Team:AMU-Poznan/Project

From 2014.igem.org

(Difference between revisions)
 
(6 intermediate revisions not shown)
Line 55: Line 55:
Sh-miR designer is a project we started during iGEM 2013. This year we would like to continue and expand functionality of the software. sh-miR designer v1.0 (link) is aimed to create sh-miR molecules based on siRNAs provided by the user. In sh-miR designer v2.0 only the mRNA number (from NCBI database), which expression should be decreased can be provided. Moreover, we expanded functionality of the software with off-target validation and check of immune motifs and also extended miRNA-shuttles database.
Sh-miR designer is a project we started during iGEM 2013. This year we would like to continue and expand functionality of the software. sh-miR designer v1.0 (link) is aimed to create sh-miR molecules based on siRNAs provided by the user. In sh-miR designer v2.0 only the mRNA number (from NCBI database), which expression should be decreased can be provided. Moreover, we expanded functionality of the software with off-target validation and check of immune motifs and also extended miRNA-shuttles database.
sh-miR Designer is a software aimed for fast and efficient design of effective RNA interference (RNAi) reagents - sh-miRs, also known as artificial miRNAs. sh-miRs are RNA particles whose structure is based on miRNA precursor pri-miRNA, but sequence interacting with transcript is changed depending on research purpose. Maintenance of structure of pri-miRNA is very important to enable cellular processing and therefore ensure functionality of artificial particles. sh-miRs delivered to cells on genetic vectors - plasmids or viral vectors - enter natural RNAi pathway and silence target mRNA. They can be used in genetic therapies and basic biomedical research.
sh-miR Designer is a software aimed for fast and efficient design of effective RNA interference (RNAi) reagents - sh-miRs, also known as artificial miRNAs. sh-miRs are RNA particles whose structure is based on miRNA precursor pri-miRNA, but sequence interacting with transcript is changed depending on research purpose. Maintenance of structure of pri-miRNA is very important to enable cellular processing and therefore ensure functionality of artificial particles. sh-miRs delivered to cells on genetic vectors - plasmids or viral vectors - enter natural RNAi pathway and silence target mRNA. They can be used in genetic therapies and basic biomedical research.
-
We will provide two applications to access the software, one which require siRNA sequences and the second which require transcript accession number from NCBI database. Each user will receive an account with login (e-mail) and password where he/she would be able to check history of software usage.
+
We will provide two applications to access the software, one which require siRNA sequences and the second which require transcript accession number from NCBI database. Each user will receive an account with login (e-mail) and password where he/she would be able to check history of software usage.</br>
-
<br/>input form:<br/>
+
-
<img src="https://static.igem.org/mediawiki/2014/2/24/Zrzut_ekranu_2014-10-15_o_18.07.36.png"  width="60%"></br>
+
-
users' history:<br/>
+
-
<img src="https://static.igem.org/mediawiki/2014/c/c2/Zrzut_ekranu_2014-10-15_o_18.09.10.png"  width="60%"><br/>
+
<h1>Biological background</h1>
<h1>Biological background</h1>
</br>
</br>
-
RNA interference (RNAi) is a physiological process of posttranscriptional gene expression regulation caused by double stranded RNA molecules. This is one of the most willingly used experimental techniques. It is used in experiments designed to explore gene function, in creation cellular models of diseases or in genetic therapy design. Among RNAi technology reagents are siRNA (short interfering RNA) and vector reagents shRNA (short hairpin RNA) and sh-miR (sh- microRNA). RNAi reagents are integrated into endogenous RNAi pathway on different phases. sh-miR reagents are designed in the way to be similar to endogenous miRNA precursors (pri-miRNA), because it is important feature to be recognized by proteins involved in microRNA (miRNA) biogenesis.</br></br>
+
RNA interference (RNAi) is a physiological process of posttranscriptional gene expression regulation caused by double stranded RNA molecules. This is one of the most willingly used experimental techniques. It is used in experiments designed to explore gene function, in creation cellular models of diseases or in genetic therapy design. Among RNAi technology reagents are siRNA (short interfering RNA) and vector reagents shRNA (short hairpin RNA) and sh-miR (sh- microRNA). RNAi reagents are integrated into endogenous RNAi pathway on different phases. sh-miR reagents are designed in the way to be similar to endogenous miRNA precursors (pri-miRNA), because it is important feature to be recognized by proteins involved in microRNA (miRNA) biogenesis.</br>
 +
<img src="https://static.igem.org/mediawiki/2014/e/e1/Dicer.png">
 +
</br>
-
shRNA or sh-miR reagents are introduced into cells with usage of genetic vectors – plasmids or viral vectors to ensure intracellular expression. They have huge therapeutic potential beacuse of stable reagent production in cells what enables one time therapeutic dosage. Usage of synthetic siRNA reagents requires often dosage, what makes therapy more difficult, especially in case of Central Nervous System Diseases.</br></br>  
+
shRNA or sh-miR reagents are introduced into cells with usage of genetic vectors – plasmids or viral vectors to ensure intracellular expression. They have huge therapeutic potential beacuse of stable reagent production in cells what enables one time therapeutic dosage. Usage of synthetic siRNA reagents requires often dosage, what makes therapy more difficult, especially in case of Central Nervous System Diseases.</br>
 +
<img src="https://static.igem.org/mediawiki/2014/a/a8/Jaja.png">
 +
</br>  
It was recently shown that RNAi reagents introduces into cells can trigger unwanted non-specific effects, e.g. can interact with different transcripts besides the desired one (so called off-target effect) or induce immunological effect. Because in processing of sh-miR reagents endogenous endonucleasis Drosha and Dicer are involved, in case of high expression of reagent they can saturate those proteins as well as Exportin-5 transport protein responsible for export of sh-miR from nucleus. The saturation can influence endogenous RNAi mechanism. It was shown that sh-miR reagents influence less endogenous RNAi pathway, because of lower level of produced double-stranded RNA (dsRNA), preserving efficiency of translation silencing. They also show longer effect than different types of RNAi reagents. Because of described features sh-miR reagents seems to be good choice when designing efficient and non-toxic RNAi reagents.</br></br>
It was recently shown that RNAi reagents introduces into cells can trigger unwanted non-specific effects, e.g. can interact with different transcripts besides the desired one (so called off-target effect) or induce immunological effect. Because in processing of sh-miR reagents endogenous endonucleasis Drosha and Dicer are involved, in case of high expression of reagent they can saturate those proteins as well as Exportin-5 transport protein responsible for export of sh-miR from nucleus. The saturation can influence endogenous RNAi mechanism. It was shown that sh-miR reagents influence less endogenous RNAi pathway, because of lower level of produced double-stranded RNA (dsRNA), preserving efficiency of translation silencing. They also show longer effect than different types of RNAi reagents. Because of described features sh-miR reagents seems to be good choice when designing efficient and non-toxic RNAi reagents.</br></br>
Line 80: Line 80:
<h1>User Guide</h1>
<h1>User Guide</h1>
<div align="left">
<div align="left">
 +
There are two suplementary versions of our software. First one (based on last year's software sh-miR v1.0) enable to design sh-miR molecules based on siRNA sequence and the second design sh-miR molecules when NCBI transcript number (NM_...) is provided. In the second version the user also can set GC content, maximum off-target and immunostimulatory properties. The user can also set which pri-miRNA should be used to design sh-miR (or all available in our miRNA database).</br>
 +
 +
Please follow video where you can see how to use web version of the software</br>
 +
and short description how to use client version of the software</br>
 +
Both versions are well documented on github and readthedocs (see below)</br>
<h3>Usage via Web server</h1>
<h3>Usage via Web server</h1>
-
go to our website <a href="shmir.wmi.amu.edu.pl">shmir.wmi.amu.edu.pl</a>
+
go to our website <a href="https://shmir.wmi.amu.edu.pl">shmir.wmi.amu.edu.pl</a>
-
<div>
+
<div align = "center">
<iframe width="420" height="315"
<iframe width="420" height="315"
src="https://www.youtube.com/embed/D3DO_5NODQo">
src="https://www.youtube.com/embed/D3DO_5NODQo">
</iframe>
</iframe>
-
</div>
+
</div></br></br>
-
 
+
<br/>input form:<br/></br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/2/24/Zrzut_ekranu_2014-10-15_o_18.07.36.png"  width="60%"></br></br></br>
 +
<br/>results:<br/></br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/8/8a/Zrzut_ekranu_2014-10-15_o_22.19.56.png"  width="60%"></br></br></br>
 +
users' history:<br/></br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/c/c2/Zrzut_ekranu_2014-10-15_o_18.09.10.png"  width="60%"><br/></br></br>
<h3>Usage via client</h3>
<h3>Usage via client</h3>
</br>Fold sequence via mfold:</br>
</br>Fold sequence via mfold:</br>
Line 117: Line 127:
</br>Here you can find documentation from code:</br>
</br>Here you can find documentation from code:</br>
-
API: <a href="shmir-api.rtfd.org">shmir-api.rtfd.org</a></br>
+
API: <a href="https://shmir-api.rtfd.org">shmir-api.rtfd.org</a></br>
-
Client: <a href="shmir-client.rtfd.org">shmir-client.rtfd.org</a></br>
+
Client: <a href="https://shmir-client.rtfd.org">shmir-client.rtfd.org</a></br>
-
Webpage: <a href="shmir-designer.rtfd.org">shmir-designer.rtfd.org</a></br>
+
Webpage: <a href="https://shmir-designer.rtfd.org">shmir-designer.rtfd.org</a></br>
Line 202: Line 212:
1: backbone: miR-31, score: 106, sequence: ACATGACGGAGGTTGTGAG</br>
1: backbone: miR-31, score: 106, sequence: ACATGACGGAGGTTGTGAG</br>
  pdf: ./results/transcript/e9e8b9a2-7e3b-4b24-b26a-633332a3f6b2/miR-31/7270b2d2-0aca-472b-853e-5a9631164d46</br>
  pdf: ./results/transcript/e9e8b9a2-7e3b-4b24-b26a-633332a3f6b2/miR-31/7270b2d2-0aca-472b-853e-5a9631164d46</br>
-
  result: </br>CATAACAACGAAGAGGGATGGTATTGCTCCTGTAACTCGGAACTGGAGAGGACATGACGGAGGTTGTGAGCGTTGAACTGGGAACCCTCACAACCTCCGTCATGTCTCTCCAGTTCCGAGTTACAGGAGCAATACCAT</br>CCCTCTTCGTTGTTATGCTTTCCTGTCTGACAGCAGCTTGGCTACCTCCGTCCTGTTCCTCCTTGTCTT
+
  result: </br>CATAACAACGAAGAGGGATGGTATTGCTCCTGTAACTCGGAACTGGAGAGGACATGACGGAGGTTGTGAGCGTTGAACTGGGAACCCTCACAACCTCCGTCA
 +
</br>TGTCTCTCCAGTTCCGAGTTACAGGAGCAATACCAT</br>CCCTCTTCGTTGTTATGCTTTCCTGTCTGACAGCAGCTTGGCTACCTCCGTCCTGTTCCTCCTTGTCTT
</br></br>
</br></br>
2: backbone: miR-31, score: 106, sequence: ATGTTTTGTAGAGATGGGG</br>
2: backbone: miR-31, score: 106, sequence: ATGTTTTGTAGAGATGGGG</br>
  pdf: ./results/transcript/e9e8b9a2-7e3b-4b24-b26a-633332a3f6b2/miR-31/56232916-2649-4eb4-9970-c0b0a08ce64e</br>
  pdf: ./results/transcript/e9e8b9a2-7e3b-4b24-b26a-633332a3f6b2/miR-31/56232916-2649-4eb4-9970-c0b0a08ce64e</br>
-
  result: </br>CATAACAACGAAGAGGGATGGTATTGCTCCTGTAACTCGGAACTGGAGAGGATGTTTTGTAGAGATGGGGCGTTGAACTGGGAACCCCCCATCTCTACAAAACATCTCTCCAGTTCCGAGTTACAGGAGCAATACCAT</br>CCCTCTTCGTTGTTATGCTTTCCTGTCTGACAGCAGCTTGGCTACCTCCGTCCTGTTCCTCCTTGTCTT
+
  result: </br>CATAACAACGAAGAGGGATGGTATTGCTCCTGTAACTCGGAACTGGAGAGGATGTTTTGTAGAGATGGGGCGTTGAACTGGGAACCCCCCATCTCTACA
 +
</br>AAACATCTCTCCAGTTCCGAGTTACAGGAGCAATACCAT</br>CCCTCTTCGTTGTTATGCTTTCCTGTCTGACAGCAGCTTGGCTACCTCCGTCCTGTTCCTCCTTGTCTT
</br></br>
</br></br>
3: backbone: miR-31, score: 106, sequence: ATTACATGGGGTCTAGAAC</br>
3: backbone: miR-31, score: 106, sequence: ATTACATGGGGTCTAGAAC</br>
  pdf: ./results/transcript/e9e8b9a2-7e3b-4b24-b26a-633332a3f6b2/miR-31/37cd84aa-362c-484d-8681-929043cc9c61</br>
  pdf: ./results/transcript/e9e8b9a2-7e3b-4b24-b26a-633332a3f6b2/miR-31/37cd84aa-362c-484d-8681-929043cc9c61</br>
-
  result: </br>CATAACAACGAAGAGGGATGGTATTGCTCCTGTAACTCGGAACTGGAGAGGATTACATGGGGTCTAGAACCGTTGAACTGGGAACCGTTCTAGACCCCATGTAATCTCTCCAGTTCCGAGTTACAGGAGCAATACCAT</br>CCCTCTTCGTTGTTATGCTTTCCTGTCTGACAGCAGCTTGGCTACCTCCGTCCTGTTCCTCCTTGTCTT
+
  result: </br>CATAACAACGAAGAGGGATGGTATTGCTCCTGTAACTCGGAACTGGAGAGGATTACATGGGGTCTAGAACCGTTGAACTGGGAACCGTTCTAG
 +
</br>ACCCCATGTAATCTCTCCAGTTCCGAGTTACAGGAGCAATACCAT</br>CCCTCTTCGTTGTTATGCTTTCCTGTCTGACAGCAGCTTGGCTACCTCCGTCCTGTTCCTCCTTGTCTT
</br></br>
</br></br>
4: backbone: miR-31, score: 106, sequence: ACCATCATCACACTGGAAG</br>
4: backbone: miR-31, score: 106, sequence: ACCATCATCACACTGGAAG</br>
  pdf: ./results/transcript/e9e8b9a2-7e3b-4b24-b26a-633332a3f6b2/miR-31/50b763f6-2193-4743-96c0-61601880e574</br>
  pdf: ./results/transcript/e9e8b9a2-7e3b-4b24-b26a-633332a3f6b2/miR-31/50b763f6-2193-4743-96c0-61601880e574</br>
-
  result: </br>CATAACAACGAAGAGGGATGGTATTGCTCCTGTAACTCGGAACTGGAGAGGACCATCATCACACTGGAAGCGTTGAACTGGGAACCCTTCCAGTGTGATGATGGTCTCTCCAGTTCCGAGTTACAGGAGCAATACCAT</br>CCCTCTTCGTTGTTATGCTTTCCTGTCTGACAGCAGCTTGGCTACCTCCGTCCTGTTCCTCCTTGTCTT
+
  result: </br>CATAACAACGAAGAGGGATGGTATTGCTCCTGTAACTCGGAACTGGAGAGGACCATCATCACACTGGAAGCGTTGAACTGGGAACCCTT
 +
</br>CCAGTGTGATGATGGTCTCTCCAGTTCCGAGTTACAGGAGCAATACCAT</br>CCCTCTTCGTTGTTATGCTTTCCTGTCTGACAGCAGCTTGGCTACCTCCGTCCTGTTCCTCCTTGTCTT
</br></br>
</br></br>
5: backbone: miR-31, score: 106, sequence: ATCTCACCCCATCCCACAC</br>
5: backbone: miR-31, score: 106, sequence: ATCTCACCCCATCCCACAC</br>
  pdf: ./results/transcript/e9e8b9a2-7e3b-4b24-b26a-633332a3f6b2/miR-31/019ce915-0282-4d83-9538-93c36c790fa8</br>
  pdf: ./results/transcript/e9e8b9a2-7e3b-4b24-b26a-633332a3f6b2/miR-31/019ce915-0282-4d83-9538-93c36c790fa8</br>
-
  result: </br>CATAACAACGAAGAGGGATGGTATTGCTCCTGTAACTCGGAACTGGAGAGGATCTCACCCCATCCCACACCGTTGAACTGGGAACCGTGTGGGATGGGGTGAGATCTCTCCAGTTCCGAGTTACAGGAGCAATACCAT</br>CCCTCTTCGTTGTTATGCTTTCCTGTCTGACAGCAGCTTGGCTACCTCCGTCCTGTTCCTCCTTGTCTT</br>
+
  result: </br>CATAACAACGAAGAGGGATGGTATTGCTCCTGTAACTCGGAACTGGAGAGGATCTCACCCCATCCCACACCGTTGAAC
 +
</br>TGGGAACCGTGTGGGATGGGGTGAGATCTCTCCAGTTCCGAGTTACAGGAGCAATACCAT</br>CCCTCTTCGTTGTTATGCTTTCCTGTCTGACAGCAGCTTGGCTACCTCCGTCCTGTTCCTCCTTGTCTT</br>
</br>
</br>
see example pdf with structure <a href="https://static.igem.org/mediawiki/2014/d/da/Sequence_1.pdf">link</a>
see example pdf with structure <a href="https://static.igem.org/mediawiki/2014/d/da/Sequence_1.pdf">link</a>
</br>
</br>
 +
During sh-miR designer development, colleagues from befriended lab used our software, so we had constant feedback from potential users,</br>
 +
who by the way, have nothing to do with bioinformatics. So it's really hard to satisfy their strong need for easy interface.</br>
 +
We also had significant feedback from our survey (see Modeling tab), so we knew what we should emphasise on during develoment.</br>
 +
</br>
</br>
<h1>Test cases</h1>
<h1>Test cases</h1>

Latest revision as of 21:18, 17 October 2014