Team:SCAU-China/Methods & Materials

From 2014.igem.org

(Difference between revisions)
(Created page with "{{CSS/Main}} {{CSS/hxstyle}} {{:Team:SCAU-China/hxmenu}} <html> <script> $(function(){ $(".hx-menu li:eq(6)").addClass("active"); }) </script> <div class="r hx-main"> ...")
 
(6 intermediate revisions not shown)
Line 11: Line 11:
              
              
             <div class="hx-box hx-boxd hx-methodsnew">
             <div class="hx-box hx-boxd hx-methodsnew">
-
                 <div class="ti"><strong>Methods and materials</strong></div>
+
                 <div class="ti"><strong>Methods and Materials</strong></div>
                     <div class="con">
                     <div class="con">
<!---->
<!---->
                         <h3>MEDIUM</h3>
                         <h3>MEDIUM</h3>
-
                         •LB medium
+
                         <b>•LB medium</b>
                         <br />
                         <br />
                         <ul>
                         <ul>
                             <li><em>Tryptone</em> 10 g/L</li>
                             <li><em>Tryptone</em> 10 g/L</li>
-
                             <li><em>YeastExtract</em> 5 g/L</li>
+
                             <li><em>Yeast Extract</em> 5 g/L</li>
                             <li><em>NaCl</em> 10 g/L</li>
                             <li><em>NaCl</em> 10 g/L</li>
                         </ul>
                         </ul>
-
                         •SOC medium
+
                         <br /><br />
 +
                        <b>•SOC medium</b>
                         <br />
                         <br />
                         <ul>
                         <ul>
                         <li><em>Tryptone</em> 20 g/L</li>
                         <li><em>Tryptone</em> 20 g/L</li>
-
                             <li><em>YeastExtract</em> 5 g/L</li>
+
                             <li><em>Yeast Extract</em> 5 g/L</li>
                             <li><em>NaCl</em> 0.50 g/L</li>
                             <li><em>NaCl</em> 0.50 g/L</li>
                             <li><em>KCl</em> 0.18 g/L</li>
                             <li><em>KCl</em> 0.18 g/L</li>
                             <li><em>MgCl</em> 0.59 g/L</li>
                             <li><em>MgCl</em> 0.59 g/L</li>
-
                             <li><em>glucose</em> 3.6 g/L</li>
+
                             <li><em>Glucose</em> 3.6 g/L</li>
                         </ul>
                         </ul>
                         <h3>MFC performance assay</h3>
                         <h3>MFC performance assay</h3>
1.Prepare anode medium, cathode medium and MFC device, autoclave at 115℃ for 15 min.<br />
1.Prepare anode medium, cathode medium and MFC device, autoclave at 115℃ for 15 min.<br />
-
                         2.Inoculate E.coli at 37℃ overnight until optical density (OD600nm) reach 2.0<br />
+
                         2.Inoculate <i>E.coli</i> at 37℃ overnight until optical density (OD600nm) reach 2.0<br />
                         3.Centrifuge at 25℃, 5000 rcf, 5 min discard supernatant and resuspend bacteria with 100 mL anode medium solution.<br />
                         3.Centrifuge at 25℃, 5000 rcf, 5 min discard supernatant and resuspend bacteria with 100 mL anode medium solution.<br />
                         4.Fill the anode chamber with anode solution and seal with rubber plug. Pour 60~80 mL cathode medium into cathode chamber until the proton exchanging membrane (PEM) being overwhelm.<br />
                         4.Fill the anode chamber with anode solution and seal with rubber plug. Pour 60~80 mL cathode medium into cathode chamber until the proton exchanging membrane (PEM) being overwhelm.<br />
Line 41: Line 42:
                         6.Incubate the chamber overnight at 37℃. <br /><br />
                         6.Incubate the chamber overnight at 37℃. <br /><br />
                         <h3>Medium for MFC  </h3>
                         <h3>Medium for MFC  </h3>
-
                         •Anode medium<br />
+
                         <b>•Anode medium</b><br />
                         <table cellpadding="0" cellspacing="0" border="0">
                         <table cellpadding="0" cellspacing="0" border="0">
                         <tr>
                         <tr>
Line 72: Line 73:
                             </tr>
                             </tr>
                         </table>
                         </table>
-
                         •Trace element stock solution<br />
+
                         <b>•Trace element stock solution</b><br />
                         <table cellpadding="0" cellspacing="0" border="0">
                         <table cellpadding="0" cellspacing="0" border="0">
                         <tr>
                         <tr>
Line 123: Line 124:
                             </tr>
                             </tr>
                         </table>
                         </table>
-
                         •Cathode solution<br />
+
                         <b>•Cathode solution</b><br />
50mM PBS
50mM PBS
                         <h3>Constructs through Ω-PCR</h3>
                         <h3>Constructs through Ω-PCR</h3>
Line 134: Line 135:
                         7.Transform into electrocomponent cells
                         7.Transform into electrocomponent cells
                         <br /><br />
                         <br /><br />
-
                         •1st Ω-PCR mixture
+
                         <b>•1st Ω-PCR mixture</b>
                         <br />
                         <br />
                         <table cellpadding="0" cellspacing="0" border="0">
                         <table cellpadding="0" cellspacing="0" border="0">
Line 184: Line 185:
                         </table>
                         </table>
                         <br />
                         <br />
-
                         PCR cycle condition<br />
+
                         <b>PCR cycle condition</b><br />
                         <table cellpadding="0" cellspacing="0" border="0">
                         <table cellpadding="0" cellspacing="0" border="0">
                         <tr>
                         <tr>
Line 228: Line 229:
                         </table>
                         </table>
                         <br />
                         <br />
-
                         •2nd Ω-PCR mixture
+
                         <b>•2nd Ω-PCR mixture</b>
                         <br />
                         <br />
                         <table cellpadding="0" cellspacing="0" border="0">
                         <table cellpadding="0" cellspacing="0" border="0">
Line 268: Line 269:
                         </table>
                         </table>
                         <br />
                         <br />
-
                         PCR cycle conditions<br />
+
                         <b>PCR cycle conditions</b><br />
                         <div class="pic"><img src="https://static.igem.org/mediawiki/2014/5/55/Hx-omega_7.jpg" width="611" /></div>
                         <div class="pic"><img src="https://static.igem.org/mediawiki/2014/5/55/Hx-omega_7.jpg" width="611" /></div>
                         <br /><br />
                         <br /><br />
Line 287: Line 288:
                         Primer 4 ttgggaaccagtgtgctggt<br />
                         Primer 4 ttgggaaccagtgtgctggt<br />
                         <br /><br />
                         <br /><br />
-
                         Confirming PCR reaction mixture<Br />
+
                         <b>Confirming PCR reaction mixture</b><Br />
<table cellpadding="0" cellspacing="0" border="0" class="tableborder">
<table cellpadding="0" cellspacing="0" border="0" class="tableborder">
                         <tr>
                         <tr>
Line 323: Line 324:
                         </table>
                         </table>
                         <br />
                         <br />
-
                         Amplification PCR reaction mixture<br />
+
                         <b>Amplification PCR reaction mixture</b><br />
                         <table cellpadding="0" cellspacing="0" border="0" class="tableborder">
                         <table cellpadding="0" cellspacing="0" border="0" class="tableborder">
                         <tr>
                         <tr>

Latest revision as of 17:55, 17 October 2014

Methods and Materials

MEDIUM

•LB medium
  • Tryptone 10 g/L
  • Yeast Extract 5 g/L
  • NaCl 10 g/L


•SOC medium
  • Tryptone 20 g/L
  • Yeast Extract 5 g/L
  • NaCl 0.50 g/L
  • KCl 0.18 g/L
  • MgCl 0.59 g/L
  • Glucose 3.6 g/L

MFC performance assay

1.Prepare anode medium, cathode medium and MFC device, autoclave at 115℃ for 15 min.
2.Inoculate E.coli at 37℃ overnight until optical density (OD600nm) reach 2.0
3.Centrifuge at 25℃, 5000 rcf, 5 min discard supernatant and resuspend bacteria with 100 mL anode medium solution.
4.Fill the anode chamber with anode solution and seal with rubber plug. Pour 60~80 mL cathode medium into cathode chamber until the proton exchanging membrane (PEM) being overwhelm.
5.Load a 1,000 Ω resistor into the circuit, and connect to the digital multimeter with recorder.
6.Incubate the chamber overnight at 37℃.

Medium for MFC

•Anode medium
Ingredient Concentration
glucose 2.0 g/L
NH4Cl 0.25 g/L
KCl 0.1 g/L
trace element solution 10 mL
PBS buffer (Na2HPO4 and NaH2PO4) 50 mM
riboflavin 100 μM
•Trace element stock solution
Ingredient Concentration (g/L)
MgSO4•7H2O 3.0
MnSO4•H2O 0.5
NaCl 1.0
FeSO4•7H2O 0.1
CoCl2•6H2O 0.1
CaCl2 0.1
ZnSO4•7H2O 0.1
CuSO4•5H2O 0.01
KAl(SO4)2•12H2O 0.01
H3BO3 0.01
Na2MoO4•2H2O 0.01
•Cathode solution
50mM PBS

Constructs through Ω-PCR

1.design primers containing overlap sequences.
2.1st Ω-PCR
3.Exo I digest at 37 ℃ for 20 min.
4.2nd Ω-PCR
5.Dpn I digest at 37 ℃ for 1 hour.
6.Dialysis for 30min
7.Transform into electrocomponent cells

•1st Ω-PCR mixture
  For 1 reaction Final concentration
2x PCR buffer for KOD FX 10 μl 1 ×
2mM dNTPs 4 μl 0.4 mM each
10μM Primer #1 0.4 0.2 μM
10μM Primer #2 0.4 0.2 μM
    Genomic DNA ~200 ng / 50μl
Template DNA ≧ 1 μl Plasmid DNA ~50 ng / 50μl
cDNA (from ~200 ng RNA) / 50μl
KOD FX (1.0U/μl) 0.4 μl 1.0 U / 50 μl
Autoclaved, distilled water up to 20 μl  

PCR cycle condition
Step Temp Time
1:Predenature 94 °C 4 min
2:Denature 98 °C 15 s
3:Annealing （Tm-5）°C 30 s
4:Extension 68 °C 1min/kb DNA
5:Go To step 2 / 35 cycles
6:Final Extension 68 °C 10 min
7:Storage 4 °C ∞

•2nd Ω-PCR mixture
  For 1 reaction Final concentration
2 x PCR buffer for KOD FX 10 μl 1×
2mM dNTPs 4 μl 0.4 mM each
1st Ω-PCR product ≥1 μl 50~400 ng
Template plasmid ≥ 1 μl 5~100 ng
KOD FX (1.0 U/μl) 0.4 μl 1.0 U / 50 μl
Autoclaved, distilled water up to 20 μl  

PCR cycle conditions


Arca knockout method

1. Transfer plasmid pKD46 into the wild type E. coli MG1655; screen the positive colony using Ampicillin.
2. Use pKD46 specific primers to screen transformants by colony PCR.
3. Prepare pKD46 positive electrocomponent cell.
4. Amplify Kanamycin resistant gene NPTII using primer 1 and 2.
5. Purify the NPTII fragment by electrophoresis.
6. Transfer the NPTII segment into the wild type cell with pKD46.
7. Screen Kan and Amp resistant strain on selection media.
8. Use PCR (primer 3 and 4) to confirm the arcA knock-out colony.
9. Sequencing the target gene to confirm the knock-out effect.

Primer 1 gacttttgtacttcctgtttcgatttagttggcaatttaggtagcaaacatgagccatattcaacggga
Primer 2 ataaaaacggcgctaaaaagcgccgttttttttgacggtggtaaagccgattagaaaaactcatcgagca
Primer 3 gtcatgttacgccgatcatg
Primer 4 ttgggaaccagtgtgctggt


Confirming PCR reaction mixture
Component Volume (μl)
ddH2O 13
10 x PCR buffer 2
dNTP mix 0.4
Primer 3 0.4
Primer 4 0.4
Taq polymerase 0.4
Bacteria 3

Amplification PCR reaction mixture
Component Volume (μl)
ddH2O 160
10 x PCR buffer 20
dNTP mix 4
Primer 3 4
Primer 4 4
Taq polymerase 4
DNA template 4

Retrieved from "http://2014.igem.org/Team:SCAU-China/Methods_%26_Materials"