Latest revision as of 14:20, 17 October 2014

Wageningen UR iGEM 2014

Gene transfer inhibition journal

Escherichia coli DH5α and JM109 strain have been used in the Toxin-Antitoxin (T-A) system subproject. As a growing medium in Lysogeny broth (LB medium) was used. Tetracycline, Ampicillin, Streptomycin and Kanamaycin were used as selection criteria for the transformations at a working concentration of 10, 50, 50 and 100 μg/mL,respectively. The antibiotics were applied either on LB agar plates, for transformation purposes, or liquid LB, to grow the cells. All cultures were grown overnight at 37°C. Cell competence for transformation purposes was achieved by making electro competent cells and by using commercially competent E. coli DH5a from New England Biolabs. Gene JET Plasmid MiniPrep kit was used to purify all the plasmids of interest after overnight growth.

List of used primers for PCR elongation and amplification of the T-A systems:

KIS Fw (XbaI-RBS-Kis_Fw): CGCTTCTAGAGAGGAGGACAGCCATGCATACCACCCGACTGAA
KIS Rv (Kis_Rv-SpeI-PstI): TCACTGCAGGTGACTAGTCACTCAGATTTCCTCCTGACCAG
KID Fw (XbaI-RBS-Kid_Fw): CGCTTCTAGAGAGGAGGACAGCGATGGAAAGAGGGGAAATCTG
KID Rv (Kid_Rv-SpeI-PstI): CTCACTGCAGGTGACTAGTCACTCAAGTCAGAATAGTGGACA
EPSILON Fw (XbaI-RBS-Epsilon_Fw): CGCTTCTAGAGAGGAGGACAGCCATGGCAGTTACGTATGAAAA
EPSILON Rv (Epsilon_Rv-SpeI–PstI): CTCACTGCAGGTGACTAGTCACTTAAGCCACTTTCTCTTTAT
ZETA Fw (XbaI-RBS-Zeta_Fw): AGCTTCTAGAGAGGAGGACAGCGATGGCAAATATAGTCAATTT
ZETA Rv (Zeta_Rv-SpeI–PstI): CTCACTGCAGGTGACTAGTCACTTAAATACCTGGAAGTTTAG

+ expand all

June

Week 1-4: Literature review and system design.

July

Week 1-2: Preliminary transformation setup evaluation using chromo proteins to assess the best approach to integrate the double plasmid system in E. coli. Using pSB1K3 + yellow chromo protein, pSB1A3 + red chromo protein and SEVA434 + no chromo protein.

Week 3: We received the stains containing the toxin-antitoxin plasmids from Imperial College London (ICL).
PCR primer design to extract the toxin antitoxin system from their original plasmids received from ICL, introducing new RBS and restriction sites.

Chromo proteins insertion verification using different restriction enzymes.

Week 4: Digestion and ligations of a purple chromo protein to pSB3C5 backbone + red chromoprotein (1^st attempt failed).

August

Week 1: Elongation PCR, successful elongation of Epsilon, Zeta, Kis and Kid, with the appropriate overhangs (Successful attempt).
Digestion and ligations of a purple chromo protein to pSB3C5 backbone + red chromoprotein (2^nd attempt failed).
Digestion and ligations of the LacI promoter to 3 different backbones: pSB1K3, pSB3C5 and pSBA1 (1^st attempt failed).

Week 2: Digestion and ligations of the LacI promoter to 3 different backbones: pSB1K3, pSB3C5 and pSBA3 ( 2^nd attempt failed).

Week 3: Final transformation setup evaluation using chromo proteins, with pSB1K3 + yellow chromo protein, pSB6A1 + red chromo protein and pSEVA434 in E. coli.

Week 4-5: Elongation PCR, digestion and insertion in pSB3C5 to build BioBricks.
Results: 5 colonies for the helper plasmid.

September

Week 1: Previous results evaluation, new planning and ordering new primers.

Week 2: Cloning toxins and antitoxins in pSB1C3, performing the following steps: Toxin and antitoxin PCR amplification, restriction enzyme digestion of insert and backbone (insert XbaI and PstI, backbone SpeI and PstI), ligation, cloning in DH5a and JM109 E. coli cells.

Week 3: Verification of successful transformation of toxins and antitoxins cloning in pSB1C3 by colony PCR and restriction digestion of the minipreped plasmid DNA ( Successful attempt).

Week 4: Cloning toxins in electro-competent cells containing the antitoxins, performing the following steps: Toxin PCR amplification, restriction enzyme digestion of insert and backbone (insert XbaI and PstI, backbone SpeI and PstI), ligation, cloning in electrocompetent JM109 E. coli cells containing the antitoxin plasmids.
Verification by restriction digestion (Successful attempt).

October

Week 1: Attempt to separate toxins and antitoxins contained in the same transformed cells by gel electrophoresis (Failed attempt).

Week 2: Wiki writing, images and figures design.

Week 3: Wiki writing and html coding.

@@ Line 5: / Line 5: @@
 {{:Team:Wageningen_UR/templates/menu}}
 <html>
-<h1>Journal</h1>
+<h1>Gene transfer inhibition journal</h1>
 							<p><i>Escherichia coli</i> DH5α and JM109 strain have been used in the Toxin-Antitoxin (T-A) system subproject. As a growing medium in Lysogeny broth (LB medium) was used. Tetracycline, Ampicillin, Streptomycin and Kanamaycin were used as selection criteria for the transformations at a working concentration of 10, 50, 50 and 100 μg/mL,respectively. The antibiotics were applied either on LB agar plates, for transformation purposes, or liquid LB, to grow the cells. All cultures were grown overnight at 37°C. Cell competence for transformation purposes was achieved by making electro competent cells and by using commercially competent <i>E. coli</i>  DH5a  from <i>New England Biolabs</i>. Gene JET Plasmid MiniPrep kit was used to purify all the plasmids of interest after overnight growth. </p></br>
 							<p>List of used primers for PCR elongation and amplification of the T-A systems:</p>

Team:Wageningen UR/notebook/journal/gene-transfer

From 2014.igem.org