningen_UR_notebook_wen_06_07_14_SEVA_434.jpg" width="300"><figcaption></figcaption></figure><p>
+
<figure><img src="https://static.igem.org/mediawiki/2014/a/a1/Wageningen_UR_notebook_wen_06_07_14_SEVA_434.jpg" width="300"><figcaption>lacIq-Ptrc PCR using SEVA 434 as template</figcaption></figure><p>
PCR purified rest of the PCR samples. Digested lacIq-Ptrc with PacI and SpeI then ligated with SEVA 581 (tet) and SEVA256 (km)  backbones. Did overnight ligation then afterwards ligase was deactivated by putting ligation mixture in 70°C for 10 min.  
PCR purified rest of the PCR samples. Digested lacIq-Ptrc with PacI and SpeI then ligated with SEVA 581 (tet) and SEVA256 (km)  backbones. Did overnight ligation then afterwards ligase was deactivated by putting ligation mixture in 70°C for 10 min.  
</p>
</p>
Line 132: Line 134:
<figure>
<figure>
<img src="https://static.igem.org/mediawiki/2014/0/05/Wageningen_UR_notebook_wen_07_22_gel_dapg.jpg">
<img src="https://static.igem.org/mediawiki/2014/0/05/Wageningen_UR_notebook_wen_07_22_gel_dapg.jpg">
-
<figcaption>Picture from DAPG</figcaption>
+
<figcaption>PCR <i>phl (DAPG)</i> gene cluster</figcaption>
</figure>
</figure>
<br/>
<br/>
Line 141: Line 143:
<figure>
<figure>
<img src="https://static.igem.org/mediawiki/2014/thumb/b/b1/Wageningen_UR_notebook_wen_07_22_SEVA_transformants_digest.jpg/472px-Wageningen_UR_notebook_wen_07_22_SEVA_transformants_digest.jpg">
<img src="https://static.igem.org/mediawiki/2014/thumb/b/b1/Wageningen_UR_notebook_wen_07_22_SEVA_transformants_digest.jpg/472px-Wageningen_UR_notebook_wen_07_22_SEVA_transformants_digest.jpg">
-
<figcaption>All transformants seemed to be correct, took #2 to be shuttle vector. Renamed it SEVA 254 which has a kanymcin resistance.</figcaption>
+
<figcaption>SEVA transformants digest.</figcaption>
</figure>
</figure>
 +
All transformants seemed to be correct, took #2 to be shuttle vector. Renamed it SEVA 254m contains a kanymcin resistance.
<p>
<p>
Digested the following:<br/>
Digested the following:<br/>
Line 174: Line 177:
<p>Transformation of SEVA 254 containing genes was successful. Did a colony PCR for Methionine-γ-lyase and <i>PfrI</i> transformants. <br/><br/>
<p>Transformation of SEVA 254 containing genes was successful. Did a colony PCR for Methionine-γ-lyase and <i>PfrI</i> transformants. <br/><br/>
Using same primers that was used in order to amplify the gene. Used Taq polymerase with tm of 64°C. Ran PCR with a 2-log NEB ladder. Upper lane is Methionine-γ-lyase and lower lane is <i>PfrI</i>. Positive and negative control are indicated as + and – respectively. + control was for Methionine-γ-lyase <i>B. linens</i> and <i>PfrI</i> was <i>P. putida</i> KT2440.</p>  
Using same primers that was used in order to amplify the gene. Used Taq polymerase with tm of 64°C. Ran PCR with a 2-log NEB ladder. Upper lane is Methionine-γ-lyase and lower lane is <i>PfrI</i>. Positive and negative control are indicated as + and – respectively. + control was for Methionine-γ-lyase <i>B. linens</i> and <i>PfrI</i> was <i>P. putida</i> KT2440.</p>  
-
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/9/9a/Wageningen_UR_notebook_wen_pfri_colony_pcr.jpg/503px-Wageningen_UR_notebook_wen_pfri_colony_pcr.jpg"><figcaption></figcaption></figure>
+
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/9/9a/Wageningen_UR_notebook_wen_pfri_colony_pcr.jpg/503px-Wageningen_UR_notebook_wen_pfri_colony_pcr.jpg"><figcaption>pfri colony PCR</figcaption></figure>
<p>Made glycerol stocks for #4 and 5 of Methionine-γ-lyase and pfrI.
<p>Made glycerol stocks for #4 and 5 of Methionine-γ-lyase and pfrI.
Miniprepped and digest <i>phlABCDE</i> in SEVA 254 with xbaI and SpeI. If it cuts, then gene was inserted in the correct direction. Ran gel with 2-log NEB ladder.</p>
Miniprepped and digest <i>phlABCDE</i> in SEVA 254 with xbaI and SpeI. If it cuts, then gene was inserted in the correct direction. Ran gel with 2-log NEB ladder.</p>
-
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/2/20/Wageningen_UR_notebook_wen_07_21_seva254_dapg_dig.png/743px-Wageningen_UR_notebook_wen_07_21_seva254_dapg_dig.png"><figcaption>Took #2 and made glycerol stocks.</figcaption></figure>
+
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/2/20/Wageningen_UR_notebook_wen_07_21_seva254_dapg_dig.png/743px-Wageningen_UR_notebook_wen_07_21_seva254_dapg_dig.png"><figcaption>SEVA254 DAPG digest</figcaption></figure>
 +
Took #2 and made glycerol stocks.
<p>
<p>
Transformed P.putida KT2440 using electroporation:</p>
Transformed P.putida KT2440 using electroporation:</p>
Line 207: Line 211:
Fw: 5’-GTGCTGGTGACCTCGATTGC-3’<br/>
Fw: 5’-GTGCTGGTGACCTCGATTGC-3’<br/>
Rev:5’-GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA CTAGTCCTTCAGGGGCAAG-3’</p>
Rev:5’-GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA CTAGTCCTTCAGGGGCAAG-3’</p>
-
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/f/f6/Wageningen_UR_notebook_wen_08_04_colonypcr_dapg.png/800px-Wageningen_UR_notebook_wen_08_04_colonypcr_dapg.png" width="400"><figcaption>Continued with number 6.</figcaption></figure>
+
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/f/f6/Wageningen_UR_notebook_wen_08_04_colonypcr_dapg.png/800px-Wageningen_UR_notebook_wen_08_04_colonypcr_dapg.png" width="400"><figcaption>Colony PCR DAPG</figcaption></figure>
 +
Continued with number 6.
<p>Chitinase sequence transformation to pSB1A3 into <i>E. coli</i> (unsuccesful attempt).
<p>Chitinase sequence transformation to pSB1A3 into <i>E. coli</i> (unsuccesful attempt).
Line 226: Line 231:
<dd class="timelineEvent" id="02w11EX" style="display:none;">
<dd class="timelineEvent" id="02w11EX" style="display:none;">
<p>Set up HPLC machine in order to detect 2,4-DAPG.  
<p>Set up HPLC machine in order to detect 2,4-DAPG.  
-
Ran 2,4-DAPG standard in HPLC.
+
Ran 2,4-DAPG standard in HPLC. ALso did a colony PCR with PfrI tranformants
</p>
</p>
-
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/e/e8/Wageningen_UR_notebook_wen_07_28_colony-pcr_pfri.png/800px-Wageningen_UR_notebook_wen_07_28_colony-pcr_pfri.png" width="400"><figcaption>Continued with number 3 and 4.</figcaption></figure>
+
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/e/e8/Wageningen_UR_notebook_wen_07_28_colony-pcr_pfri.png/800px-Wageningen_UR_notebook_wen_07_28_colony-pcr_pfri.png" width="400"><figcaption>Colony PCR pfri</figcaption></figure>
 +
Continued with number 3 and 4.
                                                     </dd>
                                                     </dd>
</dl>
</dl>
Line 239: Line 245:
<ul><li>SEVA 254 EcoRI & PstI</li>
<ul><li>SEVA 254 EcoRI & PstI</li>
<li>synthetic methionine-γ-lyase in IDT vector EcoRI & PstI</li></ul>
<li>synthetic methionine-γ-lyase in IDT vector EcoRI & PstI</li></ul>
-
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/f/f1/Wageningen_UR_notebook_wen_08_18_colonypcr_seva_mgl.png/453px-Wageningen_UR_notebook_wen_08_18_colonypcr_seva_mgl.png" width="200"><figcaption> Lower band of MgL and backbone band were gel extracted and then ligated together. Transformed in <i>E. coli</i>.  Ran a colony PCR (Taq pol) with the only transformant and ran gel with 2-log NEB ladder. + control was methionine-γ-lyase in IDT vector.</figcaption></figure> <br/>
+
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/f/f1/Wageningen_UR_notebook_wen_08_18_colonypcr_seva_mgl.png/453px-Wageningen_UR_notebook_wen_08_18_colonypcr_seva_mgl.png" width="200"><figcaption>Colony PCR SEVA Methionine-gamma-lyase(MgL)</figcaption></figure>
-
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/d/d3/Wageningen_UR_notebook_wen_08_18_dig_seva_mgl.png/550px-Wageningen_UR_notebook_wen_08_18_dig_seva_mgl.png" width="200"><figcaption> Transformant is correct, grew it in liq LB, mini-prepped day after. Transformed in <i>P. putida</i> KT2440. </figcaption></figure>
+
Lower band of MgL and backbone band were gel extracted and then ligated together. Transformed in <i>E. coli</i>.  Ran a colony PCR (Taq pol) with the only transformant and ran gel with 2-log NEB ladder. + control was methionine-γ-lyase in IDT vector.
 +
<br/>
 +
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/d/d3/Wageningen_UR_notebook_wen_08_18_dig_seva_mgl.png/550px-Wageningen_UR_notebook_wen_08_18_dig_seva_mgl.png" width="200"><figcaption>Digest SEVA MgL</figcaption></figure>
 +
Transformant is correct, grew it in liq LB, mini-prepped day after. Transformed in <i>P. putida</i> KT2440.  
<p>Chitinase transformation into <i>P. putida</i> in pSEVA254 (succesfully). <br/>
<p>Chitinase transformation into <i>P. putida</i> in pSEVA254 (succesfully). <br/>
Line 294: Line 303:
<dd class="timelineEvent" id="02w15EX" style="display:none;">
<dd class="timelineEvent" id="02w15EX" style="display:none;">
<p>Ran a colony PCR with <i>E. coli</i> transforamants with <i>PfrI</i> (psb1C3) and methionine-γ-lyase (psb1C3). Ran gel with 2-log NEB ladder. </p><br/>
<p>Ran a colony PCR with <i>E. coli</i> transforamants with <i>PfrI</i> (psb1C3) and methionine-γ-lyase (psb1C3). Ran gel with 2-log NEB ladder. </p><br/>
-
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/f/f0/Wageningen_UR_notebook_wen_09_08_1_mgl_pfri_colony_pcr.png/727px-Wageningen_UR_notebook_wen_09_08_1_mgl_pfri_colony_pcr.png" width="400"><figcaption>Upper lane is from methionine-γ-lyase (psb1C3) and lower lane is <i>PfrI</i> (psb1C3). Expected around 1.5kb for methionine-γ-lyase and around 600bp for <i>PfrI</i>. Numbers 1 and 2 were continued with both methionine-γ-lyase (psb1C3) and <i>PfrI</i> (psb1C3).</figcaption></figure>
+
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/f/f0/Wageningen_UR_notebook_wen_09_08_1_mgl_pfri_colony_pcr.png/727px-Wageningen_UR_notebook_wen_09_08_1_mgl_pfri_colony_pcr.png" width="400"><figcaption>Mgl, PfrI colony PCR</figcaption></figure>
 +
Upper lane is from methionine-γ-lyase (psb1C3) and lower lane is <i>PfrI</i> (psb1C3). Expected around 1.5kb for methionine-γ-lyase and around 600bp for <i>PfrI</i>. Numbers 1 and 2 were continued with both methionine-γ-lyase (psb1C3) and <i>PfrI</i> (psb1C3).
<br/>
<br/>
<p>Grew and miniprepped these transformants. methionine-γ-lyase (psb1C3) plasmids were digested with EcoRI and PstI. Ran gel with 2-log NEB ladder. Expected a 1.5kb band (insert) with a 2.2 kb backbone.</p><br/>
<p>Grew and miniprepped these transformants. methionine-γ-lyase (psb1C3) plasmids were digested with EcoRI and PstI. Ran gel with 2-log NEB ladder. Expected a 1.5kb band (insert) with a 2.2 kb backbone.</p><br/>
-
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/d/db/Wageningen_UR_notebook_wen_09_08_2_mgl_dig.png/312px-Wageningen_UR_notebook_wen_09_08_2_mgl_dig.png" width="200"><figcaption>Both plasmids are correct with 1.5kb insert band and a 2.2kb backbone, 3-4kb band are uncut plasmids.</figcaption></figure>
+
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/d/db/Wageningen_UR_notebook_wen_09_08_2_mgl_dig.png/312px-Wageningen_UR_notebook_wen_09_08_2_mgl_dig.png" width="200"><figcaption>MgL EcoRI and PstI digestion</figcaption></figure>
 +
Both plasmids are correct with 1.5kb insert band and a 2.2kb backbone, 3-4kb band are uncut plasmids.
<p>Also did a mutagenesis with <i>PfrI</i> (psb1C3) plasmid with Q5 polymerase using primers: <br/>
<p>Also did a mutagenesis with <i>PfrI</i> (psb1C3) plasmid with Q5 polymerase using primers: <br/>
Line 305: Line 316:
Afterwards ran a gel for the mutagenesis. </p>
Afterwards ran a gel for the mutagenesis. </p>
-
<figure><img src="https://static.igem.org/mediawiki/2014/thumb/d/db/Wageningen_UR_notebook_wen_09_08_2_mgl_dig.png/312px-Wageningen_UR_notebook_wen_09_08_2_mgl_dig.png" width="200"><figcaption>Both plasmids are correct with 1.5kb insert band and a 2.2kb backbone, 3-4kb band are uncut plasmids.</figcaption></figure>
+
<figure><img src="https://static.igem.org/mediawiki/2014/6/67/Wageningen_UR_notebook_wen_09_08_3_mutagenesis.png" width="200"><figcaption>mutagenesis</figcaption></figure>
 +
Both plasmids are correct with 1.5kb insert band and a 2.2kb backbone, 3-4kb band are uncut plasmids.
<p>Mutagenesis was succesfull with expected band size of 2.8kb and nothing on negative control. Afterwards added DpnI to purified mutagenesis plasmid and transformed into <i>E. coli</i> competent cells. <br/>
<p>Mutagenesis was succesfull with expected band size of 2.8kb and nothing on negative control. Afterwards added DpnI to purified mutagenesis plasmid and transformed into <i>E. coli</i> competent cells. <br/>

Latest revision as of 03:47, 18 October 2014

Wageningen UR iGEM 2014

 

 

Fungal inhibition and greenhouse journal


May

Week 4

June

Week 1
Week 2
Week 3-4

July

Week 1
Week 2
Week 3
Week 4
Week 5

August

Week 1
Week 2
Week 3
Week 4

September

Week 1
Week 2
Week 3
Week 4

October

Week 1
Week 2
Week 3