Team:UT-Tokyo/CTCD/Content/Result

From 2014.igem.org

(Difference between revisions)

Latest revision as of 02:21, 18 October 2014

Our aim was to make a construct like below.(Fig.1)

       <legend>Fig. 1</legend>

miRNA142-5p sequence is CAUAAAGUAGAAAGCACUACU .
miRNA142-3p sequence is UGUAGUGUUUCCUACUUUAUGGA.

The target sequence is complementary to the miRNA142-5p and miRNA142-3p sequence.

miRNA142-5p binding site is AGTAGTGCTTTCTACTTTATG.
miRNA142-3p binding site is TCCATAAAGTAGGAAACACTACA.

We constructed miRNA-binding sites by annealing the two oligos shown below (BBa_K1461100, BBa_K1461101).

5’-GCGGAATTCGCGGCCGCTTCTAGAGCATAAAGTAGAAAGCACTACTTACTAGTAGCGGCCGCTGCAGGCG-3’
5’-CGCCTGCAGCGGCCGCTACTAGTAAGTAGTGCTTTCTACTTTATGCTCTAGAAGCGGCCGCGAATTCCGC-3’

When we made miRNA-binding site connected tandemly, we couldn’t use PCR or gel extraction because they contained repeats and short sequences . So we had to anneal two oligos and insert in the plasmid.(Fig.2)

       <legend>Fig. 2</legend>

This method can be used for other miRNA-binding sites or other parts not suitable for PCR or gel extraction .

Constructs we planed to use in this experiment were already made apart from EGP-2 promoter, and sequences were confirmed (BBa_K1461306, BBa_K1461307, BBa_K1461308, BBa_K1461309, BBa_K1461310, BBa_K1461311). But cloning of EGP-2 was not successful.
So we have to clone EGP-2 promoter, make the construct,and perform reporter assay before our presentation.

@@ Line 1: / Line 1: @@
 <div id="Result-1">
 	<img src="https://static.igem.org/mediawiki/2014/3/34/SubCTC_miRNA_binding_sites.png" class = "contTitle" />
-	<p>Our aim was to make a construct like below.(fig.1)</p>
+	<p>Our aim was to make a construct like below.(Fig.1)</p>
 	<img src="https://static.igem.org/mediawiki/2014/6/64/Kobari_pegp2.png" class = "figure" />
+        <legend><b>Fig. 1</b></legend>
 	<p>miRNA142-5p sequence is CAUAAAGUAGAAAGCACUACU .<br />miRNA142-3p sequence is UGUAGUGUUUCCUACUUUAUGGA.</p>
 	<p>The target sequence is complementary to the miRNA142-5p and miRNA142-3p sequence.</p>
 	<p>miRNA142-5p binding site is AGTAGTGCTTTCTACTTTATG.<br />miRNA142-3p binding site is TCCATAAAGTAGGAAACACTACA.</p>
-	<p>We constructed miRNA-binding sites by annealing the two oligos shown below.</p>
+	<p>We constructed miRNA-binding sites by annealing the two oligos shown below (BBa_K1461100, BBa_K1461101).</p>
 	<p>5’-GCGGAATTCGCGGCCGCTTCTAGAGCATAAAGTAGAAAGCACTACTTACTAGTAGCGGCCGCTGCAGGCG-3’<br />5’-CGCCTGCAGCGGCCGCTACTAGTAAGTAGTGCTTTCTACTTTATGCTCTAGAAGCGGCCGCGAATTCCGC-3’</p>
-	<p>When we made miRNA-binding site connected tandemly, we couldn’t use PCR or gel extraction because they contained repeats and short sequences . So we had to anneal two oligos and insert in the plasmid.(fig.2)</p>
+	<p>When we made miRNA-binding site connected tandemly, we couldn’t use PCR or gel extraction because they contained repeats and short sequences . So we had to anneal two oligos and insert in the plasmid.(Fig.2)</p>
 	<img src="https://static.igem.org/mediawiki/2014/7/73/Tomohuji001.png" class = "figure" />
+        <legend><b>Fig. 2</b></legend>
 	<p>This method can be used for other miRNA-binding sites or other parts not suitable for PCR or gel extraction .</p>
-	<p>Constructs we planed to use in this experiment were already made apart from EGP-2 promoter, and sequences were confirmed. But cloning of EGP-2 was not successful.<br />So we have to clone EGP-2 promoter, make the construct,and perform reporter assay before our presentation.</p>
+	<p>Constructs we planed to use in this experiment were already made apart from EGP-2 promoter, and sequences were confirmed (BBa_K1461306, BBa_K1461307, BBa_K1461308, BBa_K1461309, BBa_K1461310, BBa_K1461311). But cloning of EGP-2 was not successful.<br />So we have to clone EGP-2 promoter, make the construct,and perform reporter assay before our presentation.</p>
 </div>