Escherichia coli strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B Escherichia coli were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GeneArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.

Luria Broth Miller (LB) and LB Agar were purchased from VWR, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.

Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM. This was also used, also at a concentration of 20 uM, to make LB Agar Congo Red Assay plates.

3.1 Cloning of pSB-AraC-pBAD

The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on figure 7. The primers used during this procedure were as follows:

• Forward: TACTAGTAGCGGCCGCTGCAG
• Reverse: GCTAGCCCAAAAAAACGGGTATGGAG

The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.

3.2 Cloning of pSB3K3-LacI-pLAC

A compatible plasmid and induction system was cloned to allow expression of the operon in two parts. The medium/strong promoter J23110 was cloned in front of the quad part inverter Q01121. The inverter has an RBS, the LacI repressor followed by a double terminator then a Lac inducible promoter. The composite part created give constitutive expression of the Lac repressor allowing for induction by IPTG. The parts were then moved into the pSB3k3 backbone to be compatible with pSB1C3.

3.3 Assembly of AcsAB and AcsCD

The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B E.coli using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5ml LB were inoculated with a freshly growing colony and grown overnight at 37 C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.

In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, we proceeded as described on figure 8. Two separate rounds of digestion were carried out using EcoRI, NcoI, PvuII and PstI to, and the resulting fragments (AcsA, AcsB, AcsC and AcsD and linearized pSB1C3) were submitted to a three-part ligation after dephosphorylation of the vector backbone (rAPid desphosphorylation, Roche). An equimolar ratio amongst all three parts was established during the ligation procedure, which in turn proceeded at 4 degrees overnight. The NEB High Efficiency Transformation protocol was used on NEB 10B cells (New England Biolabs) to propagate the resulting plasmid. Transformed cells were plated and incubated overnight at 37 C. 5 ml LB supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of colonies for further analysis (refer to Results for additional information).

3.4 Assembly of pSB-AraC-pBAD-AcsAB

AcsAB was cloned into pSB-AraC-pBAD by Biobrick cloning. The destination vector was linearized using SpeI and PstI (New England Biolabs), and AcsAB (previously digested with XbaI and PstI, and gel extracted using the Minelute Gel Extraction Kit, by Qiagen) was ligated at a 1:1 ratio throughout an overnight ligation at room temperature. The resulting part was transformed into chemically competent DH10B Escherichia coli and plated on LB Agar+Chloramphenicol plates, grown overnight at 37 C. 5 ml LB falcons supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of freshly grown colonies for further restriction analysis (refer to Results for additional information)

3.5 Assembly of pSB-LacI-pLAC-CD

Similarly to 3.4, AcsCD was cloned by BioBrick cloning into the pSB3K3 low copy expression vector containing the LacI-pLAC regulatory elements. Vector and insert were ligated at a 1:1 ratio overnight at room temperature. After transformation and plating on LB Agar+Kanamycin (25 ug/ml), colonies were screened by Greentaq colony PCR, and were further confirmed during the Congo Red Assay.

DH10B E.coli already containing the AcsAB construct were made electrocompetent using a standard protocol, which can be found in the Protocols section. A second round of transformation was carried out to insert pLAC-AcsCD. 5ul of miniprepped pSB-pLAC-CD (diluted in ddH2O) were added into 50ul electrocompetent DH10B cells already containing the pBAD-inducible AcsAB element. Electroporation was carried out in in 10mm electrocuvettes at 1.8 kV, 200 Ohm resistance and 25 mF capacitance. 500ul SOC medium was added to the electroporated samples and these were recovered at 37 °C for 1h before plating on Kanamycin25 + Chloramphenicol 50 LB Agar plates.

LB Agar Congo Red assay plates were prepared with a final Congo Red concentration of 20uM, and they were supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose. Transformed cells containing both AcsAB and AcsCD were plated on Congo Red assay plates and incubated at 37 °C. They were qualitatively assayed after 24h and 48h for cellulose production. Finally, 5 mL LB supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose were inoculated with freshly grown, cellulose-producing colonies and were grown for 16h at 30 °C, 180 rpm. An empty vector control was also grown overnight for comparative analysis. These liquid cultues were supplied with Congo Red, to yield a final concentration of 20uM. They were incubated under static conditions for 2h at room temperature, and were later pelleted down to allow for qualitative analysis of Congo Red binding.

AcsAB functionality was assayed by inducing AcsAB-containing cells with 0.1% Arabinose in 5mL LB supplied with 1% Glucose and Chloramphenicol. Overnight incubations were set up at 30 °C and 37 °C, and both empty vector controls and un-induced controls were also assayed. Cells were pelleted at 4000rpm for 10 minutes and the supernatant was kept for further analysis. Cells were resuspended in 1xPBS and sonicated for 3 minutes as on/off cycles of 15 seconds. Both the membrane and soluble samples produced after centrifugation were kept for further analysis. Congo Red was then added to the LB, soluble and membrane samples up to a final concentration of 20uM, and no Congo Red samples were also kept for further inspection. Samples were incubated for 2h at static conditions and at room temperature to allow for Congo Red binding. 96-well plates were inoculated for further absorbance measurements at 490nm.

All constructs were assembled as described in Materials and Methods. As a preliminary verification step, restriction analyses were carried out using the corresponding restriction enzymes (refer to figure legends for more details) and results were visualized on 0.7-1% agarose gels. Final confirmation was obtained by gene sequencing, during which the BioBrick Verification Primers and walking primers were used. These are shown on the table below, please refer to the Registry for further information.

Cellulose Production can be easily assayed using the diazo dye Congo Red. Congo Red specifically binds cellulostic fibrils, and this binding can be measured by spectral analysis, because it causes a shift on the spectral properties of the dye, which can be monitored with a spectrophotometer (Klunk et al., 1999). In addition to this, Congo Red also allows for visual, qualitative analysis: it causes a color change of any cellulose-producing colonies by binding to the growing fibres. Therefore, cellulose production can be easily detected by eye on LB Agar plates and liquid cultures (Jolanta Sereikaite and Vladas-Algirdas Bumelis, 2006).

We assayed cellulose production on LB Agar Congo Red assay plates. Colonies containing the refactored cellulose production machinery turned red within 24h, and presented a rougher composition and brighter red color after 48h. In contrast to this, colonies presenting empty vector (negative controls), presented no color changes and maintained the characteristics of standard Escherichia coli colonies (smoother composition and standard yellow colour).

To confirm this qualitative assay, a second qualitative assay was carried out, also based on Congo Red binding. This second analysis consisted of incubating overnight cultures (both cellulose producers and empty vector controls) with Congo Red as described in Materials and Methods. Cellulose producers will present growing cellulose fibres on their extracellular surface, hence will dye red in the presence of Congo Red, unlike non-cellulose-producing cells. After spinning down the cells, a red pellet was observed that corresponded to the cellulose producing colonies. In contrast to this, negative controls did not bind Congo Red and hence maintained the standard E.coli characteristics. We consider that this qualitative data supports our design and confirms that the cellulose production operon has been successfully refactored and transferred into Escherichia coli.

In order to gain a better understanding of the activity of the Acs elements in Escherichia coli, it was of interest to explore whether the AcsAB element alone would be enough to achieve cellulose production. AcsAB is embedded in the cytoplasmic membrane and transports the growing polymer through the membrane as it attaches the glucose monomers in the cytoplasm. In the absence of AcsC and AcsD, no cellulose can be secreted into the environment and as a result, it was assumed that it would instead become accumulated in the cell’s periplasm. For this reason, during characterization we required sonication in order to get the cellulose (if any at all) out of the cells.

To widen our screening, we set up induced samples and uninduced controls and assayed samples at different temperatures (30°C versus 37°C) and different conditions (shaking versus static) in the presence or absence of 1% D-Glucose. Furthermore, 2 Biological replicates were assayed, and technical triplicates were also set up during plate reading to support any statistically relevant findings. Although we expected no cellulose to be accumulating in the medium, we still analysed all fractions originating throughout the procedure: LB fractions, soluble fractions and non-soluble fractions (called membrane fractions throughout this study).

All fractions were incubated in the presence of Congo Red (as described in Materials and Methods) and were later inoculated into a 96-well plate for absorbance measurements at 490nm. Free Congo Red has a maximal absorption at such wavelength. By setting up a control sample, containing solvent (PBS)+ Congo Red, it is possible to measure the total absorbance of the molecule whilst free in solution. When cellulolytic samples are incubated in the presence of Congo Red, less azodye molecules becomes available in the medium due to binding, hence absorbance levels will decrease. The total Congo Red bound will equal the absorbance of Congo Red Control minus the absorbance of our samples of interest. This approach gives you an idea of the amount of Congo Red that may have bound to the cellulositic fibres, but it does not provide exact values of cellulose present.

As expected, LB fractions all presented similar, non-cellulolytic composition and hence displayed no changes in absorbance, indicating no CR binding.

It was observed that interestingly, membrane fractions that had been previously incubated at 30 C presented a dramatic change in Congo Red binding. This proves not only that the AcsAB is active (at least to some extent) in the absence of AcsC and AcsD, but also that it may be optimal for the cellulose synthase to be folded and functional at lower temperatures, as it occurs in the native host G.xylinus.