WELCOME TO PENN STATE iGEM 2014!

Click here to edit this page!

Parts Submitted to the Registry

Coding Sequence for BBa_K1506002

atgcgtaaaggtgaagaactgttcactggtgttgttccgatcctggttgaactggacggtgacgttaacggtcacaaattctctgttcgtggtgaaggtg aaggtgacgctactaacggtaaactgactctgaaattcatctgcactactggtaaactgccggttccgtggccgactctggttactactctgacttacgg tgttcagtgcttcgctcgttacccggaccacatgaaacagcacgacttcttcaaatctgctatgccggaaggttacgttcaggaacgtactatctctttc aaagacgacggtacttacaaaactcgtgctgaagttaaattcgaaggtgacactctggttaaccgtatcgaactgaaaggtatcgacttcaaagaagacg gtaacatcctgggtcacaaactggaatacaacttcaactctcacaacgtttacatcactgctgacaaacagaaaaacggtatcaaagctaacttcaaaat ccgtcacaacgttgaagacggttctgttcagctggctgaccactaccagcagaacactccgatcggtgacggtccggttctgctgccggacaaccactac ctgtctactcagtctgttctgtctaaagacccgaacgaaaaacgtgaccacatggttctgctggaattcgttactgctgctggtatcactcacggtatgg acgaactgtacaaataataa

Explanation of part BBa_K1506002

Superfolder GFP (part BBa_I746916) has been modified so that the coding sequence contains only "fast" codons. This GFP was designed as one of five variants we optimized at the codon level using different criteria in order to develop a novel method for codon optimization. Traditional methods of codon optimization rely primarily on the distinction between degenerate codons that are common throughout the entire genome of E. coli and those that are rare. This GFP was optimized instead using only degenerate codons that are more frequent in higher translation initiation regions of the genome, ie fast codons. This criterion is based on the results of a recent project in which all the coding DNA sequences of E. coli are divided into five groups based on the naturally occurring TIR, from lowest to highest. Then, the codon usage profile of each group of genes is statistically analyzed to determine whether a codon is slow or fast. A fast codon is defined as one with high correlation between TIR and its frequency. Otherwise, it is a slow codon. Ng, C. Y., Farasat, I., Zomorrodi, A. R., Maranas, C. D. & Salis, H. M. Model-guided construction and optimization of synthetic metabolism for chemical product synthesis. Synthetic Biology Engineering Research Center Spring Retreat (2013), Berkeley, CA. It is hypothesized that the groups of CDS with high TIR will hold more “fast” codons, which will lead to higher translation elongation rate and thus higher protein expression, whereas the slow regions will hold more “slow” codons leading to lower expression.

Codons whose frequency increases with TIR are defined as fast codons. Those with declining frequency in relation to TIR are slow codons, and those with no correlation are defined as independent of TIR. This can be viewed in the figure above as the slope of the graphs for each codon showing ratio and TIR. If ratio increases with TIR, the codon is fast, and the graph displays positive slope. Slow codons slow negative slope, and TIR independent codons show essentially no slope.

Parts Table