Team:XMU-China/Notebook Protocol

From 2014.igem.org

(Difference between revisions)

Latest revision as of 03:40, 18 October 2014

side_bar

Protocols

General Considerations

E. coli Strains

E. coli strain DH5α, was offered by XMU-China iGEM 2013.

E. coli strain CL-1, whose gene of cheZ had been knocked out, was offered generously by iGEMer JianDong Huang and Lizhong Liu, from Department of Biochemistry, The University of Hong Kong.

Antibiotic

Antibiotic	Stock Concentration (mg/mL)	Final Concentration (μg/mL)	Solvent
Chloramphenicol	50	50	Absolute ethyl alcohol
Ampicillin	50	100	ddH2O
Kanamycin	50	50	ddH2O
Tetracycline	50	50	Absolute ethyl alcohol

 All the antibiotics above require filtration to sterilize.

 Stock in -20°C

LB Liquid Medium

Ingredients	Percent (g/mL)
Yeast Extract	0.5%
Tryptone	1%
NaCl	1%

LB Solid Medium

Ingredients	Percent (g/mL)
Yeast Extract	0.5%
Tryptone	1%
NaCl	1%
Agar	1.5%

LB Semi-Solid Medium

Ingredients	Percent (g/mL)
Yeast Extract	0.5%
Tryptone	1%
NaCl	1%
Agar	0.25%

Preparation of Competent Cell (TaKaRa Competent Cell Preparation Kit)

 Activate the E. coli strain on LB-plate from glycerol stock under the condition of 37°C for 12 hours.

 Pre-culture a single colony in 5 mL LB liquid medium under the condition of 37°C, 200 rpm for 12 hours.

 Add 200 μL pre-culture bacteria into 20 mL LB liquid medium. Culture under the condition of 37°C, 200 rpm for 2 hours.

 Place on ice for 30 min.

 Subpackage the 20 mL culture medium into 1.5 mL sterile centrifuge tube, each centrifuge tube containing 1 mL.

 Centrifuge at 1500×g for 5 min at 4°C, then discard supernatant.

 Re-suspend each centrifuge tube gently with 100 μL Solution A, which has been precooled in ice.

 Centrifuge at 1500×g for 5 min at 4°C, then discard supernatant.

 Re-suspend each centrifuge tube gently with 100 μL Solution B, which has been precooled in ice.

 Stock in -20°C

Transformation

 Add 1 μL purified plasmid or 10 μL ligation system into 100 μL fresh competent cells, which is contained in 1.5 mL centrifuge tube. Then mix gently.

 Leave on ice for 30 minutes.

 Heat shock at 42°C for 90 seconds.

 Leave on ice for 10 minutes immediately.

 Add 400 μL fresh LB medium into the centrifuge tube.

 Incubate for 2 hours under the condition of 37°C, 200 rpm.

Note: If the resistance of vector is ampicillin, incubation time is shortened to 1 hour.

 Spread 100 μL culture medium on a LB solid medium plate, which contains appropriate antibiotics.

 Incubate overnight at 37°C

Confirmation

1. Plasmid Extraction (Omega Plasmid Mini Kit)

 Add 1 mL overnight suspension culture into a 1.5 mL sterile centrifuge tube. Centrifuge at 10000 x g for 1 min, then discard supernatant.

 Repeat the step above several times, until the amount of bacteria is appropriate.

 Re-suspend cells gently with 250 μL Solution I/RNase A.

 Add 250 μL Solution II into each centrifuge tube. Mix gently by inverting 4-6 times to obtain cleared lysate.

 Add 350 μL Solution III into each centrifuge tube. Mix well to form protein precipitate.

 Centrifuge at ≥13000 x g for 10 min.

 Transfer cleared lysate into a HiBind Mini Column placed in a 2 mL collection tube.

 Centrifuge at 10000 x g for 1 min. Discard liquid.

 Wash the HiBind Mini Column with 500 μL HB Buffer. Centrifuge at 10000 x g for 1 min. Discard liquid.

 Using the same collection tube, wash the HiBind Mini Column with 700 Μl DNA Wash Buffer, which is diluted with ethanol. Centrifuge at 10000 x g for 1 min. Discard liquid.

 Wash the HiBind Mini Column a second time with an additional 700 μL DNA Wash Buffer. Centrifuge at 10000 x g for 1 min. Discard liquid.

 Centrifuge the empty HiBind Mini Column at ≥ 13000 x g for 2 min to spin-dry.

 Place the HiBind Mini Column into a sterile 1.5 mL centrifuge tube.

 Add 30 μL sterile ultrapure water directly into the HiBind Mini Column. Sit at room temperature for 2 minutes. Centrifuge at maximum speed (≥ 13000 x g) for 1 min to elute DNA.

2. Digestion for Confirmation

Reaction condition: 37°C for 2 hours.

Single Digestion		Double Digestion
Plasmid	5 μL	Plasmid	5 μL
EcoR I	0.5 μL	Xba I	0.5 μL
		Pst I	0.5 μL
10×H Buffer	1 μL	10×M Buffer	1 μL
ddH2O	3.5 μL	ddH2O	3 μL
Total Volume	10 μL	Total Volume	10 μL

3. DNA gel electrophoresis (take 20 mL as example)

 Dilute 50×TAE to 1×TAE with ddH2O.

 Measure 20 mL 1×TAE buffer.

 Pour 1×TAE buffer into an erlenmeyer flask.

 Weigh 0.2g agarose to make 1% DNA gel.

 Pour agarose into the erlenmeyer flask.

 Make agarose melt by microwave, lasting for 105 seconds until melt completely.

 Cool for 5 minutes.

 Assemble gel pouring apparatus by inserting gate into slots.

 Pour agarose gel into gel tray.

 Bring a piece of silver paper on the top of the gel pouring apparatus.

 Wait for 30-40 minutes to solidify the DNA agarose gel.

Ligation

1. Digestion for Ligation

Reaction condition: 37°C for 2.5 hours.

Insert(A) + Vector(B)				Vector (A) + Insert (B)
Insert(A)	30 μL	Vector(B)	30 μL	Insert(B)	30 μL	Vector(A)	30 μL
EcoR I	3 μL	EcoR I	4.5 μL	Xba I	3 μL	Spe I	4.5 μL
Spe I	3 μL	Xba I	4.5 μL	Pst I	3 μL	Pst I	4.5 μL
10×H Buffer	4 μL	10×M Buffer	4 μL	10×M Buffer	4 μL	10×H Buffer	4 μL
ddH2O	0 μL	ddH2O	7 μL	ddH2O	0 μL	ddH2O	7 μL
Total Volume	40 μL	Total Volume	50 μL	Total Volume	40 μL	Total Volume	50 μL

2. Gel Extraction of DNA (Omega Gel Extraction Kit)

 Perform DNA gel electrophoresis to fractionate DNA fragments.

 When adequate separation of bands has occurred, excise the DNA fragments of interest carefully.

 Weigh in sterile 1.5 mL centrifuge tube.

 Add corresponding volume of Binding Buffer (XP2) into the centrifuge tube.

 Heat the DNA/gel mixture at 55-65°C for 7 min, until the gel melt completely.

 Put a HiBind DNA Mini Column in a 2 mL collection tube. Add the DNA/gel solution to the HiBind DNA Mini Column.

 Centrifuge at 10000 x g for 1 min at room temperature. Discard the flow-through liquid.

 Add 300 μL Binding Buffer (XP2) into the centrifuge tube. Centrifuge at 10000 x g for 1 minute at room temperature. Then discard the flow-through liquid.

 Add 700 μL SPW Wash Buffer (diluted with absolute ethanol). Centrifuge at 10000 x g for 1 minute at room temperature. Then discard the flow-through liquid.

 Repeat the previous step.

 Centrifuge the empty HiBind Mini Column at ≥ 13000 x g for 2 min to spin-dry.

 Place the HiBind Mini Column into a sterile 1.5 mL centrifuge tube.

 Add 30 μL Elution Buffer directly into the HiBind Mini Column. Sit at room temperature for 2 minutes. Centrifuge at maximum speed (≥ 13000 x g) for 1 min to elute DNA.

3. Ligation

 Reaction condition: 16°C for 5-12 hours.

 Measure the concentration of DNA fragments and vector which are going to be ligated.

 Calculate the volume of insert fragments and vector which should be added, based on the formula:

 Add DNA fragments, vector, ligation buffer and T4 Ligase together in an EP tube as the table below.

Insert Fragments	V1 μL
Vector	V2 μL
10×Ligation Buffer	1 μL
T4 Ligase	1 μL
Add ddH2O until the total volume equals 10.0 μL

Note: Mixing the ligation system well by pipetting up and down gently is necessary.

General PCR (Polymerase Chain Reaction)

PCR System

Template	1 μL
Forward Primer	2 μL
Reverse Primer	2 μL
dNTP Mixture	2 μL
10×PCR Buffer	5 μL
rTaq (TakaRa)	1 μL
ddH2O	37 μL
Total Volume	50 μL

PCR Condition

1	94°C	5 min
2	94°C	30 s	30 loops
3	Tm°C	30 s
4	72°C	1 min/kb
5	72°C	10 min
6	15°C	5 min

Conic curve formation

Medium: M63 [1] semi-solid medium preparation

M63 semi-solid medium/100 mL
Ingredients	Quantities
KH2PO4	1.36 g
KOH	0.42 g
(NH4)2SO4	0.2 g
MgSO4	0.012 g
Agar( gel strength>750 g/cm2)	0.25 g
H2O 1	96 mL
Glycerol	0.2 mL
FeSO4 2	10.84*10-4 g
D-glucose	0.4 g
Asp 3	6.6*10-6 g
Met, Leu, His, Thr (0.015 g/mL) 4	1 mL

Note：

1. Add 0.25 g Agar into a erlenmeyer flask first, then pour into 96 mL H2O, shaking up, continue to add glycerol using pipette.

2. Add 10 μL 0.1 g/mL FeSO4 solution into the medium.

3. Add 10 μL 66 mg/mL Asp solution into the medium.

4. Met, Leu, His, Thr could be premixed for convenience, and the amino acid should be added by injector through 0.22 μm filter membrane. Pay attention that this process must be carried out after high temperature sterilization of the M63 semi-solid medium.

I. Mix-doting bacteria, inductor and inhibitor on M63 semi-solid medium plate [2]

1. Pour 20 ml M63 semi-solid medium on a plate, leave the plate air-dried for 90 min in laminar flow clean bench.

2. Dot 15 μL inductor (IPTG) or inhibitor (L-Arabinose) on the plate through pipette, take care when insert the tip into the medium. Leave the plate air-dried for 20 min in laminar flow clean bench.

3. Dot 3 μL culture medium at the same position of the inductor (IPTG) or inhibitor (L-Arabinose), leave the plate air-dried for 5 min in laminar flow clean bench.

4. Seal the plate.

II. Lineation of inductor and inhibitor on the M63 semi-solid medium plate

1. Pour 20 mL M63 semi-solid medium on a plate, leave the plate air-dried for 90 min in laminar flow clean bench.

2. Inhale 15 μL inductor (IPTG) or inhibitor (L-Arabinose), doting along the line pre-pianted carefully, bear in mind don’t destroy the semi-solid medium when moving along the line.

3. Leave the plate air-dried for 90 min in laminar flow clean bench.

4. Repeat the process mix-doting bacteria, inductor and inhibitor on M63 semi-solid medium plate.

Characterization the activity of promoter and efficiency of RBS by chemotaxis

culture

1. Add 50 μL bacterium solution (pLac-RBS (1.0)-CheZ-TT, pLac-RBS (0.3)-CheZ-TT, pLac-RBS (0.01)-CheZ-TT,) into 5 mL fresh LB liquid medium, in which chloromycetin concentration is 50 μg/ml.

2. Culture overnight under the condition of 37°C, 200 rpm.

3. Add 50 μL bacterium solution from the LB liquid medium above to another 5 mL fresh LB liquid medium, in which chloromycetin concentration is 50 μg/mL.

4. Culture under the condition of 37°C, 200 rpm for 3 hours. Stock it in 4°C.

5. Prepare M63 semi-solid medium as above.

6. Draw three dots on a M63 semi-solid medium plate first, then inoculate the three kinds of bacterium solution at the three dots, respectively. The volume of the inoculated bacterium solution is 3 μL.

7. Culture in incubator at 37°C.

Measurement

1. Use a ruler to measure the radius of colony from the bottom of the semi-solid medium plate. The initial colony radius is recorded as R1, and the radiuses measured at 12h, 24h, 30h, 36h, 42h... as R2, R3, R4, R5, R6, R7…

2. Record time and diameter in a table.

3. Process data with excel.

Black hole

Plasmid Construction

All DNA parts applied in these experiments came from the MIT Registry of Standard Biological Parts. The new BioBrick part, PompC-cheZ (BBa_K1412010) was formed by ligating the pre-existing parts, PompC (BBa_R0082) and cheZ (BBa_K629003). The E.Z.N.A.TM Plasmid Mini Kit I (200) was used according to the manufacturer’s instructions to extract plasmid DNA. BioBrick parts were digested with restriction enzymes, EcoRI, Xba I, Spe I, and Pst I to produce ‘sticky ends’ that were used to combine BioBrick parts. Digested DNA was purified using 1% agarose gel electrophoresis followed by gel purification with the E.Z.N.A.TM Gel Extraction Kit (200). BioBrick parts with matching ‘sticky ends’ were ligated using T4 ligase produced by Takara Biotechnology (Dalian) Co., Ltd. (Takara Dalian). Plasmid DNA was transformed into DH5α

first. Then we began a new circulation consisting of extracting plasmids, digestion and DNA gel electrophoresis to confirm the success of the ligation. Finally, the construct was sequenced for verification.

Construction of E. coli strain CL-1

The new biobrick part, PompC-cheZ (BBa_K1412010) on pSB1C3 was introduced into E. coli strain CL-1, whose gene of cheZ had been knocked out.

I. Gradient Plate Experiments (semi-solid medium, Cm 50μg/ml)

Medium: Medium A [3] (Improved)

Ingredients	Percent (g/mL)
Yeast Extract	0.26%
Peptone	0.27%
K2HPO4	0.37%
KH2PO4	0.13%
NaCl	0.05%
Glycerol	0.2%

Sucrose concentration gradient: 0~20%, the concentration gradient was 2%.

Mid-log-phase cell suspensions preparation:

1. Overnight culture of the required strain grow at 37 °C in Medium A (Improved) containing appropriate chloramphenicol.

2. Dilute the overnight culture at the ratio of 1:100 in fresh culture (Medium A), then incubate the culture under the condition of 37°C, 200 rpm, until its OD590 reaches 0.2.

3. Stock in 4°C.

The method of preparing gradient semi-solid medium (0.25% agar)

1. Prepare 100% sucrose solution.

2. Prepare the medium with tripled ingredients amount.

3. Put the 100% sucrose solution, the prepared medium and plenty of deionized water into the autoclave for 121°C, 20 minutes.

4. After sterilization, put the 100% sucrose solution, the prepared medium and the deionized water into a drying oven for around 10 minutes.

5. Take 5 mL tripled Medium A (Improved) into a 25 mL erlenmeyer flask, then add appropriate volume of 100% sucrose solution into the erlenmeyer flask, while the shortage will be complemented by deionized water to make the total volume to be 15 mL.

6. Add 15 μL chloramphenicol into the erlenmeyer flask.

7. Pour the mixture into a Petri dish (85 mm dia.) as quickly as possible.

8. Leave the plate air-dried for 90 min in laminar flow clean bench.

9. After solidification of the media, cell suspensions from mid-log-phase cultures (3 μL) were inoculated in the center of the plate.

10. Leave the plate dried in air for 15 min in laminar flow clean bench.

11. Leave the plate incubated at 37°C. During the period of time, measure the diameters of the colony and take them down.

II. Plates Crossed Experiments (semi-solid medium, Cm 50μg/ml)

Medium: half Medium A (Improved)

Ingredients	Percent (g/mL)
Yeast Extract	0.13%
Peptone	0.135%
K2HPO4	0.195%
KH2PO4	0.065%
NaCl	0.025%
Glycerol	0.1%

The concentration of sucrose: 0%, 10%

The method of preparing liquid medium containing different concentrations of sucrose:

1. Prepare the medium with corresponding ingredients amount in the table above.

2. Add corresponding amount of solid sucrose into the liquid medium.

3. Wait for sterilization.

Mid-log-phase cell suspensions preparation:

1. Overnight culture of the required strain grow at 37°C in Medium A (Improved) containing appropriate chloramphenicol.

2. Dilute the overnight culture at the ratio of 1:100 in fresh culture (half Medium A), then incubate the culture under the condition of 37°C, 200 rpm, until its OD590 reaches 0.2.

3. Stock in 4°C.

The method of preparing semi-solid medium with a cross (0.25% agar)

1. Prepare the medium with corresponding ingredients amount in the table above.

2. Put the medium containing agar, the liquid medium containing sucrose and plenty of deionized water into the autoclave for 121°C, 20 minutes.

3. After sterilization, put the mediums and the deionized water into a drying oven for around 10 minutes.

4. Take 15 mL of the medium containing agar into a 25 mL erlenmeyer flask.

5. Add 15 μL chloramphenicol into the erlenmeyer flask.

6. Pour the mixture into a Petri dish (85 mm dia.) as quickly as possible.

7. Leave the plate air-dried for 90 min in laminar flow clean bench.

8. After solidification of the media, draw a cross composed of two straight lines on the plate, by the way of Intensive RBI (1 μL/mm). One straight line is dotted with water, the other is dotted with liquid medium containing 10% sucrose. The length of the lines is 6 centimeters.

9. Leave the plate dried in air for 15 min in laminar flow clean bench.

10. Cell suspensions from mid-log-phase cultures (3 μL) is inoculated at the cross point.

11. Leave the plate dried in air for 15 min in laminar flow clean bench.

12. Leave the plate incubated at 37°C. During the period of time, take pictures of the colony.

Osicllation timer

Medium: Luria–Bertani (LB) medium [4]

Luria–Bertani (LB) medium/100 mL
Ingredients	Quantities
Yeast Extract		0.25 g
Bacto Tryptone		0.5 g
NaCl		0.5 g
Glycerol 1		0.5 g
0.1 M HEPES 2		3-4 mL
NaOH 3		Until pH 8.0

Note :

1. Glycerol is used as the carbon source.

2. 3-4 mL 0.1 M HEPES is added after rich defined medium is utilized, serving for minimizing the effects of pH.

3. NaOH is added until PH of the medium reaches 8.0.

Experiments

1. Pour 10 mL of the medium above containing 0.25% agar (Difco, Bacto agar) into a Petridish to prepare semi-solid medium.

2. Leave the plate air-dried for 90 min in laminar flow clean bench at room temperature.

3. Spot medium culture in half thickness in the centern of the plate.

4. Cultivate at 37°C.

Aptamer key-lock

PCR System

Template	1 μL
Forward Primer	1 μL
Reverse Primer	1 μL
dNTP Mixture	4 μL
10×PCR Buffer	5 μL
rTaq (TakaRa)	1 μL
ddH2O	37 μL
Total Volume	50 μL

The source and formation of the idea

Designation	Sequence
theophylline Aptamer1	GGU GAU ACC AGC AUC GUC UUG AUG CCCUUG GCA GCA CC
theophylline Aptamer_RBS_AUG1	GGU GAU ACC AGC AUC GUC UUG AUG CC CUU GGC AGC ACC CC G CUG CAA GAC AAC AAG AUG
crRNA	CGU CUU GAU UCC UUC UUU
RBS	AGG AGG AAA
taRNA	GCA GAA CUA AGG AAG AAA

Sequence

Designation	Sequence( 5’-3’)	Length
Lock Templates	TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACGAATTT CTTTCTTCCTTAG TTCTGCCTAAGGAGGAAA	91 bp
Forward Primer	GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCCCTATCAGTGA	50 bp
Reverse primer	GTTTCTTCCTGCAGCGGCCGCTACTAGTATTTCCTCCTTAGGCAGAACT	49 bp
Aptamer key Templates	TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACGAATTTCGGTGAT ACCAGCATCGTCTTGATGCCCTTGGCAGCACCCTGCGTAAAGAAGGAATCAAGACG	123 bp
Forward primer	GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCCCTATCAGTGATAGAGATTGA	53 bp
Reverse primer	GTTTCTTCCTGCAGCGGCCGCTACTAGTACGTCTTGATTCCTTCTTTACGCA	52 bp
New RBS Templates	TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACTAC TAGAGAGGAGGAAA	71 bp
Forward primer	GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCCCTATCAGTGA	50 bp
Reverse primer	GTTTCTTCCTGCAGCGGCCGCTACTAGTATTTCCTCCTCTCTAGTAGTG	49 bp

PCR Conditions

Lock

1	94°C	5 min
2	94°C	30 s	30 loops
3	55°C	30 s
4	72°C	30 s
5	72°C	10 min
6	15°C	5 min

Aptamer Key

1	94°C	5 min
2	94°C	30 s	30 loops
3	52°C	30 s
4	72°C	30 s
5	72°C	10 min
6	15°C	5 min

New RBS

1	94°C	5 min
2	94°C	30 s	30 loops
3	55°C	30 s
4	72°C	30 s
5	72°C	10 min
6	15°C	5 min

References

[1]Adler J. A method for measuring chemotaxis and use of the method to determine optimum conditions for chemotaxis by Escherichia coli[J]. Journal of General Microbiology, 1973, 74(1): 77-91.

[2] S T, JP. G. Guiding bacteria with small molecules and RNA[J]. Journal of the American Chemical Society, 2007, (21):6807-6811.

[3] Kawaji, H., T. Mizuno, and S. Mizushima. "Influence of molecular size and osmolarity of sugars and dextrans on the synthesis of outer membrane proteins O-8 and O-9 of Escherichia coli K-12." Journal of bacteriology 140.3 (1979): 843-847.

[4] Liu C, Fu X, Liu L, et al. Sequential establishment of stripe patterns in an expanding cell population[J]. Science, 2011, 334(6053): 238-241.

[5] Topp S, Gallivan J P. Guiding bacteria with small molecules and RNA[J]. Journal of the American Chemical Society, 2007, 129(21): 6807-6811.

Team:XMU-China/Notebook Protocol

From 2014.igem.org

Latest revision as of 03:40, 18 October 2014

Protocol

Lab notes

Calendar

@@ Line 57: / Line 57: @@
 			}
 			#nav_bar_full_01{left: 70px;top:47px;}
-			#nav_bar_full_02{left: 210px;top:47px;}
+			#nav_bar_full_02{left: 210px;top:47px;letter-spacing:-2px;}
 			#nav_bar_full_03{left: 360px;top:47px;}
 			#nav_bar_full_04{left: 525px;top:47px;}
@@ Line 206: / Line 206: @@
 				margin-top:70px;
 			}
-			#side_bar ul{list-style: none;border-color:#135996;border-width:2px}
+			#side_bar ul{list-style: none;border-color:#135996;border-width:5px}
 			#side_bar a{
 				text-decoration:none;
@@ Line 244: / Line 244: @@
 				position:absolute;
 				width:160px;
-				top: 160px;
+				top: 52px;
 			}
 /*Protocol*/
 			.Notebook_title{position:absolute;width:300px;}
-			#Notebook_Protocol{position:relative;top:230px;width:1000px;margin-left:-400px;left:43%;}
+			#Notebook_Protocol{position:relative;top:230px;width:1000px;margin-left:-500px;left:50%;}
 			#Notebook_Protocol_wd{
 background:rgba(0, 0, 0, 0.7) none repeat scroll 0 0 !important;/*FF*/
@@ Line 255: / Line 255: @@
 padding-left: 30px;
 padding-right: 30px;
+line-height:1.5;
 				position:relative;
 				top:150px;
@@ Line 335: / Line 336: @@
 					var sidebar_sub_hover_display = side_bar_hover_target.children(".sidebar_sub").css("display");
 					if(sidebar_sub_hover_display = "none"){
-						side_bar_hover_target.animate({width:"275px"},200);
+						side_bar_hover_target.stop().animate({width:"275px"},200);
-						side_bar_hover_target.children(".sidebar_sub").slideDown("normal");
 					};
 					$(".sidebar_main").mouseleave(function(){
@@ Line 342: / Line 342: @@
 						var sidebar_sub_hoveroff_display = side_bar_hoveroff_target.children(".sidebar_sub").css("display");
 						if(sidebar_sub_hover_display = "block"){
-							side_bar_hover_target.children(".sidebar_sub").slideUp(100);
+							side_bar_hover_target.stop().animate({width:"155px"},100);
-							side_bar_hover_target.animate({width:"155px"},100);
 						};
 					});
@@ Line 350: / Line 349: @@
 				$(".navbar_main").mouseenter(function(){
 					var nav_bar_hover_target = $(this);
-					nav_bar_hover_target.children(".navbar_sub").slideDown();
+					nav_bar_hover_target.children(".navbar_sub").stop().slideDown();
 					$(".navbar_main").mouseleave(function(){
 						var nav_bar_hoveroff_target = $(this);
-						nav_bar_hoveroff_target.children(".navbar_sub").slideUp();
+						nav_bar_hoveroff_target.children(".navbar_sub").stop().slideUp();
 					});
 				});
@@ Line 362: / Line 361: @@
 	<body style="font-family:Arial;color:#8ccFFF">
 <div id="background" style="position:fixed;z-index:-1;width:100%;height:100%;top:0px;left:0px;">
-		<img src="https://static.igem.org/mediawiki/2014/d/d1/XMU-Project-background.jpg" width="100%" height="100%"/>
+		<img src="https://static.igem.org/mediawiki/2014/a/a6/Xmu_background_veir.jpg" width="100%" height="100%"/>
 	</div>
 <div id="warp_navbar_main">
 		<div id="warp_navbar">
 			<div id="nav_bar_frame" >
-				<img class="navbar_frame" id="navbar_frame_left" src="https://static.igem.org/mediawiki/2014/c/c9/Xmu_navbar_left.png" />
+				<img class="navbar_frame" id="navbar_frame_left" src="https://static.igem.org/mediawiki/2014/c/cf/Xmu_navbar_left04.png" />
-				<img class="navbar_frame" id="navbar_frame_right" src="https://static.igem.org/mediawiki/2014/b/b5/Xmu_navbar_right.png" />
+				<img class="navbar_frame" id="navbar_frame_right" src="https://static.igem.org/mediawiki/2014/8/88/Xmu_navbar_right02.png" />
 			</div>
 			<div id="nav_bar">
 				<ul id="nav_bar_main">
 					<li id="navbar_main_01" class="navbar_main">
-						<a href="#"><span class="nav_bar" id="nav_bar_01"> </span></a>
+						<a href="https://2014.igem.org/Team:XMU-China/Project_Background"><span class="nav_bar" id="nav_bar_01"> </span></a>
-						<a href="#" class="nav_bar_full" id="nav_bar_full_01">Project</a>
+						<a href="https://2014.igem.org/Team:XMU-China/Project_Background" class="nav_bar_full" id="nav_bar_full_01">Project</a>
 						<ul class="navbar_sub">
 							<img class="navbar_sub_x" id="navbar_sub_x_01" src="https://static.igem.org/mediawiki/2014/4/4e/Xmu_navbar_sub_01.png" />
@@ Line 387: / Line 386: @@
 					</li>
 					<li id="navbar_main_02" class="navbar_main">
-						<a href="#"><span class="nav_bar" id="nav_bar_02"> </span></a>
+						<a href="https://2014.igem.org/Team:XMU-China/Notebook_Protocol"><span class="nav_bar" id="nav_bar_02"> </span></a>
-						<a href="#" class="nav_bar_full" id="nav_bar_full_02" style="letter-spacing:-2px;">Notebook</a>
+						<a href="https://2014.igem.org/Team:XMU-China/Notebook_Protocol" class="nav_bar_full" id="nav_bar_full_02">Notebook</a>
 						<ul class="navbar_sub">
 							<img class="navbar_sub_x" id="navbar_sub_x_02" src="https://static.igem.org/mediawiki/2014/e/e0/Xmu_navbar_sub_02.png" />
@@ Line 397: / Line 396: @@
 					</li>
 					<li id="navbar_main_03" class="navbar_main">
-						<a href="#"><span class="nav_bar" id="nav_bar_03"> </span></a>
+						<a href="https://2014.igem.org/Team:XMU-China/Judging_Parts"><span class="nav_bar" id="nav_bar_03"> </span></a>
-						<a href="#" class="nav_bar_full" id="nav_bar_full_03">Judging</a>
+						<a href="https://2014.igem.org/Team:XMU-China/Judging_Parts" class="nav_bar_full" id="nav_bar_full_03">Judging</a>
 						<ul class="navbar_sub">
 							<img class="navbar_sub_x" id="navbar_sub_x_03" src="https://static.igem.org/mediawiki/2014/7/7a/Xmu_navbar_sub_03.png" />
@@ Line 406: / Line 405: @@
 					</li>
 					<li id="navbar_main_04" class="navbar_main">
-						<a href="#"><span class="nav_bar" id="nav_bar_04"> </span></a>
+						<a href="https://2014.igem.org/Team:XMU-China/Team_Members"><span class="nav_bar" id="nav_bar_04"> </span></a>
-						<a href="#" class="nav_bar_full" id="nav_bar_full_04">Team</a>
+						<a href="https://2014.igem.org/Team:XMU-China/Team_Members" class="nav_bar_full" id="nav_bar_full_04">Team</a>
 						<ul class="navbar_sub">
 							<img class="navbar_sub_x" id="navbar_sub_x_04" src="https://static.igem.org/mediawiki/2014/1/1f/Xmu_navbar_sub_04.png" />
@@ Line 415: / Line 414: @@
 					</li>
 					<li id="navbar_main_05" class="navbar_main">
-						<a href="#"><span class="nav_bar" id="nav_bar_05"> </span></a>
+						<a href="https://2014.igem.org/Team:XMU-China/PP_Overview"><span class="nav_bar" id="nav_bar_05"> </span></a>
-						<a href="#" class="nav_bar_full" id="nav_bar_full_05">P&amp;P</a>
+						<a href="https://2014.igem.org/Team:XMU-China/PP_Overview" class="nav_bar_full" id="nav_bar_full_05">P&amp;P</a>
 						<ul class="navbar_sub">
 							<img class="navbar_sub_x" id="navbar_sub_x_05" src="https://static.igem.org/mediawiki/2014/d/de/Xmu_navbar_sub_05.png" />
@@ Line 428: / Line 427: @@
 					</li>
 					<li id="navbar_main_06" class="navbar_main">
-						<a href="#"><span class="nav_bar" id="nav_bar_06"> </span></a>
+						<a href="https://2014.igem.org/Team:XMU-China/Safety"><span class="nav_bar" id="nav_bar_06"> </span></a>
-						<a href="#" class="nav_bar_full" id="nav_bar_full_06">Safety</a>
+						<a href="https://2014.igem.org/Team:XMU-China/Safety" class="nav_bar_full" id="nav_bar_full_06">Safety</a>
 					</li>
 				</ul>
@@ Line 435: / Line 434: @@
 		</div>
 </div>
-		<div id="side_bar">
-			<ul id="side_bar_main_1">
-				<li class="sidebar_main" id="side_bar_judging">
-					<h3><a href="https://2014.igem.org/Team:XMU-China/Notebook_Protocol">Protocol</a></h3>
-				</li>
-			</ul>
-			<img id="side_bar_img_x" src="https://static.igem.org/mediawiki/2014/2/24/Xmu_sidebar_x.png" />
-			<ul id="side_bar_main_2">
-				<li class="sidebar_main">
-					<h3><a href="https://2014.igem.org/Team:XMU-China/Notebook_Labnotes">Lab notes</a></h3>
-				</li>
-				<li class="sidebar_main" id="side_bar_safety">
-					<h3><a href="https://2014.igem.org/Team:XMU-China/Notebook_Calendar">Calendar</a></h3>
-				</li>
-			</ul>
-		</div>
 			<!--Protocol-->
 			<div id="Notebook_Protocol">
-				<img id="Notebook_Protocol_title" class="Notebook_title" src="https://static.igem.org/mediawiki/2014/0/0f/Xmu_project_background_zwei.png"/>
+				<img id="Notebook_Protocol_title" class="Notebook_title" src="https://static.igem.org/mediawiki/2014/2/26/Xmu_notebook_protocol_zwei.png"/>
 				<div id="Notebook_Protocol_wd">
-<p style="text-align: center; font-family: Times New Roman; font-size: 21px;">
+<p style="font-family:Arial;font-size:29px;text-align:center;">
-     <span style="font-family: Times New Roman; font-size: 21px; font-weight: 700;">Protocols</span>
+    <span style="font-family:Arial;font-weight:700;font-size:29px;">Protocols</span>
+</p>
+<p style="font-family:Arial;font-size:21px;">
+     <span style="font-family:Arial;font-weight:700;font-size:21px;">General Considerations</span>
+</p>
+<p >
+    <span style="font-family:Arial;font-weight:700;font-style:italic;color:#fff;font-size:16px;">E. coli</span><span style="font-family:Arial;font-weight:700;color:#fff;font-size:16px;"> </span><span style="font-family:Arial;font-weight:700;color:#fff;font-size:16px;">S</span><span style="font-family:Arial;font-weight:700;color:#fff;font-size:16px;">train</span><span style="font-family:Arial;font-weight:700;color:#fff;font-size:16px;">s</span>
+</p>
+<p >
+    <span style="font-family:Arial;font-weight:700;font-style:italic;color:#fff;font-size:16px;">E. coli</span><span style="font-family:Arial;color:#fff;font-size:16px;"> strain DH5</span><span style="font-family:Arial;color:#fff;font-size:16px;">α</span><span style="font-family:Arial;color:#fff;font-size:16px;">, was offered by </span><span style="font-family:Arial;color:#fff;font-size:16px;">XMU-China iGEM 2013.</span>
+</p>
+<p >
+    <span style="font-family:Arial;font-weight:700;font-style:italic;color:#fff;font-size:16px;">E. coli</span><span style="font-family:Arial;color:#fff;font-size:16px;"> strain </span><span style="font-family:Arial;color:#fff;font-size:16px;">CL-1</span><span style="font-family:Arial;color:#fff;font-size:16px;">, </span><span style="font-family:Arial;color:#fff;font-size:16px;">whose gene of</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> cheZ</span><span style="font-family:Arial;color:#fff;font-size:16px;"> had been knocked out, </span><span style="font-family:Arial;color:#fff;font-size:16px;">was offered generously by </span><span style="font-family:Arial;color:#fff;font-size:16px;">iGEMer </span><span style="font-family:Arial;color:#fff;font-size:16px;">JianDong Huang and Lizhong Liu, from Department of Biochemistry, </span><span style="font-family:Arial;color:#fff;font-size:16px;">The University of Hong Kong.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 18px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Times New Roman;font-size:21px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 18px; font-weight: 700;">Cell Culture</span>
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p >
-     <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">Antibiotic</span>
+     <span style="font-family:Arial;font-weight:700;font-size:16px;">Antibiotic</span>
 </p>
-<table style="border: currentColor; border-image: none; width: 551px; font-size: 16px; margin-right: auto; margin-left: auto; border-collapse: collapse; styleName: Normal Table; border-insideH: 1px solid #000000; border-insideV: 1px solid #000000; cellpadding: 0px 7px 0px 7px;">
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;">
      <tbody>
-         <tr class="firstRow" style="height: 18px;">
+         <tr style="height:18px;" class="firstRow">
-             <td style="border-width: 1px; border-style: solid solid solid none; border-color: rgb(0, 0, 0); padding: 0px 7px; width: 113px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">Antibiotic</span>
+                     <span style="font-family:Arial;">Antibiotic</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 150px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                    <span style="font-family: Times New Roman; font-size: 13px;">Stock conc(mg/ml)</span>
+                    <span style="font-family:Arial;">Stock </span><span style="font-family:Arial;">Concentration</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">(mg/mL</span><span style="font-family:Arial;">)</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 150px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                    <span style="font-family: Times New Roman; font-size: 13px;">Final conc(ug/ml)</span>
+                    <span style="font-family:Arial;">Final </span><span style="font-family:Arial;">Concentration</span><span style="font-family:Arial;"> (μ</span><span style="font-family:Arial;">g/mL</span><span style="font-family:Arial;">)</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 138px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">Solvent</span>
+                     <span style="font-family:Arial;">Solvent</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 18px;">
+         <tr style="height:18px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 113px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">Chloramphenicol</span>
+                     <span style="font-family:Arial;">Chloramphenicol</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 150px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">50</span>
+                     <span style="font-family:Arial;">50</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 150px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">50</span>
+                     <span style="font-family:Arial;">50</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 138px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">Absolute ethyl alcohol</span>
+                     <span style="font-family:Arial;">Absolute ethyl alcohol</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 18px;">
+         <tr style="height:18px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 113px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">Ampicillin</span>
+                     <span style="font-family:Arial;">Ampicillin</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 150px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">50</span>
+                     <span style="font-family:Arial;">50</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 150px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">100</span>
+                     <span style="font-family:Arial;">100</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 138px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">ddH2O</span>
+                     <span style="font-family:Arial;">ddH2O</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 18px;">
+         <tr style="height:18px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 113px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">Kanamycin</span>
+                     <span style="font-family:Arial;">Kanamycin</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 150px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">50</span>
+                     <span style="font-family:Arial;">50</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 150px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">50</span>
+                     <span style="font-family:Arial;">50</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 138px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">ddH2O</span>
+                     <span style="font-family:Arial;">ddH2O</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 15px;">
+         <tr style="height:15px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 113px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">Tetracycline</span>
+                     <span style="font-family:Arial;">Tetracycline</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 150px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">50</span>
+                     <span style="font-family:Arial;">50</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 150px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">50</span>
+                     <span style="font-family:Arial;">50</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 138px; vertical-align: top;">
+             <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman; font-size: 13px;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-size: 13px;">Absolute ethyl alcohol</span>
+                     <span style="font-family:Arial;">Absolute ethyl alcohol</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 0px;">
+         <tr style="height:0;">
-             <td style="border: currentColor; border-image: none; width: 113px;"></td>
+             <td style="width:134px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 150px;"></td>
+             <td style="width:155px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 150px;"></td>
+             <td style="width:152px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 138px;"></td>
+             <td style="width:112px;border:none;"></td>
          </tr>
      </tbody>
 </table>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">All the antibiotics above require filtration to sterilizate.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >All the antibiotics above require filtration to </span><span >sterilize</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Stock in -20°C</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Stock in -20°C</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p style="font-family:Times New Roman;font-size:16px;">
-     &nbsp;
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p >
-    <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">LB Medium</span>
+    <span style="font-family:Arial;font-weight:700;font-size:16px;">LB </span><span style="font-family:Arial;font-weight:700;font-size:16px;">Liquid </span><span style="font-family:Arial;font-weight:700;font-size:16px;">Medium</span>
 </p>
-<table style="border: currentColor; border-image: none; font-size: 16px; margin-right: auto; margin-left: auto; border-collapse: collapse; styleName: Normal Table; border-insideH: 1px solid #000000; border-insideV: 1px solid #000000; cellpadding: 0px 7px 0px 7px;">
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;">
      <tbody>
          <tr class="firstRow">
-             <td style="border-width: 1px; border-style: solid solid solid none; border-color: rgb(0, 0, 0); padding: 0px 7px; width: 184px; vertical-align: middle;">
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial;text-align:center;">
-                    &nbsp;
+                    <span style="font-family:Arial;">Ingredients</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 184px; vertical-align: middle;">
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial;text-align:center;">
-                    <span style="font-family: Times New Roman;">Mass</span>
+                    <span style="font-family:Arial;">Percent</span><span style="font-family:Arial;"> (g/mL)</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 184px; vertical-align: middle;">
+        </tr>
-                 <p style="text-align: center; font-family: Times New Roman;">
+        <tr>
-                     <span style="font-family: Times New Roman;">M/L</span>
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;text-align:center;">
+                    <span style="font-family:Arial;">Yeast Extract</span>
+                </p>
+            </td>
+            <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                 <p style="font-family:Arial;text-align:center;">
+                     <span style="font-family:Arial;">0.5%</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 184px; vertical-align: middle;">
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman;">Yeast Extrac</span>
+                     <span style="font-family:Arial;">Tryptone</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 184px; vertical-align: middle;">
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman;">5g/L</span>
+                     <span style="font-family:Arial;">1%</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 184px; vertical-align: middle;">
+        </tr>
-                 <p style="text-align: center; font-family: Times New Roman;">
+        <tr>
-                     <span style="font-family: Times New Roman;">0.5%</span>
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;text-align:center;">
+                    <span style="font-family:Arial;">NaCl</span>
+                </p>
+            </td>
+            <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;text-align:center;">
+                    <span style="font-family:Arial;">1%</span>
+                </p>
+            </td>
+        </tr>
+        <tr style="height:0;">
+            <td style="width:184px;border:none;"></td>
+            <td style="width:184px;border:none;"></td>
+        </tr>
+    </tbody>
+</table>
+<p style="font-family:Arial;font-size:16px;text-align:left;">
+    <br/>
+</p>
+<p style="font-family:Arial;font-size:16px;text-align:left;">
+    <span style="font-family:Arial;font-weight:700;font-size:16px;">LB Solid Medium </span>
+</p>
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;">
+    <tbody>
+        <tr class="firstRow">
+            <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                 <p style="font-family:Arial;text-align:center;">
+                    <span style="font-family:Arial;">Ingredients</span>
+                </p>
+            </td>
+            <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;text-align:center;">
+                     <span style="font-family:Arial;">Percent (g/mL)</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 184px; vertical-align: middle;">
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman;">Tryptone</span>
+                     <span style="font-family:Arial;">Yeast Extract</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 184px; vertical-align: middle;">
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman;">10g/L</span>
+                     <span style="font-family:Arial;">0.5%</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 184px; vertical-align: middle;">
+        </tr>
-                 <p style="text-align: center; font-family: Times New Roman;">
+        <tr>
-                     <span style="font-family: Times New Roman;">1%</span>
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;text-align:center;">
+                    <span style="font-family:Arial;">Tryptone</span>
+                </p>
+            </td>
+            <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                 <p style="font-family:Arial;text-align:center;">
+                     <span style="font-family:Arial;">1%</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 184px; vertical-align: middle;">
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman;">NaCl</span>
+                     <span style="font-family:Arial;">NaCl</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 184px; vertical-align: middle;">
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman;">10g/L</span>
+                    <span style="font-family:Arial;">1%</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                 <p style="font-family:Arial;text-align:center;">
+                     <span style="font-family:Arial;">Agar</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 184px; vertical-align: middle;">
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman;">1%</span>
+                     <span style="font-family:Arial;">1.5%</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 0px;">
+         <tr style="height:0;">
-             <td style="border: currentColor; border-image: none; width: 184px;"></td>
+             <td style="width:184px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 184px;"></td>
+             <td style="width:184px;border:none;"></td>
-            <td style="border: currentColor; border-image: none; width: 184px;"></td>
          </tr>
      </tbody>
 </table>
-<p style="text-align: left; font-family: Times New Roman; font-size: 16px;">
+<p style="font-family:Arial;">
-     &nbsp;
+     <br/>
 </p>
-<p style="text-align: left; font-family: Times New Roman; font-size: 16px;">
+<p style="font-family:Arial;font-size:16px;text-align:left;">
-     <span style="font-family: Times New Roman; font-size: 16px;">LB Solid Medium (on the basis of the liquid media)</span>
+     <span style="font-family:Arial;font-weight:700;font-size:16px;">LB Semi-Solid Medium</span>
 </p>
-<table style="border: currentColor; border-image: none; font-size: 16px; margin-right: auto; margin-left: auto; border-collapse: collapse; styleName: Normal Table; border-insideH: 1px solid #000000; border-insideV: 1px solid #000000; cellpadding: 0px 7px 0px 7px;">
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;">
      <tbody>
          <tr class="firstRow">
-             <td style="border-width: 1px; border-style: solid solid solid none; border-color: rgb(0, 0, 0); padding: 0px 7px; width: 184px; vertical-align: middle;">
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman;">Agar</span>
+                     <span style="font-family:Arial;">Ingredients</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 184px; vertical-align: middle;">
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman;">15g/L</span>
+                     <span style="font-family:Arial;">Percent (g/mL)</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 184px; vertical-align: middle;">
+        </tr>
-                 <p style="text-align: center; font-family: Times New Roman;">
+        <tr>
-                     <span style="font-family: Times New Roman;">1.5%</span>
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;text-align:center;">
+                    <span style="font-family:Arial;">Yeast Extract</span>
+                </p>
+            </td>
+            <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                 <p style="font-family:Arial;text-align:center;">
+                     <span style="font-family:Arial;">0.5%</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 0px;">
+         <tr>
-            <td style="border: currentColor; border-image: none; width: 184px;"></td>
+            <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-             <td style="border: currentColor; border-image: none; width: 184px;"></td>
+                <p style="font-family:Arial;text-align:center;">
-            <td style="border: currentColor; border-image: none; width: 184px;"></td>
+                    <span style="font-family:Arial;">Tryptone</span>
+                </p>
+            </td>
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;text-align:center;">
+                    <span style="font-family:Arial;">1%</span>
+                </p>
+            </td>
          </tr>
-    </tbody>
+        <tr>
-</table>
+            <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-<p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;text-align:center;">
-    &nbsp;
+                     <span style="font-family:Arial;">NaCl</span>
-</p>
-<p style="text-align: left; font-family: Times New Roman; font-size: 16px;">
-    <span style="font-family: Times New Roman; font-size: 16px;">LB Semi-Solid Medium (on the basis of the liquid media)</span>
-</p>
-<table style="border: currentColor; border-image: none; font-size: 16px; margin-right: auto; margin-left: auto; border-collapse: collapse; styleName: Normal Table; border-insideH: 1px solid #000000; border-insideV: 1px solid #000000; cellpadding: 0px 7px 0px 7px;">
-    <tbody>
-        <tr class="firstRow">
-            <td style="border-width: 1px; border-style: solid solid solid none; border-color: rgb(0, 0, 0); padding: 0px 7px; width: 184px; vertical-align: middle;">
-                 <p style="text-align: center; font-family: Times New Roman;">
-                     <span style="font-family: Times New Roman;">Agar</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 184px; vertical-align: middle;">
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman;">15g/L</span>
+                    <span style="font-family:Arial;">1%</span>
+                 </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;text-align:center;">
+                     <span style="font-family:Arial;">Agar</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 184px; vertical-align: middle;">
+             <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman;">0.25%</span>
+                     <span style="font-family:Arial;">0.25%</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 0px;">
+         <tr style="height:0;">
-             <td style="border: currentColor; border-image: none; width: 184px;"></td>
+             <td style="width:184px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 184px;"></td>
+             <td style="width:184px;border:none;"></td>
-            <td style="border: currentColor; border-image: none; width: 184px;"></td>
          </tr>
      </tbody>
 </table>
-<p style="font-family: Times New Roman;">
+<p style="font-family:Times New Roman;">
-     &nbsp;
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p >
-    <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">M63 Medium</span>
+    <span style="font-family:Arial;font-weight:700;font-size:16px;">Preparation of </span><span style="font-family:Arial;font-weight:700;font-size:16px;">Competent Cell (</span><span >TaKaRa Competent Cell Preparation Kit</span><span >)</span>
 </p>
-<p style="font-family: Times New Roman;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     &nbsp;
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Activate the </span><span style="font-family:Arial;font-style:italic;font-size:16px;">E.</span><span style="font-family:Arial;font-style:italic;font-size:16px;"> </span><span style="font-family:Arial;font-style:italic;font-size:16px;">coli </span><span >strain on LB-plate from glycerol stock under the condition of 37°C for 12 hours.</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">Competent Cell</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Pre-culture </span><span >a single </span><span >colony in 5 mL LB </span><span >liquid </span><span >medium under the condition of 37°C, 200 rpm for 12 hours.</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Times New Roman; font-size: 16px;">TaKaRa Competent Cell Preparation Kit</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Add 200 μL</span><span > pre-culture </span><span >bacteria </span><span >into 20 mL LB liquid medium. Culture </span><span >under the condition of 37°C, 200 rpm for 2 hours.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 16px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-size: 14px;">1.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Prification</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Place on ice for 30 min.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 14px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Activate the E.coli strain on LB-plate from glycerol stock under the condition of 37</span><span style="font-family: Times New Roman;">°C</span><span style="font-family: Times New Roman; font-size: 14px;"> for 12 hours.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Subpackage the 20 mL </span><span >culture medium</span><span > </span><span >into </span><span >1.5 mL </span><span >sterile </span><span >centrifuge tube</span><span >, each centrifuge tube containing 1 mL. </span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 14px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Pre-culture single-colony in 5 mL LB medium under the condition of 37</span><span style="font-family: Times New Roman;">°C</span><span style="font-family: Times New Roman; font-size: 14px;">, 200 rpm for 12 hours.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >C</span><span >entrifuge</span><span > at 1500×g for 5 min at 4°C, then discard supernatant.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 16px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-size: 14px;">2.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Culture</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >R</span><span >e-suspend each </span><span >centrifuge tube </span><span >gently </span><span >with 100</span><span > </span><span >μL Solution A</span><span >,</span><span > </span><span >which has been </span><span >precooled in ice</span><span >. </span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 14px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Add 200 μl pre-culture into 20 mL LB medium under the condition of 37</span><span style="font-family: Times New Roman;">°C</span><span style="font-family: Times New Roman; font-size: 14px;">, 200 rpm for 2 hours.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Centrifuge at 1500×g for 5 min </span><span >at 4°C, then</span><span > discard supernatant.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 14px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Place on ice for 30 min.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Re-suspend each </span><span >centrifuge tube</span><span > </span><span >gently </span><span >with 100 μL Solution B</span><span >,</span><span > </span><span >which has been precooled in ice. </span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 16px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-size: 14px;">3.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Preparation</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Stock in -20°C</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 14px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:0em;">
-    <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Aliquot into sterile 1.5 mL</span><span style="font-family: Times New Roman;"> m</span><span style="font-family: Times New Roman; font-size: 14px;">icrotube and spin down at 1500</span><span style="font-family: Times New Roman;">×</span><span style="font-family: Times New Roman; font-size: 14px;">g for 5 min at 4</span><span style="font-family: Times New Roman;">°C</span><span style="font-family: Times New Roman; font-size: 14px;">, then discard supernatant.</span>
+    <br/>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 14px; margin-left: 28px; styleName: Normal;">
+<p >
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Gently re-suspend each pellet with 100μL ice cold Solution A. Centrifuge at 1500</span><span style="font-family: Times New Roman;">×</span><span style="font-family: Times New Roman; font-size: 14px;">g for 5 min and discard supernatant.</span>
+     <span style="font-family:Arial;font-weight:700;font-size:16px;">Transformation</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 14px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Re-suspend each pellet with 100 μL ice cold Solution B.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Add 1 μL </span><span >purified </span><span >plasmid or 10 μL ligation system into 100 μL fresh competent cells</span><span >, which is</span><span > </span><span >contained in 1.5 mL centrifuge tube. Then </span><span >mix gently.</span>
 </p>
-<p style="text-align: justify; text-indent: 0em; font-family: Times New Roman; font-size: 16px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     &nbsp;
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Leave on ice for 30 minutes.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 18px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 18px; font-weight: 700;">Transformation</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >H</span><span >eat shock at</span><span > 42°C</span><span > for 90 seconds.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Add 1 μL plasmid or 10 μL ligation system into 100 μL fresh competent cells and mix gently. Leave on ice for 30 minutes.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Leave on ice for 10 minutes immediately.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Heat shock tubes in 42°C water bath for 90 seconds, then place them on ice for 10 minutes immediately.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Add </span><span >400 μL fresh LB medium into the centrifuge tube</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Add 400 μL fresh LB medium into each tube.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Incubate for </span><span >2 hours</span><span > under the condition of 37°C, 200 rpm</span><span >. </span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:0em;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Incubate for 1~2 hourswith 200 rpm shaking at 37°C. When the antibiotic of vector is ampicillin, the time of incubate is 1 hr.</span>
+     <span >Note: If </span><span >the </span><span >resistance </span><span >of vector</span><span > </span><span >is ampicillin, </span><span >incubation</span><span > time</span><span > is </span><span >shortened to </span><span >1 h</span><span >ou</span><span >r.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Spread 100 μL on an LB solid medium plate containing the appropriate antibiotics and incubate overnight at 37°C</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Spread 100 μL culture medium on a</span><span > LB so</span><span >lid medium plate, which contains appropriate antibiotics.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 18px; margin-left: 0px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 18px; font-weight: 700;">Confirmation</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >I</span><span >ncubate overnight at 37°C</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p style="font-family:Times New Roman;font-size:16px;">
-     <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">Plasmid Extraction</span>
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;">
-     <span style="font-family: Times New Roman; font-size: 16px;">Omega Plasmid Mini Kit</span>
+     <span style="font-family:Arial;font-weight:700;font-size:16px;">Confirmation</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Pellet bacterial cells from a 1.5-5 ml overnight culture.</span>
+     <span style="font-size:14px;">1.</span><span style="font-size:14px;">	</span><span >Plasmid Extraction</span><span > (</span><span >Omega Plasmid Mini Kit</span><span >)</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Resuspend cells in 250 μL Solution I/RNase A.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Add 1 mL overnight suspension culture into a 1.5 mL sterile centrifuge tube. Centrifuge at 10000 x g for 1 min, then discard supernatant.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Add 250 μL of Solution II. Mix gently by inverting 4-6 times to obtain cleared lysate. </span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Repeat the step above several times, until the amount of bacteria is appropriate.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Add 350 μL of Solution III and mix well to form white precipitate.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Re</span><span >-</span><span >suspend </span><span >cells gently with</span><span > 250 μL Solution I/RNase A.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Centrifuge at maximum speed of at least 10000 x g for 10 min.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Add 250 μL</span><span > Solution II</span><span > into each centrifuge tube</span><span >. Mix gently by inverting 4-6 times to obtain </span><span >cleared</span><span > lysate. </span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Transfer cleared lysate into a HiBind Mini Column placed in a 2 mL collection tube. Centrifuge for 1 min at maxi speed. Discard liquid.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Add 350 μL</span><span > Solution III </span><span >into each centrifuge tube. M</span><span >ix well to form </span><span >protein </span><span >precipitate.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Wash column with 500 μL Buffer HB. Centrifuge 1 min </span><span style="font-family: Times New Roman;">at </span><span style="font-family: Times New Roman; font-size: 16px;">maximal speed (≥ 13000 x g )</span><span style="font-family: Times New Roman;">. </span><span style="font-family: Times New Roman;">Discard liquid.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Centrifuge at </span><span >≥</span><span >13</span><span >000 x g for 10 min.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Using the same collection tube, wash column with 700μL DNA Wash Buffer diluted with ethanol. Centrifuge 1 min at </span><span style="font-family: Times New Roman; font-size: 16px;">maximal speed (≥ 13000 x g )</span><span style="font-family: Times New Roman;">.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Transfer cleared lysate into a </span><span >HiBind Mini Column</span><span > placed in a 2 mL collection tube. </span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Wash HiBind Mini Column a second time with an additional 700 μL of DNA Wash Buffer.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Centrifuge at 10000 x g for 1 min</span><span >. Discard liquid.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Centrifuge empty HiBind Mini Column for 2 min at at </span><span style="font-family: Times New Roman; font-size: 16px;">maximal speed (≥ 13000 x g )</span><span style="font-family: Times New Roman;"> to dry.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Wash </span><span >the </span><span >HiBind Mini Column</span><span > with 500 μL </span><span >HB </span><span >Buffer</span><span >.</span><span > </span><span >Centrifuge at 10000 x g for 1 min. Discard liquid.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Elute plasmid DNA with 30 μL sterile water.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Using the same collection tube, wash </span><span >the HiBind Mini Column</span><span > with 700</span><span > </span><span >Μl </span><span >DNA Wash Buffer</span><span >, which is</span><span > diluted with ethanol.</span><span > Centrifuge at 10000 x g for 1 min. Discard liquid.</span>
 </p>
-<p style="text-align: justify; text-indent: 0em; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     &nbsp;
+    <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Wash </span><span >the </span><span >HiBind Mini Column a second t</span><span >ime with an additional 700 μL </span><span >DNA Wash Buffer.</span><span > Centrifuge at 10000 x g for 1 min. Discard liquid.</span>
+</p>
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
+    <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Centrifuge </span><span >the </span><span >empty HiBind Mini Column at</span><span > ≥ 13000 x g for 2 min</span><span > to </span><span >spin-dry</span><span >.</span>
+</p>
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
+    <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Place the HiBind Mini Column into a sterile</span><span > 1.5 mL</span><span > centrifuge tube. </span>
+</p>
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
+    <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Add 30 μL sterile ultrapure water directly into the HiBind Mini Column. Sit at room temperature for 2 minutes. Centrifuge at maximum speed (≥ 13000 x g) for 1 min to elute DNA.</span>
+</p>
+<p style="font-family:Times New Roman;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:0em;">
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p style="font-family:Arial,微软雅黑;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">Digestion for Confirmation</span>
+     <span style="font-size:14px;">2.</span><span style="font-size:14px;">	</span><span style="font-family:Arial,微软雅黑;font-size:16px;">Digestion for Confirmation</span>
 </p>
-<p style="text-align: justify; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+<p style="font-family:Arial,微软雅黑;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;">
-     <span style="font-family: Times New Roman;">Reaction condition: 37°C for 2 hours.</span>
+     <span style="font-family:Arial,微软雅黑;font-size:16px;">Reaction condition: 37°C for 2 hours.</span>
 </p>
-<table style="border: currentColor; border-image: none; width: 579px; font-size: 16px; margin-right: auto; margin-left: auto; border-collapse: collapse; styleName: Normal Table; border-insideH: 1px solid #000000; border-insideV: 1px solid #000000; cellpadding: 0px 7px 0px 7px;">
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;width:579px;border-collapse:collapse;border:none;">
      <tbody>
-         <tr class="firstRow" style="height: 27px;">
+         <tr style="height:27px;" class="firstRow">
-             <td style="border-width: 1px; border-style: solid solid solid none; border-color: rgb(0, 0, 0); padding: 0px 7px; width: 279px; vertical-align: top;" colspan="2">
+             <td colspan="2" style="width:279px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                     <span style="font-family: Times New Roman;">Single Digestion</span>
+                     <span style="font-family:Arial,微软雅黑;">Single Digestion</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 20px; vertical-align: top;" rowspan="7">
+             <td rowspan="7" style="width:20px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                     &nbsp;
+                     <br/>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 280px; vertical-align: top;" colspan="2">
+             <td colspan="2" style="width:280px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                     <span style="font-family: Times New Roman;">Double Digestion</span>
+                     <span style="font-family:Arial,微软雅黑;">Double Digestion</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 29px;">
+         <tr style="height:29px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                     <span style="font-family: Times New Roman;">Plasmid</span>
+                     <span style="font-family:Arial,微软雅黑;">Plasmid</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                    <span style="font-family: Times New Roman;">5μL</span>
+                    <span style="font-family:Arial,微软雅黑;">5</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                     <span style="font-family: Times New Roman;">Plasmid</span>
+                     <span style="font-family:Arial,微软雅黑;">Plasmid</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                    <span style="font-family: Times New Roman;">5μL</span>
+                    <span style="font-family:Arial,微软雅黑;">5</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 27px;">
+         <tr style="height:27px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                     <span style="font-family: Times New Roman; font-style: italic;">Eco</span><span style="font-family: Times New Roman;">R I</span>
+                     <span style="font-family:Arial,微软雅黑;font-style:italic;">Eco</span><span style="font-family:Arial,微软雅黑;">R I</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                    <span style="font-family: Times New Roman;">1μL</span>
+                    <span style="font-family:Arial,微软雅黑;">0.5 </span><span style="font-family:Arial,微软雅黑;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                     <span style="font-family: Times New Roman; font-style: italic;">Xba </span><span style="font-family: Times New Roman;">I</span>
+                     <span style="font-family:Arial,微软雅黑;font-style:italic;">Xba </span><span style="font-family:Arial,微软雅黑;">I</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                    <span style="font-family: Times New Roman;">0.5μL</span>
+                    <span style="font-family:Arial,微软雅黑;">0.5</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 29px;">
+         <tr style="height:29px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                     &nbsp;
+                     <br/>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                     &nbsp;
+                     <br/>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                     <span style="font-family: Times New Roman; font-style: italic;">Pst</span><span style="font-family: Times New Roman;"> I</span>
+                     <span style="font-family:Arial,微软雅黑;font-style:italic;">Pst</span><span style="font-family:Arial,微软雅黑;"> I</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                    <span style="font-family: Times New Roman;">0.5μL</span>
+                    <span style="font-family:Arial,微软雅黑;">0.5</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 27px;">
+         <tr style="height:27px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                    <span style="font-family: Times New Roman;">10×H buffer</span>
+                    <span style="font-family:Arial,微软雅黑;">10×H B</span><span style="font-family:Arial,微软雅黑;">uffer</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                    <span style="font-family: Times New Roman;">1μL</span>
+                    <span style="font-family:Arial,微软雅黑;">1</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                    <span style="font-family: Times New Roman;">10×M buffer</span>
+                    <span style="font-family:Arial,微软雅黑;">10×M B</span><span style="font-family:Arial,微软雅黑;">uffer</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                    <span style="font-family: Times New Roman;">1μL</span>
+                    <span style="font-family:Arial,微软雅黑;">1</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 29px;">
+         <tr style="height:29px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                     <span style="font-family: Times New Roman;">ddH</span><span style="font-family: Times New Roman; valign: sub;">2</span><span style="font-family: Times New Roman;">O</span>
+                     <span style="font-family:Arial,微软雅黑;">ddH</span><span style="font-family:Arial,微软雅黑;valign:sub;">2</span><span style="font-family:Arial,微软雅黑;">O</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                    <span style="font-family: Times New Roman;">3μL</span>
+                    <span style="font-family:Arial,微软雅黑;">3</span><span style="font-family:Arial,微软雅黑;">.5 </span><span style="font-family:Arial,微软雅黑;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                     <span style="font-family: Times New Roman;">ddH</span><span style="font-family: Times New Roman; valign: sub;">2</span><span style="font-family: Times New Roman;">O</span>
+                     <span style="font-family:Arial,微软雅黑;">ddH</span><span style="font-family:Arial,微软雅黑;valign:sub;">2</span><span style="font-family:Arial,微软雅黑;">O</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                    <span style="font-family: Times New Roman;">3μL</span>
+                    <span style="font-family:Arial,微软雅黑;">3</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 27px;">
+         <tr style="height:27px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                     <span style="font-family: Times New Roman;">Total Volume</span>
+                     <span style="font-family:Arial,微软雅黑;">Total Volume</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                    <span style="font-family: Times New Roman;">10μL</span>
+                    <span style="font-family:Arial,微软雅黑;">10</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                     <span style="font-family: Times New Roman;">Total Volume</span>
+                     <span style="font-family:Arial,微软雅黑;">Total Volume</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial,微软雅黑;text-align:center;">
-                    <span style="font-family: Times New Roman;">10μL</span>
+                    <span style="font-family:Arial,微软雅黑;">10</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 0px;">
+         <tr style="height:0;">
-             <td style="border: currentColor; border-image: none; width: 140px;"></td>
+             <td style="width:140px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 140px;"></td>
+             <td style="width:140px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 20px;"></td>
+             <td style="width:20px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 140px;"></td>
+             <td style="width:140px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 140px;"></td>
+             <td style="width:140px;border:none;"></td>
          </tr>
      </tbody>
 </table>
-<p style="font-family: Times New Roman;">
+<p style="font-family:Times New Roman;font-size:16px;">
-     &nbsp;
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-    <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">DNA Agarose Gels</span><span style="font-family: Times New Roman; font-weight: 700;"> (</span><span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">take 20mL as example)</span>
+    <span style="font-size:14px;">3.</span><span style="font-size:14px;">	</span><span >DNA gel electrophoresis</span><span > (take 20</span><span > </span><span >mL as example)</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Times New Roman; font-size: 16px;">1.</span><span style="font-family: Times New Roman; font-size: 16px;"> &nbsp; &nbsp;Dilution</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Dilute </span><span >50×TAE to 1×TAE with ddH</span><span style="font-family:Arial;font-size:16px;valign:sub;">2</span><span >O.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Dilute stock of 50×TAE to 1×TAE with ddH2O.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Measure 20 mL</span><span > 1×TAE buffer.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Measure 20 ml of 1×TAE buffer.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Pour</span><span > 1×TAE buffer </span><span >in</span><span >to an e</span><span >rlenmeyer flask.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Transfer 1×TAE buffer to Erlenmeyer flask.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Weigh</span><span > 0.2g agarose to make 1% </span><span >DNA </span><span >gel.</span>
 </p>
-<p style="font-family: Times New Roman;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Times New Roman;">2. &nbsp;Melt</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Pour</span><span > agarose </span><span >in</span><span >to </span><span >the e</span><span >rlenmeyer flask.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Weigh out 0.2g agarose to make 1% gel.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Make</span><span > agarose </span><span >melt </span><span >by</span><span > microwave, lasting for</span><span > 105</span><span > seconds until melt</span><span > completely</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Transfer agarose to Erlenmeyer flask.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >C</span><span >ool </span><span >for 5 minutes</span><span >.</span><span > </span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Melt agarose in microwave, stirring 105 seconds until completely melted.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Assemble gel pouring apparatus by inserting gate into slots.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-size: 14px;">3.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">Cooling</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >P</span><span >our</span><span style="font-family:Arial;"> </span><span >agarose gel</span><span > into gel tray.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Allow gel to cool until Erlenmeyer flask can be handled comfortably.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Bring a piece of silver paper</span><span > on</span><span > the top of the </span><span >gel pouring apparatus</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Add 1:10 volume ratio (2</span><span style="font-family: Times New Roman;">μl</span><span style="font-family: Times New Roman;">) GelRed Nucleic acid dye to the gel and shake the Erlenmeyer flask to dye the gel well.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Wait for 30-</span><span >40 minutes to solidify the </span><span >DNA agarose g</span><span >el.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:0em;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman;">Pour agarose into gel tray, assemble gel pouring apparatus by inserting gate into slots.</span>
+     <br/>
 </p>
-<p style="text-align: justify; text-indent: 0em; font-family: Times New Roman; margin-left: 28px; styleName: Normal;">
+<p >
-    &nbsp;
+    <span style="font-family:Arial;font-weight:700;font-size:16px;">Ligation</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 18px; margin-left: 0px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 18px; font-weight: 700;">Ligation</span>
+     <span style="font-size:14px;">1.</span><span style="font-size:14px;">	</span><span >Digestion for</span><span > Ligation</span>
 </p>
-<p style="text-align: justify; text-indent: 0em; font-family: Times New Roman; font-size: 16px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:0em;">
-    <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">Digestion for</span><span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;"> Ligation</span>
+    <span >Reaction condition: 37°C for 2.5 hours.</span>
 </p>
-<table style="border: currentColor; border-image: none; width: 663px; font-size: 16px; margin-right: auto; margin-left: auto; border-collapse: collapse; styleName: Normal Table; border-insideH: 1px solid #000000; border-insideV: 1px solid #000000; cellpadding: 0px 7px 0px 7px;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:0em;">
+    <br/>
+</p>
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;width:586px;border-collapse:collapse;border:none;">
      <tbody>
-         <tr class="firstRow" style="height: 42px;">
+         <tr style="height:42px;" class="firstRow">
-             <td style="border-width: 1px; border-style: solid solid solid none; border-color: rgb(0, 0, 0); padding: 0px 7px; width: 326px; vertical-align: middle;" colspan="4">
+             <td colspan="4" style="width:293px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">Insert(A) + Vector(B)</span>
+                     <span style="font-family:Arial;">Insert(A) + Vector(B)</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 16px; vertical-align: middle;" rowspan="7">
+             <td colspan="4" style="width:293px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:32px;text-align:center;">
-                     &nbsp;
+                     <span style="font-family:Arial;">Vector (A) + Insert (B)</span>
                  </p>
-            </td>
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:32px;text-align:center;">
-            <td style="border-width: 1px 1px 1px medium; border-style: solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 321px; vertical-align: middle;" colspan="5">
+                     <br/>
-                <p style="text-align: center; text-indent: 32px; font-family: Times New Roman; styleName: Normal;">
-                     <span style="font-family: Times New Roman;">Vector (B) + Insert (A)</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 42px;">
+         <tr style="height:42px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 115px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">Insert(A)</span>
+                     <span style="font-family:Arial;">Insert(A)</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 48px; vertical-align: middle;">
+             <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">30μL</span>
+                    <span style="font-family:Arial;">30</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 104px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">Vector(B)</span>
+                     <span style="font-family:Arial;">Vector(B)</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 59px; vertical-align: middle;">
+             <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">30μL</span>
+                    <span style="font-family:Arial;">30</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 94px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 32px; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman;">Insert(A)</span>
+                     <span style="font-family:Arial;">Insert(B)</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 62px; vertical-align: middle;">
+             <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">30μL</span>
+                    <span style="font-family:Arial;">30</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 108px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">Vector(B)</span>
+                     <span style="font-family:Arial;">Vector(A)</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 55px; vertical-align: middle;">
+             <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">30μL</span>
+                    <span style="font-family:Arial;">30</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-            <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 55px; vertical-align: middle;"></td>
          </tr>
-         <tr style="height: 42px;">
+         <tr style="height:42px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 115px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman; font-style: italic;">Eco</span><span style="font-family: Times New Roman;">R I</span>
+                     <span style="font-family:Arial;font-style:italic;">Eco</span><span style="font-family:Arial;">R I</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 48px; vertical-align: middle;">
+             <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">3μL</span>
+                    <span style="font-family:Arial;">3</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 104px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman; font-style: italic;">Eco</span><span style="font-family: Times New Roman;">R I</span>
+                     <span style="font-family:Arial;font-style:italic;">Eco</span><span style="font-family:Arial;">R I</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 59px; vertical-align: middle;">
+             <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">4.5μL</span>
+                     <span style="font-family:Arial;">4.5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 94px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 32px; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-style: italic;">Xba</span><span style="font-family: Times New Roman;"> I</span>
+                     <span style="font-family:Arial;font-style:italic;">Xba</span><span style="font-family:Arial;"> I</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 62px; vertical-align: middle;">
+             <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">3μL</span>
+                    <span style="font-family:Arial;">3</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 108px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman; font-style: italic;">Spe</span><span style="font-family: Times New Roman;"> I</span>
+                     <span style="font-family:Arial;font-style:italic;">Spe</span><span style="font-family:Arial;"> I</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 55px; vertical-align: middle;">
+             <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">4.5μL</span>
+                     <span style="font-family:Arial;">4.5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-            <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 55px; vertical-align: middle;"></td>
          </tr>
-         <tr style="height: 42px;">
+         <tr style="height:42px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 115px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman; font-style: italic;">Spe</span><span style="font-family: Times New Roman;"> I</span>
+                     <span style="font-family:Arial;font-style:italic;">Spe</span><span style="font-family:Arial;"> I</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 48px; vertical-align: middle;">
+             <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">3μL</span>
+                    <span style="font-family:Arial;">3</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 104px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman; font-style: italic;">Xba</span><span style="font-family: Times New Roman;"> I</span>
+                     <span style="font-family:Arial;font-style:italic;">Xba</span><span style="font-family:Arial;"> I</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 59px; vertical-align: middle;">
+             <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">4.5μL</span>
+                     <span style="font-family:Arial;">4.5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 94px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 32px; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman; font-style: italic;">Pst</span><span style="font-family: Times New Roman;"> I</span>
+                     <span style="font-family:Arial;font-style:italic;">Pst</span><span style="font-family:Arial;"> I</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 62px; vertical-align: middle;">
+             <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">3μL</span>
+                    <span style="font-family:Arial;">3</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 108px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman; font-style: italic;">Pst</span><span style="font-family: Times New Roman;"> I</span>
+                     <span style="font-family:Arial;font-style:italic;">Pst</span><span style="font-family:Arial;"> I</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 55px; vertical-align: middle;">
+             <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">4.5μL</span>
+                     <span style="font-family:Arial;">4.5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-            <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 55px; vertical-align: middle;"></td>
          </tr>
-         <tr style="height: 42px;">
+         <tr style="height:42px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 115px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">10×H buffer</span>
+                     <span style="font-family:Arial;">10×H Buffer</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 48px; vertical-align: middle;">
+             <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">4μL</span>
+                    <span style="font-family:Arial;">4</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 104px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">10×M buffer</span>
+                     <span style="font-family:Arial;">10×M Buffer</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 59px; vertical-align: middle;">
+             <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">4μL</span>
+                    <span style="font-family:Arial;">4</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 94px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 32px; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">10×M buffer</span>
+                     <span style="font-family:Arial;">10×M Buffer</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 62px; vertical-align: middle;">
+             <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">4μL</span>
+                    <span style="font-family:Arial;">4</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 108px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">10×H buffer</span>
+                     <span style="font-family:Arial;">10×H Buffer</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 55px; vertical-align: middle;">
+             <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">4μL</span>
+                    <span style="font-family:Arial;">4</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-            <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 55px; vertical-align: middle;"></td>
          </tr>
-         <tr style="height: 42px;">
+         <tr style="height:42px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 115px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">ddH</span><span style="font-family: Times New Roman; valign: sub;">2</span><span style="font-family: Times New Roman;">O</span>
+                     <span style="font-family:Arial;">ddH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">O</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 48px; vertical-align: middle;">
+             <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">0μL</span>
+                    <span style="font-family:Arial;">0</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 104px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">ddH</span><span style="font-family: Times New Roman; valign: sub;">2</span><span style="font-family: Times New Roman;">O</span>
+                     <span style="font-family:Arial;">ddH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">O</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 59px; vertical-align: middle;">
+             <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">7μL</span>
+                    <span style="font-family:Arial;">7</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 94px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 32px; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman;">ddH</span><span style="font-family: Times New Roman; valign: sub;">2</span><span style="font-family: Times New Roman;">O</span>
+                     <span style="font-family:Arial;">ddH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">O</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 62px; vertical-align: middle;">
+             <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">0μL</span>
+                    <span style="font-family:Arial;">0</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 108px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">ddH</span><span style="font-family: Times New Roman; valign: sub;">2</span><span style="font-family: Times New Roman;">O</span>
+                     <span style="font-family:Arial;">ddH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">O</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 55px; vertical-align: middle;">
+             <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">7μL</span>
+                    <span style="font-family:Arial;">7</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-            <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 55px; vertical-align: middle;"></td>
          </tr>
-         <tr style="height: 42px;">
+         <tr style="height:42px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 115px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">Total Volume</span>
+                     <span style="font-family:Arial;">Total Volume</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 48px; vertical-align: middle;">
+             <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">40μL</span>
+                    <span style="font-family:Arial;">40</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 104px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">Total Volume</span>
+                     <span style="font-family:Arial;">Total Volume</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 59px; vertical-align: middle;">
+             <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">50μL</span>
+                    <span style="font-family:Arial;">50</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 94px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 32px; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">Total Volume</span>
+                     <span style="font-family:Arial;">Total Volume</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 62px; vertical-align: middle;">
+             <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">40μL</span>
+                    <span style="font-family:Arial;">40</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 108px; vertical-align: middle;">
+             <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">Total Volume</span>
+                     <span style="font-family:Arial;">Total Volume</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 55px; vertical-align: middle;">
+             <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">50μL</span>
+                    <span style="font-family:Arial;">50</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
-            <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 55px; vertical-align: middle;"></td>
          </tr>
-         <tr style="height: 0px;">
+         <tr style="height:0;">
-             <td style="border: currentColor; border-image: none; width: 115px;"></td>
+             <td style="width:85px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 48px;"></td>
+             <td style="width:57px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 104px;"></td>
+             <td style="width:85px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 59px;"></td>
+             <td style="width:66px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 16px;"></td>
+             <td style="width:85px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 94px;"></td>
+             <td style="width:57px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 62px;"></td>
+             <td style="width:85px;border:none;"></td>
-            <td style="border: currentColor; border-image: none; width: 108px;"></td>
+             <td style="width:66px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 55px;"></td>
-            <td style="border: currentColor; border-image: none; width: 2px;"></td>
          </tr>
      </tbody>
 </table>
-<p style="text-align: justify; text-indent: 0em; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Times New Roman;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:0em;">
-     &nbsp;
+     <br/>
 </p>
-<p style="text-align: justify; text-indent: 0em; font-family: Times New Roman; font-size: 16px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">Gel Extraction of DNA</span>
+     <span style="font-size:14px;">2.</span><span style="font-size:14px;">	</span><span >Gel Extraction of DNA</span><span > (</span><span >Omega Gel Extraction K</span><span >it</span><span >)</span>
 </p>
-<p style="text-align: justify; text-indent: 0em; font-family: Times New Roman; font-size: 16px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Times New Roman; font-size: 16px;">Omega Gel Extraction kit</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Perform</span><span > DNA gel electrophoresis</span><span > to fractionate DNA fragments.</span>
 </p>
-<p style="text-align: justify; text-indent: 0em; font-family: Times New Roman; font-size: 16px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Times New Roman; font-size: 16px;">1. Melt</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >When adequate separation of bands has occurred, exci</span><span >se the DNA fragments of interest carefully.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Perform agarose gel electrophoresis to fractionate DNA fragments.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Weigh in sterile 1.5 mL centrifuge tube</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">When adequate separation of bands has occurred, carefully excise the DNA fragment of interest.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Add</span><span style="font-family:Arial;"> </span><span >corresponding</span><span > volume of Binding Buffer (XP2)</span><span > into the centrifuge tube</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Weigh it in a clean 1.5 ml microcentrifuge tube.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Heat the DNA/gel mixture at 55-65°C for 7 min, until the gel melt</span><span > completely</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Add an equal volume of Binding Buffer (XP2).</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Put</span><span > a HiBind DN</span><span >A Mini Column in a 2 mL</span><span > collection tube. Add the DNA/</span><span >gel</span><span > solution to the HiBind DNA Mini Column.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Incubate the mixture at 60°C for 7 min or until the gel has completely melted.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Centrifuge at 10000 x g for 1 min at room temperature.</span><span style="font-family:Arial;"> </span><span >Discard the flow-through liquid.</span>
 </p>
-<p style="text-align: justify; text-indent: 0em; font-family: Times New Roman; font-size: 16px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Times New Roman; font-size: 16px;">2.</span><span style="font-family: Times New Roman;"> </span><span style="font-family: Times New Roman; font-size: 16px;">Centrifugation</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Add 300 μL</span><span > Binding Buffer (XP2)</span><span > into the centrifuge tube</span><span >.</span><span > Centrifuge at </span><span >10</span><span >000 x g</span><span > for 1 minute at room temperature. Then discard the flow-through liquid.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Place a HiBind DNA Mini Column in a provided 2 ml collection tube. Add the </span><span style="font-family: Times New Roman; font-size: 16px;">DNA/agarose solution to the HiBind DNA Mini Column.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Add 700 μL</span><span > SPW Wash Buffer (diluted with absolute ethanol). </span><span >Centrifuge at 10</span><span >000 x g for 1 min</span><span >ute</span><span > at room temperature. Then discard the flow-through liquid</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Centrifuge at 10000 x g for 1 min at room temperature.</span><span style="font-family: Times New Roman;"> </span><span style="font-family: Times New Roman; font-size: 16px;">Discard the flow-through liquid.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Repeat the previous step.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Add 300 μl of Binding Buffer (XP2).And centrifuge at 13000 x g for 1 minute at room temperature. Then discard the flow-through liquid.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Centrifuge the empty HiBind Mini Column at ≥ 13000 x g for 2 min to spin-dry.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Add 700 μl of SPW Wash Buffer (diluted with absolute ethanol). And centrifuge at 13000 x g for 1 min at room temperature. Then discard the flow-through liquid</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Place the HiBind </span><span >Mini Column into a </span><span >sterile</span><span > 1.5 mL</span><span > centrifuge tube. </span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Repeat the previous step.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >A</span><span >dd 3</span><span >0 μL Elution Buffer directly i</span><span >nto the </span><span >HiBind Mini C</span><span >olumn</span><span >. Sit </span><span >at room temperature for 2 minutes. Centrifuge</span><span > at maximum speed (≥ 13</span><span >000 x g)</span><span > for 1 min</span><span > to elute DNA.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Times New Roman;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;">
-    <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Centrifuge the empty HiBind DNA Mini Column for 2 min at maximal speed (≥ 13000 x g ) to dry the column matrix.</span>
+    <br/>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Place the HiBind DNA Mini Column into a clean 1.5 ml microcentrifuge tube. add 30 μl Elution Buffer directly onto the column matrix and incubate at room temperature for 2 minutes. Centrifuge for 1 min at maximum speed (≥ 13,000 x g) to elute DNA.</span>
+     <span style="font-size:14px;">3.</span><span style="font-size:14px;">	</span><span >Ligation</span>
 </p>
-<p style="text-align: justify; text-indent: 0em; font-family: Times New Roman; font-size: 16px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">Ligation</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Reaction condition: 16°C for 5-12 hours.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Check the concentration of DNA fragments and vector which are going to be ligated.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Measure</span><span > the concentration of DNA fragments and vector which are going to be ligated.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Calculate the amount of insert and vector added, based on the fragment length. </span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Calculate the volume</span><span > of insert </span><span >fragments </span><span >and vector </span><span >which should be added, based on the </span><span >formula: </span><img src="http://convert.wenku.baidu.com/rtcs/math?md5sum=50a7536e3d313010db05dc35e367433d.docx&math=23cce6a9e11a7f0381d4959dad7f64fd"/>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Add DNA/buffer and ligase together in the EP tube.</span>
+     <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;">	</span><span >Add </span><span >DNA fragments, vector, ligation buffer</span><span > and </span><span >T4 Ligase together in an</span><span > EP tube</span><span > as the table below</span><span >.</span>
 </p>
-<table style="border: currentColor; border-image: none; font-size: 16px; margin-right: auto; margin-left: auto; border-collapse: collapse; styleName: Normal Table; border-insideH: 1px solid #000000; border-insideV: 1px solid #000000; cellpadding: 0px 7px 0px 7px;">
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;">
      <tbody>
          <tr class="firstRow">
-             <td style="border-width: 1px; border-style: solid solid solid none; border-color: rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Insert</span>
+                     <span style="font-family:Arial;">Insert</span><span style="font-family:Arial;"> Fragments</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">V</span><span style="font-family: Times New Roman; valign: sub;">1</span><span style="font-family: Times New Roman;"> μl</span>
+                     <span style="font-family:Arial;">V</span><span style="font-family:Arial;valign:sub;">1</span><span style="font-family:Arial;"> μL</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Vector</span>
+                     <span style="font-family:Arial;">Vector</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">V</span><span style="font-family: Times New Roman; valign: sub;">2 </span><span style="font-family: Times New Roman;">μl</span>
+                     <span style="font-family:Arial;">V</span><span style="font-family:Arial;valign:sub;">2 </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">10</span><span style="font-family: Times New Roman;">×</span><span style="font-family: Times New Roman;">ligation buffer</span>
+                     <span style="font-family:Arial;">10</span><span style="font-family:Arial;">×</span><span style="font-family:Arial;">Ligation B</span><span style="font-family:Arial;">uffer</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">1 μl</span>
+                     <span style="font-family:Arial;">1 μL</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">T4 Ligase</span>
+                     <span style="font-family:Arial;">T4 Ligase</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">1 μl</span>
+                     <span style="font-family:Arial;">1 μL</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 5px;">
+         <tr style="height:5px;">
-             <td style="border-width: medium 1px 1px; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 553px; vertical-align: top;" colspan="2">
+             <td colspan="2" style="width:553px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Add ddH</span><span style="font-family: Times New Roman; valign: sub;">2</span><span style="font-family: Times New Roman;">O until the total volume is 10.0μL</span>
+                     <span style="font-family:Arial;">Add ddH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">O until the total volume equals</span><span style="font-family:Arial;"> 10.0</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 0px;">
+         <tr style="height:0;">
-             <td style="border: currentColor; border-image: none; width: 277px;"></td>
+             <td style="width:277px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 277px;"></td>
+             <td style="width:277px;border:none;"></td>
          </tr>
      </tbody>
 </table>
-<p style="font-family: Times New Roman;">
+<p >
-     <span style="font-family: Times New Roman; font-size: 13px;">Note that a ligation using a molar ratio of 1:3 vector to inserts.</span>
+     <span >Note</span><span >: </span><span >Mix</span><span >ing</span><span > the </span><span >ligation system well by pipetting up and down gently is</span><span > necessary</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Times New Roman;font-size:16px;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Mix the reaction by pipetting up and down gently and microfuge briefly.</span>
+     <br/>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 16px; margin-left: 28px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;">
-     <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Incubate at 16°C for 5~12 hours.</span>
+     <span style="font-family:Arial;font-weight:700;font-size:16px;">General PCR </span><span >(Polymerase Chain Reaction)</span>
 </p>
-<p style="font-family: Times New Roman;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;">
-     <span style="font-family: Times New Roman;">PCR</span>
+     <span >PCR System</span>
 </p>
-<p style="text-align: justify; text-indent: -28px; font-family: Times New Roman; font-size: 18px; margin-left: 0px; styleName: Normal;">
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;">
-    <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;">	</span><span style="font-family: Times New Roman; font-size: 18px; font-weight: 700;">PCR (Polymerase Chain Reaction)</span>
-</p>
-<p style="text-align: justify; text-indent: 0em; font-family: Times New Roman; font-size: 16px; styleName: Normal;">
-    <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">General PCR</span>
-</p>
-<p style="text-align: justify; text-indent: 0em; font-family: Times New Roman; font-size: 16px; styleName: Normal;">
-    <span style="font-family: Times New Roman; font-size: 16px;">PCR System</span>
-</p>
-<table style="border: currentColor; border-image: none; font-size: 16px; margin-right: auto; margin-left: auto; border-collapse: collapse; styleName: Normal Table; border-insideH: 1px solid #000000; border-insideV: 1px solid #000000; cellpadding: 0px 7px 0px 7px;">
      <tbody>
          <tr class="firstRow">
-             <td style="border-width: 1px; border-style: solid solid solid none; border-color: rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="border: 1px rgb(0, 0, 0); border-image: none;"><span style=" font-family: Times New Roman;">Template</span></span>
+                     <span style="border:1px none #fff;"><span style="font-family:Arial;color:#fff;">Template</span></span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">1μl</span>
+                    <span style="font-family:Arial;">1</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">Forward Primer</span>
+                     <span style="font-family:Arial;">Forward Primer</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">2μl</span>
+                    <span style="font-family:Arial;">2</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">Reverse Primer</span>
+                     <span style="font-family:Arial;">Reverse Primer</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">2μl</span>
+                    <span style="font-family:Arial;">2</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">dNTP Mixture</span>
+                     <span style="font-family:Arial;">dNTP Mixture</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">2μl</span>
+                    <span style="font-family:Arial;">2</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">10×PCR Buffer</span>
+                     <span style="font-family:Arial;">10×PCR Buffer</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">5μl</span>
+                    <span style="font-family:Arial;">5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">r Taq (TakaRa)</span>
+                     <span style="font-family:Arial;">r</span><span style="font-family:Arial;">Taq (TakaRa)</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">1μl</span>
+                    <span style="font-family:Arial;">1</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">ddH</span><span style="font-family: Times New Roman; valign: sub;">2</span><span style="font-family: Times New Roman;">O</span>
+                     <span style="font-family:Arial;">ddH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">O</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">37μl</span>
+                    <span style="font-family:Arial;">37</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">Total Volume</span>
+                     <span style="font-family:Arial;">Total Volume</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">50μl</span>
+                    <span style="font-family:Arial;">50</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 0px;">
+         <tr style="height:0;">
-             <td style="border: currentColor; border-image: none; width: 277px;"></td>
+             <td style="width:277px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 277px;"></td>
+             <td style="width:277px;border:none;"></td>
          </tr>
      </tbody>
 </table>
-<p style="text-align: justify; text-indent: 0em; font-family: Times New Roman; font-size: 16px; styleName: Normal;">
+<p style="font-family:Times New Roman;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;">
-     <span style="font-family: Times New Roman; font-size: 16px;">PCR Condition</span>
+     <br/>
+</p>
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;">
+    <span >PCR Condition</span>
 </p>
-<table style="border: currentColor; border-image: none; font-size: 16px; margin-right: auto; margin-left: auto; border-collapse: collapse; styleName: Normal Table; border-insideH: 1px solid #000000; border-insideV: 1px solid #000000; cellpadding: 0px 7px 0px 7px;">
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;">
      <tbody>
          <tr class="firstRow">
-             <td style="border-width: 1px; border-style: solid solid solid none; border-color: rgb(0, 0, 0); padding: 0px 7px; width: 137px; vertical-align: middle;">
+             <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman,MS Mincho; styleName: Normal;">
+                 <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">1</span>
+                     <span style="font-family:Arial;">1</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 149px; vertical-align: middle;">
+             <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman,MS Mincho; styleName: Normal;">
+                 <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">94°C</span>
+                     <span style="font-family:Arial;">94°C</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">5min</span>
+                    <span style="font-family:Arial;">5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">min</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 127px; vertical-align: middle;">
+             <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     &nbsp;
+                     <br/>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 137px; vertical-align: middle;">
+             <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">2</span>
+                     <span style="font-family:Arial;">2</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 149px; vertical-align: middle;">
+             <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">94°C</span>
+                     <span style="font-family:Arial;">94°C</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">30s</span>
+                    <span style="font-family:Arial;">30</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">s</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 127px; vertical-align: middle;" rowspan="3">
+             <td rowspan="3" style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">30 loops</span>
+                     <span style="font-family:Arial;">30 loops</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 137px; vertical-align: middle;">
+             <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">3</span>
+                     <span style="font-family:Arial;">3</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 149px; vertical-align: middle;">
+             <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">Tm°C</span>
+                     <span style="font-family:Arial;">Tm°C</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">30s</span>
+                    <span style="font-family:Arial;">30</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">s</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 137px; vertical-align: middle;">
+             <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">4</span>
+                     <span style="font-family:Arial;">4</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 149px; vertical-align: middle;">
+             <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">72°C</span>
+                     <span style="font-family:Arial;">72°C</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">1 min/kb</span>
+                     <span style="font-family:Arial;">1 min/kb</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 5px;">
+         <tr style="height:5px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 137px; vertical-align: middle;">
+             <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">5</span>
+                     <span style="font-family:Arial;">5</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 149px; vertical-align: middle;">
+             <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">72°C</span>
+                     <span style="font-family:Arial;">72°C</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">10min</span>
+                    <span style="font-family:Arial;">10</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">min</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 127px; vertical-align: middle;">
+             <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     &nbsp;
+                     <br/>
                  </p>
              </td>
          </tr>
-         <tr style="height: 5px;">
+         <tr style="height:5px;">
-             <td style="border-width: medium 1px 1px; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 137px; vertical-align: middle;">
+             <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">6</span>
+                     <span style="font-family:Arial;">6</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 149px; vertical-align: middle;">
+             <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman,MS Mincho; styleName: Normal;">
+                 <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     <span style="font-family: Times New Roman;">15°C</span>
+                     <span style="font-family:Arial;">15°C</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 140px; vertical-align: middle;">
+             <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                    <span style="font-family: Times New Roman;">5min</span>
+                    <span style="font-family:Arial;">5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">min</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none none solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 127px; vertical-align: middle;">
+             <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; text-indent: 0em; font-family: Times New Roman; styleName: Normal;">
+                 <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
-                     &nbsp;
+                     <br/>
                  </p>
              </td>
          </tr>
-         <tr style="height: 0px;">
+         <tr style="height:0;">
-             <td style="border: currentColor; border-image: none; width: 137px;"></td>
+             <td style="width:137px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 149px;"></td>
+             <td style="width:149px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 140px;"></td>
+             <td style="width:140px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 127px;"></td>
+             <td style="width:127px;border:none;"></td>
          </tr>
      </tbody>
 </table>
-<p style="text-align: justify; text-indent: 0em; font-family: Times New Roman; font-size: 16px; styleName: Normal;">
+<p style="font-family:Times New Roman;font-size:21px;">
-    &nbsp;
+     <br/>
-</p>
-<p style="text-align: center; font-family: Times New Roman,宋体; font-size: 21px;">
-     &nbsp;
-</p>
-<p style="text-align: center; font-family: Times New Roman,宋体; font-size: 21px;">
-    &nbsp;
 </p>
-<p style="text-align: center; font-family: Times New Roman,宋体; font-size: 21px;">
+<p style="font-family:Arial;font-size:21px;">
-     <span style="font-family: Times New Roman,宋体; font-size: 21px; font-weight: 700;">Conic curve formation</span>
+     <span style="font-family:Arial;font-weight:700;font-size:21px;">Conic curve formation</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 18px;">
+<p >
-    <span style="font-family: 宋体; font-size: 18px; font-weight: 700;">Ⅰ</span><span style="font-family: Times New Roman,宋体; font-size: 18px; font-weight: 700;"> </span><span style="font-family: Times New Roman; font-size: 18px; font-weight: 700;">M63 semi-solid medium preparation</span>
+    <span style="font-family:Arial;font-weight:700;font-size:16px;">Medium: </span><span style="font-family:Arial;font-weight:700;font-size:16px;">M63 </span><span style="font-family:Arial;font-weight:700;font-size:16px;valign:sup;">[1]</span><span style="font-family:Arial;font-weight:700;font-size:16px;"> </span><span style="font-family:Arial;font-weight:700;font-size:16px;">semi-solid medium preparation</span>
 </p>
-<table style="border: currentColor; border-image: none; font-size: 16px; margin-right: auto; margin-left: auto; border-collapse: collapse; styleName: Normal Table; border-insideH: 1px solid #000000; border-insideV: 1px solid #000000; cellpadding: 0px 7px 0px 7px;">
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;">
      <tbody>
          <tr class="firstRow">
-             <td style="padding: 0px 7px; border: 1px solid rgb(0, 0, 0); width: 553px; vertical-align: top;" colspan="2">
+             <td colspan="2" style="width:553px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="text-align: center; font-family: Times New Roman;">
+                 <p style="font-family:Arial;text-align:center;">
-                     <span style="font-family: Times New Roman;">M63 semi-solid medium/100mL</span>
+                     <span style="font-family:Arial;">M63 semi-solid medium/100</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">mL</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Reagent</span>
+                     <span style="font-family:Arial;">Ingredients</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Quantities</span>
+                     <span style="font-family:Arial;">Quantities</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">KH</span><span style="font-family: Times New Roman; valign: sub;">2</span><span style="font-family: Times New Roman;">PO</span><span style="font-family: Times New Roman; valign: sub;">4</span>
+                     <span style="font-family:Arial;">KH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">PO</span><span style="font-family:Arial;valign:sub;">4</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">1.36g</span>
+                     <span style="font-family:Arial;">1.36</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">KOH</span>
+                     <span style="font-family:Arial;">KOH</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.42g</span>
+                     <span style="font-family:Arial;">0.42</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">(NH</span><span style="font-family: Times New Roman; valign: sub;">4</span><span style="font-family: Times New Roman;">)</span><span style="font-family: Times New Roman; valign: sub;">2</span><span style="font-family: Times New Roman;">SO</span><span style="font-family: Times New Roman; valign: sub;">4</span>
+                     <span style="font-family:Arial;">(NH</span><span style="font-family:Arial;valign:sub;">4</span><span style="font-family:Arial;">)</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">SO</span><span style="font-family:Arial;valign:sub;">4</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.2g</span>
+                     <span style="font-family:Arial;">0.2</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">MgSO</span><span style="font-family: Times New Roman; valign: sub;">4</span>
+                     <span style="font-family:Arial;">MgSO</span><span style="font-family:Arial;valign:sub;">4</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.012g</span>
+                     <span style="font-family:Arial;">0.012</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Agar( gel strength&gt;750 g/cm</span><span style="font-family: Times New Roman; valign: sup;">2</span><span style="font-family: Times New Roman;">)</span>
+                     <span style="font-family:Arial;">Agar( gel strength&gt;750 g/cm</span><span style="font-family:Arial;valign:sup;">2</span><span style="font-family:Arial;">)</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.25g</span>
+                     <span style="font-family:Arial;">0.25</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">H</span><span style="font-family: Times New Roman; valign: sub;">2</span><span style="font-family: Times New Roman;">O</span>
+                     <span style="font-family:Arial;">H</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">O</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;valign:sup;">1</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">96mL</span>
+                     <span style="font-family:Arial;">96</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">mL</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Glycerol</span>
+                     <span style="font-family:Arial;">Glycerol</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.2mL</span>
+                     <span style="font-family:Arial;">0.2</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">mL</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">FeSO</span><span style="font-family: Times New Roman; valign: sub;">4 &nbsp;</span><span style="font-family: Times New Roman;">*</span><span style="font-family: Times New Roman; valign: sup;">1</span>
+                     <span style="font-family:Arial;">FeSO</span><span style="font-family:Arial;valign:sub;">4</span><span style="font-family:Arial;valign:sub;"> </span><span style="font-family:Arial;valign:sup;">2</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">10.84*10</span><span style="font-family: Times New Roman; valign: sup;">-4</span><span style="font-family: Times New Roman;">g</span>
+                     <span style="font-family:Arial;">10.84*10</span><span style="font-family:Arial;valign:sup;">-4</span><span style="font-family:Arial;valign:sup;"> </span><span style="font-family:Arial;">g</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">D-glucose</span>
+                     <span style="font-family:Arial;">D-glucose</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.4g</span>
+                     <span style="font-family:Arial;">0.4</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span><span style="font-family:Arial;"> </span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Asp *</span><span style="font-family: Times New Roman; valign: sup;">2</span>
+                     <span style="font-family:Arial;">Asp</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;valign:sup;">3</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">6.6*10</span><span style="font-family: Times New Roman; valign: sup;">-3</span><span style="font-family: Times New Roman;">mg</span>
+                     <span style="font-family:Arial;">6.6*10</span><span style="font-family:Arial;valign:sup;">-6</span><span style="font-family:Arial;valign:sup;"> </span><span style="font-family:Arial;">g</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Met, Leu, His, Thr (0.015g/mL)</span>
+                     <span style="font-family:Arial;">Met, Leu, His, Thr (0.015</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g/mL)</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;valign:sup;">4</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">1mL</span>
+                     <span style="font-family:Arial;">1</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">mL</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 0px;">
+         <tr style="height:0;">
-             <td style="border: currentColor; border-image: none; width: 277px;"></td>
+             <td style="width:277px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 277px;"></td>
+             <td style="width:277px;border:none;"></td>
          </tr>
      </tbody>
 </table>
-<p style="font-family: Times New Roman;">
+<p style="font-family:Times New Roman;font-size:16px;">
-     &nbsp;
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p >
-     <span style="font-family: Times New Roman; font-size: 16px;">Note</span><span style="font-family: Times New Roman; font-size: 16px;">：</span>
+     <span >Note</span><span >：</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">1.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">FeSO</span><span style="font-family: Times New Roman; valign: sub;">4 &nbsp;</span><span style="font-family: Times New Roman;">*</span><span style="font-family: Times New Roman; valign: sup;">1</span><span style="font-family: Times New Roman;"> :Add 10μl 0.1g/mL FeSO</span><span style="font-family: Times New Roman; valign: sub;">4</span><span style="font-family: Times New Roman;"> to the medium</span>
+     <span style="font-size:14px;">1.</span><span style="font-size:14px;">	</span><span >Add</span><span > 0.25</span><span > </span><span >g Agar into a erlenmeyer flask first, then pour into 96</span><span > </span><span >mL H</span><span style="font-family:Arial;font-size:16px;valign:sub;">2</span><span >O, shaking up</span><span >, continue to add</span><span > glycerol using </span><span >pipette</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">2.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">Asp *</span><span style="font-family: Times New Roman; valign: sup;">2</span><span style="font-family: Times New Roman;"> : Add 10μL 66mg/mL Asp to the medium</span>
+     <span style="font-size:14px;">2.</span><span style="font-size:14px;">	</span><span >Add 10</span><span > </span><span >μL 0.1</span><span > </span><span >g/mL FeSO</span><span style="font-family:Arial;font-size:16px;valign:sub;">4</span><span > solution into the medium.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">3.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">Add 96mL H</span><span style="font-family: Times New Roman; valign: sub;">2</span><span style="font-family: Times New Roman;">O after 0.25g Agar poured into the </span><span style="font-family: Times New Roman;">conical</span><span style="font-family: Times New Roman;">&nbsp;</span><span style="font-family: Times New Roman;">flask</span><span style="font-family: Times New Roman;">, shaking up, and then continue adding Glycerol using </span><span style="font-family: Times New Roman;">pipette</span><span style="font-family: Times New Roman;">.</span>
+     <span style="font-size:14px;">3.</span><span style="font-size:14px;">	</span><span >Add 10</span><span > </span><span >μL 66</span><span > </span><span >mg/mL Asp solution into the medium.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">4.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">Asp *2, Met, Leu, His, Thr could be promixed for convenience, and the amino acid should be added by injector through 0.22</span><span style="font-family: Times New Roman,宋体;">μ</span><span style="font-family: Times New Roman;">m filter membrane, pay attention that this process must carry out after the M63 semi-solid medium is high temperature sterilized.</span>
+     <span style="font-size:14px;">4.</span><span style="font-size:14px;">	</span><span >Met, Leu, His, Thr could be premixed for convenience, and the amino acid should be added by injector through 0.22</span><span > </span><span >μ</span><span >m filter membrane. Pay attention that this process must be carried out after high temperature sterilization of the M63 semi-solid medium.</span>
 </p>
-<p style="font-family: Times New Roman;">
+<p style="font-family:Times New Roman;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:0em;">
-     &nbsp;
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 18px;">
+<p >
-    <span style="font-family: 宋体; font-size: 18px; font-weight: 700;">Ⅱ</span><span style="font-family: Times New Roman,宋体; font-size: 18px; font-weight: 700;"> </span><span style="font-family: Times New Roman; font-size: 18px; font-weight: 700;">Mix-doting bacteria, inductor and inhibitor on the M63 semisolid medium plate</span>
+    <span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;">I</span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;">. </span><span style="font-family:Arial;font-weight:700;font-size:16px;">Mix-doting bacteria</span><span style="font-family:Arial;font-weight:700;font-size:16px;">, inductor and inhibitor on </span><span style="font-family:Arial;font-weight:700;font-size:16px;">M63 </span><span style="font-family:Arial;font-weight:700;font-size:16px;">semi-solid medium</span><span style="font-family:Arial;font-weight:700;font-size:16px;"> plate</span><span style="font-family:Arial;font-weight:700;font-size:16px;"> </span><span style="font-family:Arial;font-weight:700;font-size:16px;valign:sup;">[2]</span>
 </p>
-<p style="font-family: Times New Roman;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Times New Roman;">1. &nbsp;Pour 20ml M63 semisolid medium on the plate, laying up in the super clean bench for 1h30min to dry it up;</span>
+     <span style="font-size:14px;">1.</span><span style="font-size:14px;">	</span><span >Pour 20</span><span > </span><span >ml M63 semi</span><span >-solid medium on a</span><span > pla</span><span >te, leave the </span><span >plate </span><span >air-dried for 90 min </span><span >in </span><span >laminar flow clean bench.</span>
 </p>
-<p style="font-family: Times New Roman;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Times New Roman;">2. &nbsp;Doting 15</span><span style="font-family: Times New Roman,宋体;">μ</span><span style="font-family: Times New Roman;">L inductor (IPTG) or inhibitor (</span><span style="background: rgb(255, 255, 255); color: rgb(51, 51, 51); font-family: Times New Roman; font-size: 14px;">L-Arabinose</span><span style="font-family: Times New Roman;">) on to plate using pipette, take care when insert the tip into the medium, then lay up in the super clean bench for 20mins to dry it up;</span>
+     <span style="font-size:14px;">2.</span><span style="font-size:14px;">	</span><span >Dot</span><span > 15</span><span > </span><span >μ</span><span >L inductor (IPTG) or inhibitor (</span>L-Arabinose<span >) on the plate through</span><span > pipette, take care when </span><span >insert the tip into the medium. L</span><span >eave the </span><span >plate </span><span >air-dried for 20 min in </span><span >laminar flow clean bench</span><span >.</span>
 </p>
-<p style="font-family: Times New Roman;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Times New Roman;">3. &nbsp;Dot 3</span><span style="font-family: Times New Roman,宋体;">μ</span><span style="font-family: Times New Roman;">L Bacteria on the inductor (IPTG) or inhibitor (</span><span style="background: rgb(255, 255, 255); color: rgb(51, 51, 51); font-family: Times New Roman; font-size: 14px;">L-Arabinose</span><span style="font-family: Times New Roman;">), laying up in the super clean bench for 5mins to dry it up;</span>
+     <span style="font-size:14px;">3.</span><span style="font-size:14px;">	</span><span >Dot 3</span><span > </span><span >μ</span><span >L culture medium at the </span><span >same </span><span >position of</span><span > the inductor (IPTG) or inhibitor (</span>L-Arabinose<span >),</span><span > leave the </span><span >plate </span><span >air-dried for 5 min in </span><span >laminar flow clean bench</span><span >.</span>
 </p>
-<p style="font-family: Times New Roman;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Times New Roman;">4. &nbsp;Have the plate sealed.</span>
+     <span style="font-size:14px;">4.</span><span style="font-size:14px;">	</span><span >Seal</span><span > the plate</span><span >.</span>
 </p>
-<p style="font-family: Times New Roman;">
+<p style="font-family:Times New Roman;font-size:16px;">
-     &nbsp;
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 18px;">
+<p >
-    <span style="font-family: 宋体; font-size: 18px; font-weight: 700;">Ⅲ</span><span style="font-family: Times New Roman,宋体; font-size: 18px; font-weight: 700;"> </span><span style="font-family: Times New Roman; font-size: 18px; font-weight: 700;">lineation of inductor and inhibitor on the M63 semisolid medium plate</span>
+    <span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;">II</span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;">. </span><span style="font-family:Arial;font-weight:700;font-size:16px;">Lineation</span><span style="font-family:Arial;font-weight:700;font-size:16px;"> of inductor and inhibitor on the M63 semi</span><span style="font-family:Arial;font-weight:700;font-size:16px;">-</span><span style="font-family:Arial;font-weight:700;font-size:16px;">solid medium plate</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">1.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">Pour 20ml M63 semisolid medium on the plate, laying up in the super clean bench for 1h30min to dry it up;</span>
+     <span style="font-size:14px;">1.</span><span style="font-size:14px;">	</span><span >Pour 20 mL</span><span > M63 semi</span><span >-solid medium on a</span><span > plate,</span><span > leave the </span><span >plate </span><span >air-dried for 90 min in </span><span >laminar flow clean bench</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">2.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">Inhale 15</span><span style="font-family: Times New Roman,宋体;">μ</span><span style="font-family: Times New Roman;">L inductor (IPTG) or inhibitor (</span><span style="background: rgb(255, 255, 255); color: rgb(51, 51, 51); font-family: Times New Roman; font-size: 14px;">L-Arabinose</span><span style="font-family: Times New Roman;">), doting along the line pre-pianted carefully, bear in mind don’t destroy the semisolid medium when moving along the line.</span>
+     <span style="font-size:14px;">2.</span><span style="font-size:14px;">	</span><span >Inhale 15</span><span > </span><span >μ</span><span >L inductor (IPTG) or inhibitor (</span>L-Arabinose<span >), doting along the line pre-pianted carefully, bear in mind don’t destroy the semi</span><span >-</span><span >solid medium when moving along the line.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">3.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">After doting, lay up in the super clean bench for 15mins to dry it up, then go on the next step.</span>
+     <span style="font-size:14px;">3.</span><span style="font-size:14px;">	</span><span >Leave the </span><span >plate </span><span >air-dried for 90 min in </span><span >laminar flow clean bench.</span>
 </p>
-<p style="text-align: center; font-family: Times New Roman,宋体; font-size: 21px;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     &nbsp;
+     <span style="font-size:14px;">4.</span><span style="font-size:14px;">	</span><span >Repeat the process mix-doting bacteria, inductor and inhibitor on M63 semi-solid medium plate.</span>
 </p>
-<p style="text-align: center; font-family: Times New Roman,宋体; font-size: 21px;">
+<p style="font-family:Times New Roman;font-size:16px;">
-     &nbsp;
+     <br/>
 </p>
-<p style="text-align: center; font-family: Times New Roman,宋体; font-size: 21px;">
+<p style="font-family:Arial;font-size:21px;text-align:left;">
-     <span style="font-family: Times New Roman,宋体; font-size: 21px; font-weight: 700;">Characterization the activity of promoter and efficiency of RBS by chemotaxis</span>
+     <span style="font-family:Arial;font-weight:700;font-size:21px;">Characterization the activity of promoter and efficiency of RBS by chemotaxis</span>
 </p>
-<p style="font-family: Times New Roman,宋体; font-size: 16px;">
+<p style="font-family:Arial;font-size:16px;text-align:left;">
-     <span style="font-family: Times New Roman,宋体; font-size: 16px; font-weight: 700;">Activation of bacteria</span>
+     <span style="font-family:Arial;font-weight:700;font-size:16px;">culture</span>
 </p>
-<p style="font-family: Times New Roman;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Times New Roman;">Transfer 50μL bacterium solution (pLac-RBS (1.0)-CheZ-TT, pLac-RBS (0.01)-CheZ-TT, pLac-RBS (0.3)-CheZ-TT) into 5ml new LB liquid medium whose chloromycetin concentration is 50ug/ml to culture for 12 hours in 37</span><span style="font-family: 宋体;">℃</span><span style="font-family: Times New Roman;">horizontal rotators at 200rpm. </span>
+     <span style="font-size:14px;">1.</span><span style="font-size:14px;">	</span><span >Add</span><span > 50</span><span > </span><span >μL bacterium solution (pLac-RBS (1.0)-</span><span style="font-family:Arial;font-style:italic;font-size:16px;">CheZ</span><span >-TT,</span><span > </span><span >pLac-RBS (0.3)-</span><span style="font-family:Arial;font-style:italic;font-size:16px;">CheZ</span><span >-TT, </span><span >pLac-RBS (0.01)-</span><span style="font-family:Arial;font-style:italic;font-size:16px;">CheZ</span><span >-TT,</span><span >) into 5</span><span > </span><span >mL</span><span > fresh LB liquid medium</span><span >,</span><span > in which</span><span > chloromyce</span><span >tin concentration is 50</span><span > μ</span><span >g/ml.</span>
 </p>
-<p style="font-family: Times New Roman;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Times New Roman;">Then transfer another 50μL bacterium solution from the LB above to another new 5ml LB liquid medium whose chloromycetin concentration is 50ug/ml to culture in 37</span><span style="font-family: 宋体;">℃</span><span style="font-family: Times New Roman;">horizontal rotators at 200rpm for 3 hours.</span>
+     <span style="font-size:14px;">2.</span><span style="font-size:14px;">	</span><span >Culture overnight under the condition of 37°C, 200 rpm.</span>
 </p>
-<p style="text-align: left; font-family: Times New Roman,宋体; font-size: 16px; outlineLvl: 0;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Times New Roman,宋体; font-size: 16px; font-weight: 700;">Culture</span>
+     <span style="font-size:14px;">3.</span><span style="font-size:14px;">	</span><span >Add</span><span > 50</span><span > </span><span >μL bacterium solution from the LB </span><span >liq</span><span >uid medium above to another 5 mL</span><span > fresh</span><span > </span><span >LB liquid medium</span><span >,</span><span > in which </span><span >chloromycetin concentration is 50</span><span > </span><span >μ</span><span >g/mL</span><span >.</span>
 </p>
-<p style="font-family: Times New Roman;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Times New Roman;">We draw three dots on a plate before, then stab 3ul bacterium medium into the M63 semisolid medium at the dots. After that culture the bacteria in constant temperature and humidity incubator at 37</span><span style="font-family: 宋体;">℃</span><span style="font-family: Times New Roman;">.</span>
+     <span style="font-size:14px;">4.</span><span style="font-size:14px;">	</span><span >Culture under the condition of 37°C, 200 rpm </span><span >for 3 hours.</span><span > Stock </span><span >it in 4</span><span >°C.</span>
 </p>
-<p style="font-family: Times New Roman,宋体; font-size: 16px;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Times New Roman,宋体; font-size: 16px; font-weight: 700;">Measurement </span>
+     <span style="font-size:14px;">5.</span><span style="font-size:14px;">	</span><span >Prepare M63 semi-solid medium as above.</span>
 </p>
-<p style="font-family: Times New Roman;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Times New Roman;">Use a ruler to measure the diameter of colony from the bottom of the semi-solid medium. The initial colony radius is recorded as R</span><span style="font-family: Times New Roman; valign: sub;">1</span><span style="font-family: Times New Roman;">, and the radius are measured at 12h, 24h, 30h, 36h, 42h... as R2, R3, R4, R5, R6, R7…and record time and diameter. Finally processing data with excel.</span>
+     <span style="font-size:14px;">6.</span><span style="font-size:14px;">	</span><span >D</span><span >raw three dots on a </span><span >M63 semi-solid medium plate first</span><span >, then</span><span > </span><span >inoculate</span><span > the three kind</span><span >s</span><span > of bacterium solution </span><span >at the three</span><span > dot</span><span >s, respectively</span><span >.</span><span > The volume</span><span > </span><span >of the </span><span >inoculate</span><span >d bacterium solution is 3 μL.</span>
 </p>
-<p style="text-align: left; font-family: Times New Roman; font-size: 14px;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-    &nbsp;
+    <span style="font-size:14px;">7.</span><span style="font-size:14px;">	</span><span >C</span><span >ulture in incubator at 37</span><span >°C</span><span >.</span>
 </p>
-<p style="text-align: left; font-family: Times New Roman; font-size: 14px;">
+<p style="font-family:Times New Roman;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:0em;">
-     &nbsp;
+     <br/>
 </p>
-<p style="text-align: center; font-family: Times New Roman; font-size: 21px;">
+<p >
-     <span style="font-family: Times New Roman; font-size: 21px; font-weight: 700;">B</span><span style="font-family: Times New Roman; font-size: 21px; font-weight: 700;">lack hole</span>
+     <span style="font-family:Arial;font-weight:700;font-size:16px;">Measurement </span>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">Plasmid Construction</span>
+     <span style="font-size:14px;">1.</span><span style="font-size:14px;">	</span><span >Use a ruler t</span><span >o measure the radius</span><span > of colony</span><span > from the bottom of the semi-solid medium</span><span > plate</span><span >. The initial colony radius is recorded as R</span><span style="font-family:Arial;font-size:16px;valign:sub;">1</span><span >, and the </span><span >radiuses</span><span > measured at 12h, 24h, 30h, 36h, 42h... as R2, R3, R4, R5, R6, R7…</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 14px; styleName: Default Paragraph Font;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-    <span style="font-family: Times New Roman; font-size: 14px;">All DNA parts applied in these </span><span style="font-family: Times New Roman; font-size: 14px;">experiments came from</span><span style="font-family: Times New Roman; font-size: 14px;"> the MIT Registry of Standard Biological Parts</span><span style="font-family: Times New Roman; font-size: 14px;">.</span><span style="font-family: Times New Roman; font-size: 14px;"> The new BioBrick part, P</span><span style="font-family: Times New Roman; font-size: 14px; font-style: italic; valign: sub;">ompC</span><span style="font-family: Times New Roman; font-size: 14px;">-</span><span style="font-family: Times New Roman; font-size: 14px; font-style: italic;">cheZ </span><span style="font-family: Times New Roman; font-size: 14px;">(BBa_K1412010)</span><span style="font-family: Times New Roman; font-size: 14px;"> was formed by ligating the pre-existing parts, </span><span style="font-family: Times New Roman; font-size: 14px;">P</span><span style="font-family: Times New Roman; font-size: 14px; font-style: italic; valign: sub;">ompC</span><span style=" font-family: Times New Roman; font-size: 14px; styleName: A17;"> </span><span style="font-family: Times New Roman; font-size: 14px;">(BBa_R0082) and </span><span style="font-family: Times New Roman; font-size: 14px; font-style: italic;">cheZ</span><span style=" font-family: Times New Roman; font-size: 14px; styleName: A17;"> </span><span style="font-family: Times New Roman; font-size: 14px;">(</span><span style="font-family: Times New Roman; font-size: 14px;">BBa_K</span><span style="font-family: Times New Roman; font-size: 14px;">1412007</span><span style="font-family: Times New Roman; font-size: 14px;">). </span><span style="font-family: Times New Roman; font-size: 14px;">The Promega Wizard Plus SV Minipreps </span><span style="font-family: Times New Roman; font-size: 14px;">(Cat. #A1460) kit was used according to the manufacturer’s instructions to extract plasmid DNA. Bio</span><span style="font-family: Times New Roman; font-size: 14px;">Brick parts were digested with restriction enzymes, EcoRI, XbaI, SpeI, and PstI to produce ‘sticky ends’ that were used to com</span><span style="font-family: Times New Roman; font-size: 14px;">bine BioBrick parts. Digested DNA was purified using 1% aga</span><span style="font-family: Times New Roman; font-size: 14px;">rose gel electrophoresis followed by gel purification with the QIAGEN QIAquick Gel Extraction Kit (Cat. # 28706). BioBrick parts with matching ‘sticky ends’ were ligated using T4 ligase produced by Promega. Plasmid DNA was transformed into </span>
+    <span style="font-size:14px;">2.</span><span style="font-size:14px;">	</span><span >R</span><span >ecord time and diameter</span><span > in a</span><span style="font-family:Arial;"> </span><span >table.</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 14px; styleName: Default Paragraph Font;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-    <span style="font-family: Times New Roman; font-size: 14px;">DH5α</span><span style="font-family: Times New Roman; font-size: 14px;">.</span><span style="font-family: Times New Roman; font-size: 14px;"> Then we began a new circulation</span><span style="font-family: Times New Roman; font-size: 14px;"> consisting of extracting plasmids, digestion and DNA gel electrophoresis to make sure</span><span style="font-family: Times New Roman; font-size: 14px;"> the success of the ligation</span><span style="font-family: Times New Roman; font-size: 14px;">. Finally, the construct was</span><span style="font-family: Times New Roman; font-size: 14px;"> sequenced for verifica</span><span style="font-family: Times New Roman; font-size: 14px;">tion.</span>
+    <span style="font-size:14px;">3.</span><span style="font-size:14px;">	</span><span >Process</span><span > data with excel.</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px; styleName: Default Paragraph Font;">
+<p style="font-family:Times New Roman;font-size:16px;">
-     <span style=" font-family: Times New Roman; font-size: 16px; font-weight: 700; styleName: Default Paragraph Font;">Construction of </span><span style=" font-family: Times New Roman; font-size: 16px; font-style: italic; font-weight: 700; styleName: Default Paragraph Font;">E. coli</span><span style=" font-family: Times New Roman; font-size: 16px; font-weight: 700; styleName: Default Paragraph Font;"> strain </span><span style=" font-family: Times New Roman; font-size: 16px; font-style: italic; font-weight: 700; styleName: Default Paragraph Font;">CL-1</span>
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px; styleName: Default Paragraph Font;">
+<p style="font-family:Arial;font-size:21px;text-align:left;">
-     <span style=" font-family: Times New Roman; font-size: 16px;">The new BioBrick part, P</span><span font-family: Times New Roman; font-size: 16px; font-style: italic; valign: sub;">ompC</span><span style=" font-family: Times New Roman; font-size: 16px;">-</span><span style=" font-family: Times New Roman; font-size: 16px; font-style: italic;">cheZ </span><span style=" font-family: Times New Roman; font-size: 16px;">(</span><span style=" font-family: Times New Roman; font-size: 16px;">BBa_K1412010</span><span style=" font-family: Times New Roman; font-size: 16px;">)</span><span style=" font-family: Times New Roman; font-size: 16px;"> on pSB1C3 was introduced into </span><span style=" font-family: Times New Roman; font-size: 16px; font-style: italic; font-weight: 700;">E. coli</span><span style=" font-family: Times New Roman; font-size: 16px;"> strain </span><span style=" font-family: Times New Roman; font-size: 16px; font-style: italic;">CL-1</span><span style=" font-family: Times New Roman; font-size: 16px;"> whose gene of</span><span style=" font-family: Times New Roman; font-size: 16px; font-style: italic;"> cheZ</span><span style=" font-family: Times New Roman; font-size: 16px;"> had been knocked out.</span><span style=" font-family: Times New Roman; font-size: 16px;"> </span>
+     <span style="font-family:Arial;font-weight:700;font-size:21px;">B</span><span style="font-family:Arial;font-weight:700;font-size:21px;">lack hole</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 18px;">
+<p >
-     <span style=" font-family: Times New Roman; font-size: 16px; font-style: italic; font-weight: 700;">E. coli</span><span style=" font-family: Times New Roman; font-size: 16px;"> strain</span><span style=" font-family: Times New Roman; font-size: 16px; font-style: italic;"> CL-1 </span><span style=" font-family: Times New Roman; font-size: 16px;">was offered by </span>
+     <span style="font-family:Arial;font-weight:700;font-size:16px;">Plasmid Construction</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p >
-    <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;"></span><span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;"></span><span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;"></span><span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">I</span><span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;"></span><span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">. Gradient Plate Experiments (semi-solid medium, Cm 50μg/ml)</span>
+    <span style="font-family:Arial;color:#fff;font-size:16px;">All DNA parts applied in these experiments came from the MIT Registry of Standard Biological Parts.</span><span style="font-family:Arial;color:#fff;font-size:16px;"> The new BioBrick part, P</span><span style="font-family:Arial;color:#fff;font-size:16px;">ompC</span><span style="font-family:Arial;color:#fff;font-size:16px;">-</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;">cheZ </span><span style="font-family:Arial;color:#fff;font-size:16px;">(BBa_K1412010)</span><span style="font-family:Arial;color:#fff;font-size:16px;"> was formed by ligating the pre-existing parts, </span><span style="font-family:Arial;color:#fff;font-size:16px;">P</span><span style="font-family:Arial;color:#fff;font-size:16px;">ompC</span><span style="styleName:A17;font-family:Utopia Std;color:#fff;font-size:7px;font-family:Arial;font-size:16px;"> </span><span style="font-family:Arial;color:#fff;font-size:16px;">(BBa_R0082) and </span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;">cheZ</span><span style="styleName:A17;font-family:Utopia Std;color:#fff;font-size:7px;font-family:Arial;font-size:16px;"> </span><span style="font-family:Arial;color:#fff;font-size:16px;">(BBa_K629003). The E.Z.N.A.</span><span style="font-family:Arial;color:#fff;font-size:16px;valign:sup;">TM</span><span style="font-family:Arial;color:#fff;font-size:16px;"> Plasmid Mini Kit </span><span style="font-family:Arial;color:#fff;font-size:16px;"></span><span style="font-family:Arial;color:#fff;font-size:16px;"></span><span style="font-family:Arial;color:#fff;font-size:16px;"></span><span style="font-family:Arial;color:#fff;font-size:16px;">I</span><span style="font-family:Arial;color:#fff;font-size:16px;"></span><span style="font-family:Arial;color:#fff;font-size:16px;"> (200) was used according to the manufacturer’s instructions to extract plasmid DNA. Bio</span><span style="font-family:Arial;color:#fff;font-size:16px;">Brick parts were digested with restriction enzymes,</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> Eco</span><span style="font-family:Arial;color:#fff;font-size:16px;">RI, </span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;">Xba</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> </span><span style="font-family:Arial;color:#fff;font-size:16px;">I, </span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;">Spe</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> </span><span style="font-family:Arial;color:#fff;font-size:16px;">I, and</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> Pst</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> </span><span style="font-family:Arial;color:#fff;font-size:16px;">I</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> </span><span style="font-family:Arial;color:#fff;font-size:16px;">to produce ‘sticky ends’ that were used to com</span><span style="font-family:Arial;color:#fff;font-size:16px;">bine BioBrick parts. Digested DNA was purified using 1% aga</span><span style="font-family:Arial;color:#fff;font-size:16px;">rose gel electrophoresis followed by gel purification with the E.Z.N.A.TM Gel Extraction Kit (200). BioBrick parts with matching ‘sticky ends’ were ligated using T4 ligase produced by Takara Biotechnology (Dalian) Co., Ltd. (Takara Dalian). Plasmid DNA was transformed into DH5α</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p >
-    <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">Medium: </span><span style="font-family: Times New Roman; font-size: 16px;">Medium A</span><span style="font-family: Times New Roman; font-size: 16px; valign: sup;">1 </span><span style="font-family: Times New Roman; font-size: 16px;">(Improved)</span>
+    <span style="font-family:Arial;color:#fff;font-size:16px;"> first</span><span style="font-family:Arial;color:#fff;font-size:16px;">. Then we began a new circulation consisting of extracting plasmids, digestion and</span><span style="font-family:Arial;color:#fff;font-size:16px;"> DNA gel electrophoresis</span><span style="font-family:Arial;color:#fff;font-size:16px;"> to</span><span > </span><span style="font-family:Arial;color:#fff;font-size:16px;">confirm</span><span style="font-family:Arial;color:#fff;font-size:16px;"> the success of the ligation. Finally, the construct was sequenced for verifica</span><span style="font-family:Arial;color:#fff;font-size:16px;">tion.</span>
 </p>
-<table style="border: currentColor; border-image: none; font-size: 16px; margin-right: auto; margin-left: auto; border-collapse: collapse; styleName: Normal Table; border-insideH: 1px solid #000000; border-insideV: 1px solid #000000; cellpadding: 0px 7px 0px 7px;">
+<p style="styleName:mw-headline;styleName:Default Paragraph Font;font-family:Times New Roman;font-size:16px;">
+    <br/>
+</p>
+<p style="styleName:mw-headline;styleName:Default Paragraph Font;font-family:Arial;font-size:16px;">
+    <span style="styleName:mw-headline;styleName:Default Paragraph Font;font-family:Arial;font-weight:700;color:#fff;font-size:16px;">Construction of </span><span style="styleName:mw-headline;styleName:Default Paragraph Font;font-family:Arial;font-weight:700;font-style:italic;color:#fff;font-size:16px;">E. coli</span><span style="styleName:mw-headline;styleName:Default Paragraph Font;font-family:Arial;font-weight:700;color:#fff;font-size:16px;"> strain </span><span style="styleName:mw-headline;styleName:Default Paragraph Font;font-family:Arial;font-weight:700;color:#fff;font-size:16px;">CL-1</span>
+</p>
+<p style="styleName:mw-headline;styleName:Default Paragraph Font;font-family:Arial;font-size:16px;">
+    <span style="font-family:Arial;color:#fff;font-size:16px;">The new biob</span><span style="font-family:Arial;color:#fff;font-size:16px;">rick part, P</span><span style="font-family:Arial;color:#fff;font-size:16px;">ompC</span><span style="font-family:Arial;color:#fff;font-size:16px;">-</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;">cheZ </span><span style="font-family:Arial;color:#fff;font-size:16px;">(BBa_K141</span><span style="font-family:Arial;color:#fff;font-size:16px;">2010) on pSB1C3 was introduced </span><span style="font-family:Arial;color:#fff;font-size:16px;">i</span><span style="font-family:Arial;color:#fff;font-size:16px;">nto </span><span style="font-family:Arial;font-weight:700;font-style:italic;color:#fff;font-size:16px;">E. coli</span><span style="font-family:Arial;color:#fff;font-size:16px;"> strain </span><span style="font-family:Arial;color:#fff;font-size:16px;">CL-1</span><span style="font-family:Arial;color:#fff;font-size:16px;">,</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> </span><span style="font-family:Arial;color:#fff;font-size:16px;">whose gene of</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> cheZ</span><span style="font-family:Arial;color:#fff;font-size:16px;"> had been knocked out.</span><span style="font-family:Arial;color:#fff;font-size:16px;"> </span>
+</p>
+<p style="font-family:Times New Roman;font-size:16px;">
+    <br/>
+</p>
+<p >
+    <span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;">I</span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;">. Gradient Plate Experiments (semi-solid medium, Cm 50μg/ml)</span>
+</p>
+<p >
+    <span style="font-family:Arial;font-weight:700;font-size:16px;">Medium: </span><span >Medium A</span><span > </span><span style="font-family:Arial;font-size:16px;valign:sup;">[</span><span style="font-family:Arial;font-size:16px;valign:sup;">3</span><span style="font-family:Arial;font-size:16px;valign:sup;">]</span><span style="font-family:Arial;font-size:16px;valign:sup;"> </span><span >(Improved)</span>
+</p>
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;">
      <tbody>
          <tr class="firstRow">
-             <td style="padding: 0px 7px; border: 1px solid rgb(0, 0, 0); width: 276px; vertical-align: top;">
+             <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Ingredients</span>
+                     <span style="font-family:Arial;">Ingredients</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Quantities</span>
+                     <span style="font-family:Arial;">Percent (g/mL)</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 276px; vertical-align: top;">
+             <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Yeast Extract</span>
+                     <span style="font-family:Arial;">Yeast Extract</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.26%</span>
+                     <span style="font-family:Arial;">0.26%</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 276px; vertical-align: top;">
+             <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Peptone</span>
+                     <span style="font-family:Arial;">Peptone</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.27%</span>
+                     <span style="font-family:Arial;">0.27%</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 276px; vertical-align: top;">
+             <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">K</span><span style="font-family: Times New Roman; valign: sub;">2</span><span style="font-family: Times New Roman;">HPO</span><span style="font-family: Times New Roman; valign: sub;">4</span>
+                     <span style="font-family:Arial;">K</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">HPO</span><span style="font-family:Arial;valign:sub;">4</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.37%</span>
+                     <span style="font-family:Arial;">0.37%</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 276px; vertical-align: top;">
+             <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">KH</span><span style="font-family: Times New Roman; valign: sub;">2</span><span style="font-family: Times New Roman;">PO</span><span style="font-family: Times New Roman; valign: sub;">4</span>
+                     <span style="font-family:Arial;">KH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">PO</span><span style="font-family:Arial;valign:sub;">4</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.13%</span>
+                     <span style="font-family:Arial;">0.13%</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 276px; vertical-align: top;">
+             <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">NaCl</span>
+                     <span style="font-family:Arial;">NaCl</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.05%</span>
+                     <span style="font-family:Arial;">0.05%</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 276px; vertical-align: top;">
+             <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Glycerol</span>
+                     <span style="font-family:Arial;">Glycerol</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 277px; vertical-align: top;">
+             <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.2%</span>
+                     <span style="font-family:Arial;">0.2%</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 0px;">
+         <tr style="height:0;">
-             <td style="border: currentColor; border-image: none; width: 276px;"></td>
+             <td style="width:276px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 277px;"></td>
+             <td style="width:277px;border:none;"></td>
          </tr>
      </tbody>
 </table>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p style="font-family:Times New Roman;font-size:16px;">
-     &nbsp;
+     <br/>
 </p>
-<p style="font-family: Times New Roman;">
+<p >
-     <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">Sucrose concentration gradient: </span><span style="font-family: Times New Roman;">0~20%, the concentration gradient was 2%.</span>
+     <span style="font-family:Arial;font-weight:700;font-size:16px;">Sucrose concentration gradient: </span><span >0~20%, the concentration gradient was 2%.</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p style="font-family:Times New Roman;font-size:16px;">
-     &nbsp;
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p >
-     <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">Mid-log-phase c</span><span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">ell suspensions </span><span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">preparation</span><span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">:</span>
+     <span style="font-family:Arial;font-weight:700;font-size:16px;">Mid-log-phase c</span><span style="font-family:Arial;font-weight:700;font-size:16px;">ell suspensions </span><span style="font-family:Arial;font-weight:700;font-size:16px;">preparation</span><span style="font-family:Arial;font-weight:700;font-size:16px;">:</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">1.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Overnight culture</span><span style="font-family: Times New Roman; font-size: 14px;"> of the required strain grow</span><span style="font-family: Times New Roman; font-size: 14px;"> at 37 °C in Medium A</span><span style="font-family: Times New Roman; font-size: 14px; valign: sup;"> </span><span style="font-family: Times New Roman; font-size: 14px;">(Improved) </span><span style="font-family: Times New Roman; font-size: 14px;">containing appropriated</span><span style="font-family: Times New Roman; font-size: 14px;"> chloramphenicol</span><span style="font-family: Times New Roman; font-size: 14px;">.</span>
+     <span style="font-size:14px;">1.</span><span style="font-size:14px;">	</span><span >Overnight culture</span><span > of the required strain grow</span><span > at 37 °C in Medium A</span><span style="font-family:Arial;font-size:16px;valign:sup;"> </span><span >(Improved) </span><span >containing appropriate</span><span > chloramphenicol</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">2.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Dilute the overnight culture</span><span style="font-family: Times New Roman; font-size: 14px;"> a</span><span style="font-family: Times New Roman; font-size: 14px;">t</span><span style="font-family: Times New Roman; font-size: 14px;"> </span><span style="font-family: Times New Roman; font-size: 14px;">the ratio of 1:100 in fresh culture</span><span style="font-family: Times New Roman; font-size: 14px;"> (Medium A)</span><span style="font-family: Times New Roman; font-size: 14px;">, then </span><span style="font-family: Times New Roman; font-size: 14px;">incub</span><span style="font-family: Times New Roman; font-size: 14px;">ate the culture</span><span style="font-family: Times New Roman; font-size: 14px;"> at 37 °C</span><span style="font-family: Times New Roman; font-size: 14px;">, until </span><span style="font-family: Times New Roman; font-size: 14px;">its</span><span style="font-family: Times New Roman; font-size: 14px;"> OD590 reaches</span><span style="font-family: Times New Roman; font-size: 14px;"> 0.2</span><span style="font-family: Times New Roman; font-size: 14px;">.</span><span style="font-family: Times New Roman; font-size: 14px;"> </span>
+     <span style="font-size:14px;">2.</span><span style="font-size:14px;">	</span><span >Dilute the overnight culture</span><span > a</span><span >t</span><span > </span><span >the ratio of 1:100 in fresh culture</span><span > (Medium A)</span><span >, then </span><span >incub</span><span >ate the culture</span><span > </span><span >under the condition of 37°C, 200 rpm</span><span >, until </span><span >its</span><span > OD590 reaches</span><span > 0.2</span><span >.</span><span > </span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">3.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">K</span><span style="font-family: Times New Roman; font-size: 14px;">eep it in 4 °C.</span>
+     <span style="font-size:14px;">3.</span><span style="font-size:14px;">	</span><span >Stock</span><span > in 4</span><span >°C.</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p style="font-family:Times New Roman;font-size:16px;">
-     &nbsp;
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p >
-     <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">The method of </span><span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">preparing </span><span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">gradient semi-solid medium</span><span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;"> (0.25% agar)</span>
+     <span style="font-family:Arial;font-weight:700;font-size:16px;">The method of </span><span style="font-family:Arial;font-weight:700;font-size:16px;">preparing </span><span style="font-family:Arial;font-weight:700;font-size:16px;">gradient semi-solid medium</span><span style="font-family:Arial;font-weight:700;font-size:16px;"> (0.25% agar)</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">1.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">P</span><span style="font-family: Times New Roman;">repare 100% sucrose solution</span><span style="font-family: Times New Roman;">. </span>
+     <span style="font-size:14px;">1.</span><span style="font-size:14px;">	</span><span >P</span><span >repare 100% sucrose solution</span><span >. </span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 16px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">2.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">P</span><span style="font-family: Times New Roman;">repare the medium with tripled ingredients amount</span><span style="font-family: Times New Roman;">.</span>
+     <span style="font-size:14px;">2.</span><span style="font-size:14px;">	</span><span >P</span><span >repare the medium with tripled ingredients amount</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">3.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">Put the 100% sucrose solution, the prepared medium and plenty of deionized water into the autoclave for 121 degrees centigrade, 20 minutes.</span>
+     <span style="font-size:14px;">3.</span><span style="font-size:14px;">	</span><span >Put the 100% sucrose solution, the prepared medium and plenty of deionized water into the autoclave for 121</span><span >°C</span><span >, 20 minutes.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 16px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">4.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 16px;">After </span><span style="font-family: Times New Roman;">sterilization, put the 100% sucrose solution, the prepared medium and the deionized water into </span><span style="font-family: Times New Roman;">a </span><span style="font-family: Times New Roman;">drying oven for around 10 minutes</span><span style="font-family: Times New Roman;">.</span>
+     <span style="font-size:14px;">4.</span><span style="font-size:14px;">	</span><span >After sterilization, put the 100% sucrose solution, the prepared medium and the deionized water into </span><span >a </span><span >drying oven for around 10 minutes</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">5.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">Take 5ml tripled Medium A</span><span style="font-family: Times New Roman;"> </span><span style="font-family: Times New Roman; font-size: 16px;">(Improved) </span><span style="font-family: Times New Roman;">into a 25ml erlenmeyer flask, then </span><span style="font-family: Times New Roman;">add</span><span style="font-family: Times New Roman;"> appropriate volume of</span><span style="font-family: Times New Roman;"> 100% </span><span style="font-family: Times New Roman;">sucrose solution into </span><span style="font-family: Times New Roman;">the </span><span style="font-family: Times New Roman;">erlenmeyer flask</span><span style="font-family: Times New Roman;">, while the </span><span style="font-family: Times New Roman;">shortage </span><span style="font-family: Times New Roman;">will be complemented by deionized water</span><span style="font-family: Times New Roman;"> to make the total volume to be 15ml.</span>
+     <span style="font-size:14px;">5.</span><span style="font-size:14px;">	</span><span >Take 5</span><span > </span><span >mL</span><span > tripled Medium A</span><span > (Improved) </span><span >into a 25</span><span > </span><span >mL</span><span > erlenmeyer flask, then </span><span >add</span><span > appropriate volume of</span><span > 100% </span><span >sucrose solution into </span><span >the </span><span >erlenmeyer flask</span><span >, while the </span><span >shortage </span><span >will be complemented by deionized water</span><span > to make the total volume to be 15</span><span > </span><span >mL</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">6.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Add </span><span style="font-family: Times New Roman; font-size: 14px;">15μL</span><span style="font-family: Times New Roman; font-size: 14px;"> chloramphenicol</span><span style="font-family: Times New Roman; font-size: 14px;"> into the </span><span style="font-family: Times New Roman;">erlenmeyer flask.</span>
+     <span style="font-size:14px;">6.</span><span style="font-size:14px;">	</span><span >Add </span><span >15</span><span > </span><span >μL</span><span > chloramphenicol</span><span > into the erlenmeyer flask.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">7.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Pour </span><span style="font-family: Times New Roman; font-size: 14px;">the mixture into a</span><span style="font-family: Times New Roman; font-size: 14px;"> </span><span style="font-family: Times New Roman; font-size: 14px;">Petri dish</span><span style="font-family: Times New Roman; font-size: 14px;"> (85 mm dia.)</span><span style="font-family: Times New Roman; font-size: 14px;"> as quickly as possible.</span>
+     <span style="font-size:14px;">7.</span><span style="font-size:14px;">	</span><span >Pour </span><span >the mixture into a</span><span > </span><span >Petri dish</span><span > (85 mm dia.)</span><span > as quickly as possible.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">8.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Leave the </span><span style="font-family: Times New Roman; font-size: 14px;">plate </span><span style="font-family: Times New Roman; font-size: 14px;">air-dried for 90 min.</span>
+     <span style="font-size:14px;">8.</span><span style="font-size:14px;">	</span><span >Leave the </span><span >plate </span><span >air-dried for 90 min in laminar flow clean bench.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">9.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">After solidification of the media, cell suspensions from mid-log-phase cultures (</span><span style="font-family: Times New Roman; font-size: 14px;">3μL</span><span style="font-family: Times New Roman; font-size: 14px;">) were </span><span style="font-family: Times New Roman; font-size: 14px;">inoculated</span><span style="font-family: Times New Roman; font-size: 14px;"> in the center of the plate.</span>
+     <span style="font-size:14px;">9.</span><span style="font-size:14px;">	</span><span >After solidification of the media, cell suspensions from mid-log-phase cultures (</span><span >3</span><span > </span><span >μL</span><span >) were </span><span >inoculated</span><span > in the center of the plate.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">10.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Leave </span><span style="font-family: Times New Roman; font-size: 14px;">the plate dried</span><span style="font-family: Times New Roman; font-size: 14px;"> </span><span style="font-family: Times New Roman; font-size: 14px;">in air for </span><span style="font-family: Times New Roman; font-size: 14px;">15 min</span><span style="font-family: Times New Roman; font-size: 14px;">.</span>
+     <span style="font-size:14px;">10.</span><span style="font-size:14px;">	</span><span >Leave </span><span >the plate dried</span><span > </span><span >in air for </span><span >15 min</span><span > </span><span >in laminar flow clean bench.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">11.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Leave the plate incubated at 37 °C. During the period of time, </span><span style="font-family: Times New Roman; font-size: 14px;">measure</span><span style="font-family: Times New Roman; font-size: 14px;"> the diameters of the colony and taking them down.</span>
+     <span style="font-size:14px;">11.</span><span style="font-size:14px;">	</span><span >Leave the plate incubated at 37</span><span >°C. During the period of time, </span><span >measure</span><span > the di</span><span >ameters of the colony and take</span><span > them down.</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 14px;">
+<p style="font-family:Times New Roman;font-size:16px;">
-     &nbsp;
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p >
-     <span style="font-family: Times New Roman; font-size: 16px;"></span><span style="font-family: Times New Roman; font-size: 16px;"></span><span style="font-family: Times New Roman; font-size: 16px;"></span><span style="font-family: Times New Roman; font-size: 16px;">II</span><span style="font-family: Times New Roman; font-size: 16px;"></span><span style="font-family: Times New Roman; font-size: 16px;">.</span><span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;"> Plates Crossed Experiments (semi-solid medium, Cm 50μg/ml)</span>
+     <span ></span><span ></span><span ></span><span >II</span><span ></span><span >.</span><span style="font-family:Arial;font-weight:700;font-size:16px;"> Plates Crossed Experiments (semi-solid medium, Cm 50μg/ml)</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p >
-     <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">Medium: </span><span style="font-family: Times New Roman; font-size: 16px;">half Medium A</span><span style="font-family: Times New Roman; font-size: 16px; valign: sup;"> </span><span style="font-family: Times New Roman; font-size: 16px;">(Improved)</span>
+     <span style="font-family:Arial;font-weight:700;font-size:16px;">Medium: </span><span >half Medium A</span><span style="font-family:Arial;font-size:16px;valign:sup;"> </span><span >(Improved)</span>
 </p>
-<table style="border: currentColor; border-image: none; font-size: 16px; margin-right: auto; margin-left: auto; border-collapse: collapse; styleName: Normal Table; border-insideH: 1px solid #000000; border-insideV: 1px solid #000000; cellpadding: 0px 7px 0px 7px;">
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;">
      <tbody>
          <tr class="firstRow">
-             <td style="padding: 0px 7px; border: 1px solid rgb(0, 0, 0); width: 284px; vertical-align: top;">
+             <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Ingredients</span>
+                     <span style="font-family:Arial;">Ingredients</span>
                  </p>
              </td>
-             <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: rgb(0, 0, 0) rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 284px; vertical-align: top;">
+             <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Quantities</span>
+                     <span style="font-family:Arial;">Percent (g/mL)</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 284px; vertical-align: top;">
+             <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Yeast Extract</span>
+                     <span style="font-family:Arial;">Yeast Extract</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 284px; vertical-align: top;">
+             <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.13%</span>
+                     <span style="font-family:Arial;">0.13%</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 284px; vertical-align: top;">
+             <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Peptone</span>
+                     <span style="font-family:Arial;">Peptone</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 284px; vertical-align: top;">
+             <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.135%</span>
+                     <span style="font-family:Arial;">0.135%</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 284px; vertical-align: top;">
+             <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">K</span><span style="font-family: Times New Roman; valign: sub;">2</span><span style="font-family: Times New Roman;">HPO</span><span style="font-family: Times New Roman; valign: sub;">4</span>
+                     <span style="font-family:Arial;">K</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">HPO</span><span style="font-family:Arial;valign:sub;">4</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 284px; vertical-align: top;">
+             <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.195%</span>
+                     <span style="font-family:Arial;">0.195%</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 284px; vertical-align: top;">
+             <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">KH</span><span style="font-family: Times New Roman; valign: sub;">2</span><span style="font-family: Times New Roman;">PO</span><span style="font-family: Times New Roman; valign: sub;">4</span>
+                     <span style="font-family:Arial;">KH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">PO</span><span style="font-family:Arial;valign:sub;">4</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 284px; vertical-align: top;">
+             <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.065%</span>
+                     <span style="font-family:Arial;">0.065%</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 284px; vertical-align: top;">
+             <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">NaCl</span>
+                     <span style="font-family:Arial;">NaCl</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 284px; vertical-align: top;">
+             <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.025%</span>
+                     <span style="font-family:Arial;">0.025%</span>
                  </p>
              </td>
          </tr>
          <tr>
-             <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0); padding: 0px 7px; width: 284px; vertical-align: top;">
+             <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">Glycerol</span>
+                     <span style="font-family:Arial;">Glycerol</span>
                  </p>
              </td>
-             <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: currentColor rgb(0, 0, 0) rgb(0, 0, 0) currentColor; padding: 0px 7px; width: 284px; vertical-align: top;">
+             <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
-                 <p style="font-family: Times New Roman;">
+                 <p style="font-family:Arial;">
-                     <span style="font-family: Times New Roman;">0.1%</span>
+                     <span style="font-family:Arial;">0.1%</span>
                  </p>
              </td>
          </tr>
-         <tr style="height: 0px;">
+         <tr style="height:0;">
-             <td style="border: currentColor; border-image: none; width: 277px;"></td>
+             <td style="width:277px;border:none;"></td>
-             <td style="border: currentColor; border-image: none; width: 276px;"></td>
+             <td style="width:276px;border:none;"></td>
          </tr>
      </tbody>
 </table>
-<p style="font-family: Times New Roman; font-size: 14px;">
+<p style="font-family:Times New Roman;font-size:16px;">
-     &nbsp;
+     <br/>
 </p>
-<p style="font-family: Times New Roman;">
+<p >
-     <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">The concentration of sucrose: </span><span style="font-family: Times New Roman;">0%, 10%</span>
+     <span style="font-family:Arial;font-weight:700;font-size:16px;">The concentration of sucrose: </span><span >0%, 10%</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p style="font-family:Times New Roman;font-size:16px;">
-     &nbsp;
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p >
-     <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">The method of preparing liquid medium containing different concentrations of sucrose:</span>
+     <span style="font-family:Arial;font-weight:700;font-size:16px;">The method of preparing liquid medium containing different concentrations of sucrose:</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 16px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">1.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">Prepare the medium with corresponding ingredients amount in the table above.</span>
+     <span style="font-size:14px;">1.</span><span style="font-size:14px;">	</span><span >Prepare the medium with corresponding ingredients amount in the table above.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 16px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">2.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">Add corresponding amount of solid </span><span style="font-family: Times New Roman; font-size: 16px;">sucrose into the liquid medium</span><span style="font-family: Times New Roman; font-size: 16px;">.</span>
+     <span style="font-size:14px;">2.</span><span style="font-size:14px;">	</span><span >Add corresponding amount of solid sucrose into the liquid medium</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 16px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">3.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 16px;">Wait for </span><span style="font-family: Times New Roman;">sterilization.</span>
+     <span style="font-size:14px;">3.</span><span style="font-size:14px;">	</span><span >Wait for sterilization.</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 14px;">
+<p style="font-family:Times New Roman;font-size:16px;">
-     &nbsp;
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p >
-     <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">Mid-log-phase cell suspensions preparation: </span>
+     <span style="font-family:Arial;font-weight:700;font-size:16px;">Mid-log-phase cell suspensions preparation: </span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">1.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Overnight culture of the required strain grow at 37 °C in Medium A</span><span style="font-family: Times New Roman; font-size: 14px; valign: sup;"> </span><span style="font-family: Times New Roman; font-size: 14px;">(Improved) containing appropriated chloramphenicol.</span>
+     <span style="font-size:14px;">1.</span><span style="font-size:14px;">	</span><span >Overnight culture of</span><span > the required strain grow at 37</span><span >°C in Medium A</span><span style="font-family:Arial;font-size:16px;valign:sup;"> </span><span >(I</span><span >mproved) containing appropriate</span><span > chloramphenicol.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">2.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Dilute the overnight culture at the ratio of 1:100 in fresh culture (half Medium A), then incubate the culture at 37 °C, until its OD590 reaches 0.2. </span>
+     <span style="font-size:14px;">2.</span><span style="font-size:14px;">	</span><span >Dilute the overnight culture at the ratio of 1:100 in fresh culture (half Medium A), then incubate the culture </span><span >under the condition of 37°C, 200 rpm</span><span >, until its OD590 reaches 0.2. </span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">3.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Keep it in 4 °C.</span>
+     <span style="font-size:14px;">3.</span><span style="font-size:14px;">	</span><span >Stock in 4°C.</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 14px;">
+<p style="font-family:Times New Roman;font-size:16px;">
-     &nbsp;
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 16px;">
+<p >
-     <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">The method of preparing semi-solid medium</span><span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;"> with a cross</span><span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;"> (0.25% agar)</span>
+     <span style="font-family:Arial;font-weight:700;font-size:16px;">The method of preparing semi-solid medium</span><span style="font-family:Arial;font-weight:700;font-size:16px;"> with a cross</span><span style="font-family:Arial;font-weight:700;font-size:16px;"> (0.25% agar)</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 16px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">1.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">Prepare the medium with corresponding ingredients amount in the table above.</span>
+     <span style="font-size:14px;">1.</span><span style="font-size:14px;">	</span><span >Prepare the medium with corresponding ingredients amount in the table above.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">2.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">Put the</span><span style="font-family: Times New Roman;"> </span><span style="font-family: Times New Roman;">medium</span><span style="font-family: Times New Roman;"> containing agar, the </span><span style="font-family: Times New Roman; font-size: 16px;">liquid medium containing</span><span style="font-family: Times New Roman;"> </span><span style="font-family: Times New Roman; font-size: 16px;">sucrose</span><span style="font-family: Times New Roman;"> and plenty of deionized water </span><span style="font-family: Times New Roman;">into the autoclave for 121 </span><span style="font-family: Times New Roman; font-size: 14px;">°C</span><span style="font-family: Times New Roman;">, 20 minutes.</span>
+     <span style="font-size:14px;">2.</span><span style="font-size:14px;">	</span><span >Put the</span><span > </span><span >medium</span><span > containing agar, the liquid medium containing sucrose and plenty of deionized water </span><span >into the autoclave for 121</span><span >°C, 20 minutes.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 16px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">3.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 16px;">After </span><span style="font-family: Times New Roman;">sterilization, put the medium</span><span style="font-family: Times New Roman;">s and the deionized water</span><span style="font-family: Times New Roman;"> into a drying oven for around 10 minutes.</span>
+     <span style="font-size:14px;">3.</span><span style="font-size:14px;">	</span><span >After sterilization, put the medium</span><span >s and the deionized water</span><span > into a drying oven for around 10 minutes.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">4.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman;">Take 15ml of the medium</span><span style="font-family: Times New Roman;"> containing agar</span><span style="font-family: Times New Roman;"> into a 25ml erlenmeyer flask</span><span style="font-family: Times New Roman;">.</span>
+     <span style="font-size:14px;">4.</span><span style="font-size:14px;">	</span><span >Take 15</span><span > </span><span >mL</span><span > of the medium</span><span > containing agar</span><span > into a 25</span><span > </span><span >mL</span><span > erlenmeyer flask</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">5.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Add 15μL </span><span style="font-family: Times New Roman; font-size: 14px;">chloramphenicol</span><span style="font-family: Times New Roman; font-size: 14px;"> into the </span><span style="font-family: Times New Roman;">erlenmeyer flask.</span>
+     <span style="font-size:14px;">5.</span><span style="font-size:14px;">	</span><span >Add 15</span><span > </span><span >μL </span><span >chloramphenicol</span><span > into the erlenmeyer flask.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">6.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Pour the mixture into a </span><span style="font-family: Times New Roman; font-size: 14px;">Petri dish (85 mm dia.)</span><span style="font-family: Times New Roman; font-size: 14px;"> as quickly as possible.</span>
+     <span style="font-size:14px;">6.</span><span style="font-size:14px;">	</span><span >Pour the mixture into a </span><span >Petri dish (85 mm dia.)</span><span > as quickly as possible.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">7.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Leave the </span><span style="font-family: Times New Roman; font-size: 14px;">plate </span><span style="font-family: Times New Roman; font-size: 14px;">air-dried for 90 min.</span>
+     <span style="font-size:14px;">7.</span><span style="font-size:14px;">	</span><span >Leave the </span><span >plate </span><span >air-dried for 90 min in laminar flow clean bench.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">8.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">After solidification of the media, </span><span style="font-family: Times New Roman;">draw a cross composed of two straight lines on the plate, through Intensive RBI (1μl/mm). One straight line was dotted with water, the other was dotted with liquid medium containing 10% sucrose.</span><span style="font-family: Times New Roman;"> The length of the lines were 6 centimeters.</span>
+     <span style="font-size:14px;">8.</span><span style="font-size:14px;">	</span><span >After solidification of the media, </span><span >draw a cross composed of two stra</span><span >ight lines on the plate, by the way of</span><span > Intensive RBI (1 μL</span><span >/mm). O</span><span >ne straight line is</span><span > </span><span >dotted with water, the other is</span><span > dotted with liquid medium containing 10% sucrose.</span><span > The length of the lines is</span><span > 6 centimeters.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">9.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Leave the plate dried in air for 15 min.</span>
+     <span style="font-size:14px;">9.</span><span style="font-size:14px;">	</span><span >Leave th</span><span >e plate dried in air for 15 min </span><span >in laminar flow clean bench.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">10.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">C</span><span style="font-family: Times New Roman; font-size: 14px;">ell suspensions from mid-log-phase cultures (</span><span style="font-family: Times New Roman; font-size: 14px;">3μL</span><span style="font-family: Times New Roman; font-size: 14px;">) were inoculated </span><span style="font-family: Times New Roman; font-size: 14px;">at </span><span style="font-family: Times New Roman;">the cross point</span><span style="font-family: Times New Roman; font-size: 14px;">.</span>
+     <span style="font-size:14px;">10.</span><span style="font-size:14px;">	</span><span >C</span><span >ell suspensions from mid-log-phase cultures (</span><span >3</span><span > </span><span >μL</span><span >) is</span><span > inoculated </span><span >at </span><span >the cross point</span><span >.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">11.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Leave the plate dried in air for 15 min.</span>
+     <span style="font-size:14px;">11.</span><span style="font-size:14px;">	</span><span >Leave th</span><span >e plate dried in air for 15 min </span><span >in laminar flow clean bench.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-size: 14px;">12.</span><span style="font-size: 14px;">	</span><span style="font-family: Times New Roman; font-size: 14px;">Leave the plate incubated at 37 °C</span><span style="font-family: Times New Roman; font-size: 14px;">.</span><span style="font-family: Times New Roman; font-size: 14px;"> During the period of time, </span><span style="font-family: Times New Roman; font-size: 14px;">take pictures of the colony.</span>
+     <span style="font-size:14px;">12.</span><span style="font-size:14px;">	</span><span >Leave the plate incubated at 37</span><span >°C</span><span >.</span><span > During the period of time, </span><span >take pictures of the colony.</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 14px;">
+<p style="font-family:Times New Roman;font-size:14px;">
-     &nbsp;
+     <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 14px;">
+<p style="font-family:Arial;font-size:21px;text-align:left;">
-     &nbsp;
+     <span style="font-family:Arial;font-weight:700;font-size:21px;">Osicllation timer</span>
 </p>
-<p style="text-align: center; font-family: Times New Roman; font-size: 21px;">
+<p >
-    <span style="font-family: Times New Roman; font-size: 21px; font-weight: 700;">Osicllation timer</span>
+    <span style="font-family:Arial;font-weight:700;font-size:16px;">Medium: </span><span >Luria–Bertani (LB) medium</span><span > </span><span style="font-family:Arial;font-size:16px;valign:sup;">[4]</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 14px;">
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;">
-     <span style="font-family: Times New Roman; font-size: 14px;">To minimize the effects of pH, for bulk culture,we used Luria–Bertani (LB) medium containing 2.5 g Yeast extract, 5 g Bacto Tryptone,5 g NaCl per liter, buffered by 0.1 M HEPES (pH 8.0). To prepare semi-solid agar, 10-ml of the above medium containing 0.25% agar (Difco, Bacto agar) was poured into a Petridish, and allowed to harden at room temperature for 90 min. When rich defined medium was utilized, 0.1 M HEPES (pH 8.0) was also added and 0.5% (w/v) glycerol wasused as the carbon source. Unless otherwise stated, all other reagents were from Sigma.</span>
+     <tbody>
+        <tr class="firstRow">
+            <td colspan="3" style="width:553px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;text-align:center;">
+                    <span style="font-family:Arial;">Luria–Bertani (LB) medium</span><span style="font-family:Arial;">/100</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">mL</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Ingredients</span>
+                </p>
+            </td>
+            <td colspan="2" style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Quantities</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td colspan="2" style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Yeast Extract</span>
+                </p>
+            </td>
+            <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">0.25</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td colspan="2" style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Bacto Tryptone</span>
+                </p>
+            </td>
+            <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">0.5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td colspan="2" style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">NaCl</span>
+                </p>
+            </td>
+            <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">0.5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td colspan="2" style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Glycerol </span><span style="font-family:Arial;valign:sup;">1</span>
+                </p>
+            </td>
+            <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">0.5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span>
+                </p>
+            </td>
+        </tr>
+        <tr style="height:11px;">
+            <td colspan="2" style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">0.1 M HEPES </span><span style="font-family:Arial;valign:sup;">2</span>
+                </p>
+            </td>
+            <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">3-4 mL</span>
+                </p>
+            </td>
+        </tr>
+        <tr style="height:10px;">
+            <td colspan="2" style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">NaOH</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;valign:sup;">3</span>
+                </p>
+            </td>
+            <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Until </span><span style="font-family:Arial;">pH 8.0</span>
+                </p>
+            </td>
+        </tr>
+        <tr style="height:0;">
+            <td style="width:277px;border:none;"></td>
+            <td style="width:0px;border:none;"></td>
+            <td style="width:276px;border:none;"></td>
+        </tr>
+    </tbody>
+</table>
+<p style="font-family:Times New Roman;font-size:16px;">
+    <br/>
 </p>
-<p style="font-family: Times New Roman; font-size: 14px;">
+<p >
-     <span style="font-family: Times New Roman; font-size: 14px;">In order to make chemotaxis effect more obvious, we spot bacteria in the half thickness in the centern of the palte and cultivated. All experiments were carried out at 37 °C.</span>
+     <span >Note</span><span >&nbsp;:</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 14px;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     &nbsp;
+     <span style="font-size:14px;">1.</span><span style="font-size:14px;">	</span><span >Glycerol is used as the carbon source.</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 14px;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     &nbsp;
+     <span style="font-size:14px;">2.</span><span style="font-size:14px;">	</span><span >3-4 mL</span><span > </span><span >0.1 M HEPES</span><span > </span><span >is added after rich defined medium is utilized, </span><span >serving</span><span > for</span><span > minimizing the effects of pH.</span>
 </p>
-<p style="font-family: Times New Roman; font-size: 13px;">
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
-     <span style="font-family: Times New Roman; font-size: 16px; font-weight: 700;">References</span>
+     <span style="font-size:14px;">3.</span><span style="font-size:14px;">	</span><span >NaOH is added until PH of the medium reaches 8.0.</span>
 </p>
-<p style="text-align: justify; text-indent: -24px; font-family: Times New Roman; font-size: 14px; margin-left: 24px; styleName: Normal;">
+<p style="font-family:Times New Roman;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:0em;">
-     <span style="font-size: 14px;">1.</span><span style="font-size: 14px;">	</span><span style=" font-family: Times New Roman; font-size: 14px; text-decoration: none; styleName: Default Paragraph Font;">Kawaji, H., T. Mizuno, and S. Mizushima. &quot;Influence of molecular size and osmolarity of sugars and dextrans on the synthesis of outer membrane proteins O-8 and O-9 of Escherichia coli K-12.&quot; Journal of bacteriology 140.3 (1979): 843-847.</span>
+    <br/>
+</p>
+<p >
+    <span style="font-family:Arial;font-weight:700;font-size:16px;">Experiments </span>
+</p>
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
+    <span style="font-size:14px;">1.</span><span style="font-size:14px;">	</span><span >Pour 10 mL</span><span > of the </span><span >medium</span><span > above</span><span > containing 0.25% agar (Difco, Bacto agar)</span><span > into a Petridish</span><span > to prepare </span><span >semi-solid medium</span><span >.</span>
+</p>
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
+    <span style="font-size:14px;">2.</span><span style="font-size:14px;">	</span><span >Leave the </span><span >plate </span><span >air-dried for 90 min in laminar flow clean bench </span><span >at room temperature</span><span >.</span>
+</p>
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
+     <span style="font-size:14px;">3.</span><span style="font-size:14px;">	</span><span >S</span><span >pot medium culture in</span><span > half thick</span><span >ness in the centern of the plate.</span>
+</p>
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;">
+    <span style="font-size:14px;">4.</span><span style="font-size:14px;">	</span><span >Cultivate at 37</span><span >°C.</span>
+</p>
+<p style="font-family:Times New Roman;font-size:14px;">
+    <br/>
+</p>
+<p style="font-family:Arial;font-size:21px;">
+    <span style="font-family:Arial;font-weight:700;font-size:21px;">Aptamer key-lock</span>
+</p>
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;">
+    <span >PCR System</span>
+</p>
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;">
+    <tbody>
+        <tr class="firstRow">
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;text-align:center;">
+                    <span style="border:1px none #fff;"><span style="font-family:Arial;color:#fff;">Template</span></span>
+                </p>
+            </td>
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">1 </span><span style="font-family:Arial;">μL</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">Forward Primer</span>
+                </p>
+            </td>
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">1 </span><span style="font-family:Arial;">μL</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">Reverse Primer</span>
+                </p>
+            </td>
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">1 </span><span style="font-family:Arial;">μL</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">dNTP Mixture</span>
+                </p>
+            </td>
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">4 </span><span style="font-family:Arial;">μL</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">10×PCR Buffer</span>
+                </p>
+            </td>
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">5 </span><span style="font-family:Arial;">μL</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">rTaq (TakaRa)</span>
+                </p>
+            </td>
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">1 </span><span style="font-family:Arial;">μL</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">ddH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">O</span>
+                </p>
+            </td>
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">37 </span><span style="font-family:Arial;">μL</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">Total Volume</span>
+                </p>
+            </td>
+            <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">50 </span><span style="font-family:Arial;">μL</span>
+                </p>
+            </td>
+        </tr>
+        <tr style="height:0;">
+            <td style="width:277px;border:none;"></td>
+            <td style="width:277px;border:none;"></td>
+        </tr>
+    </tbody>
+</table>
+<p style="font-family:Times New Roman;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;">
+    <br/>
+</p>
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;">
+    <span >The </span><span >source and formation</span><span > of the idea</span>
+</p>
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;">
+    <tbody>
+        <tr class="firstRow">
+            <td style="width:190px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Designation</span>
+                </p>
+            </td>
+            <td style="width:183px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Sequence</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:190px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">theophylline Aptamer</span><span style="font-family:Arial;valign:sup;">1</span>
+                </p>
+            </td>
+            <td style="width:183px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">GGU GAU ACC AGC AUC GUC UUG AUG CC</span><span style="font-family:Arial;">CUUG GCA GC</span><span style="font-family:Arial;">A CC</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:190px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">theophylline Aptamer_RBS_AUG</span><span style="font-family:Arial;valign:sup;">1</span>
+                </p>
+            </td>
+            <td style="width:183px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">GGU GAU ACC AGC AUC GUC UUG AUG CC CUU GGC AGC ACC CC G CUG CAA GAC AAC AAG AUG</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:190px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">crRNA</span>
+                </p>
+            </td>
+            <td style="width:183px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">CGU CUU GAU UCC UUC UUU</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:190px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">RBS</span>
+                </p>
+            </td>
+            <td style="width:183px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">AGG AGG AAA</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:190px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">taRNA</span>
+                </p>
+            </td>
+            <td style="width:183px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">GCA GAA CUA AGG AAG AAA</span>
+                </p>
+            </td>
+        </tr>
+        <tr style="height:0;">
+            <td style="width:190px;border:none;"></td>
+            <td style="width:183px;border:none;"></td>
+        </tr>
+    </tbody>
+</table>
+<p style="font-family:Times New Roman;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;">
+    <br/>
+</p>
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;">
+    <span >Sequence</span>
+</p>
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;width:567px;border-collapse:collapse;border:none;">
+    <tbody>
+        <tr class="firstRow">
+            <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Designation</span>
+                </p>
+            </td>
+            <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Sequence( 5’-3’)</span>
+                </p>
+            </td>
+            <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Length</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Lock Templates</span>
+                </p>
+            </td>
+            <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                  TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACGAATTT<br/>CTTTCTTCCTTAG TTCTGCCTAAGGAGGAAA
+                </p>
+            </td>
+            <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">91 bp</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Forward Primer</span>
+                </p>
+            </td>
+            <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCCCTATCAGTGA
+                </p>
+            </td>
+            <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">50 bp</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Reverse primer</span>
+                </p>
+            </td>
+            <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    GTTTCTTCCTGCAGCGGCCGCTACTAGTATTTCCTCCTTAGGCAGAACT
+                </p>
+            </td>
+            <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">49 bp</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Aptamer key </span><span style="font-family:Arial;">Templates</span>
+                </p>
+            </td>
+            <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">                  TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACGAATTTCGGTGAT<br/>ACCAGCATCGTCTTGATGCCCTTGGCAGCACCCTGCGTAAAGAAGGAATCAAGACG
+                </p>
+            </td>
+            <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">123 bp</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Forward primer</span>
+                </p>
+            </td>
+            <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCCCTATCAGTGATAGAGATTGA
+                </p>
+            </td>
+            <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">53 bp</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Reverse primer</span>
+                </p>
+            </td>
+            <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                   GTTTCTTCCTGCAGCGGCCGCTACTAGTACGTCTTGATTCCTTCTTTACGCA
+                </p>
+            </td>
+            <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">52 bp</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">New RBS Templates</span>
+                </p>
+            </td>
+            <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACTAC<br/>TAGAGAGGAGGAAA
+                </p>
+            </td>
+            <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">71 bp</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Forward primer</span>
+                </p>
+            </td>
+            <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCCCTATCAGTGA
+                </p>
+            </td>
+            <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">50 bp</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">Reverse primer</span>
+                </p>
+            </td>
+            <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                   GTTTCTTCCTGCAGCGGCCGCTACTAGTATTTCCTCCTCTCTAGTAGTG
+                </p>
+            </td>
+            <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;">
+                    <span style="font-family:Arial;">49 bp</span>
+                </p>
+            </td>
+        </tr>
+        <tr style="height:0;">
+            <td style="width:104px;border:none;"></td>
+            <td style="width:397px;border:none;"></td>
+            <td style="width:66px;border:none;"></td>
+        </tr>
+    </tbody>
+</table>
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;">
+    <br/>
+</p>
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;">
+    <span >PCR Condition</span><span >s</span>
+</p>
+<p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;">
+    <span >Lock</span>
+</p>
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;">
+    <tbody>
+        <tr class="firstRow">
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">1</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">94°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">5 min</span>
+                </p>
+            </td>
+            <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <br/>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">2</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">94°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">30 s</span>
+                </p>
+            </td>
+            <td rowspan="3" style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">30 loops</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">3</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">55°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">30 s</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">4</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">72°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">30 s</span>
+                </p>
+            </td>
+        </tr>
+        <tr style="height:5px;">
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">5</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">72°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">10 min</span>
+                </p>
+            </td>
+            <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <br/>
+                </p>
+            </td>
+        </tr>
+        <tr style="height:5px;">
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">6</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">15°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">5 min</span>
+                </p>
+            </td>
+            <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <br/>
+                </p>
+            </td>
+        </tr>
+        <tr style="height:0;">
+            <td style="width:137px;border:none;"></td>
+            <td style="width:149px;border:none;"></td>
+            <td style="width:140px;border:none;"></td>
+            <td style="width:127px;border:none;"></td>
+        </tr>
+    </tbody>
+</table>
+<p style="font-family:Times New Roman;font-size:16px;">
+    <br/>
+</p>
+<p >
+    <span >Aptamer K</span><span >ey</span>
+</p>
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;">
+    <tbody>
+        <tr class="firstRow">
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">1</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">94°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">5 min</span>
+                </p>
+            </td>
+            <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <br/>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">2</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">94°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">30 s</span>
+                </p>
+            </td>
+            <td rowspan="3" style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">30 loops</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">3</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">52</span><span style="font-family:Arial;">°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">30 s</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">4</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">72°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">30 s</span>
+                </p>
+            </td>
+        </tr>
+        <tr style="height:5px;">
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">5</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">72°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">10 min</span>
+                </p>
+            </td>
+            <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <br/>
+                </p>
+            </td>
+        </tr>
+        <tr style="height:5px;">
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">6</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">15°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">5 min</span>
+                </p>
+            </td>
+            <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <br/>
+                </p>
+            </td>
+        </tr>
+        <tr style="height:0;">
+            <td style="width:137px;border:none;"></td>
+            <td style="width:149px;border:none;"></td>
+            <td style="width:140px;border:none;"></td>
+            <td style="width:127px;border:none;"></td>
+        </tr>
+    </tbody>
+</table>
+<p style="font-family:Times New Roman;font-size:16px;">
+    <br/>
+</p>
+<p >
+    <span >New RBS</span>
+</p>
+<table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;">
+    <tbody>
+        <tr class="firstRow">
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">1</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">94°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">5 min</span>
+                </p>
+            </td>
+            <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <br/>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">2</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">94°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">30 s</span>
+                </p>
+            </td>
+            <td rowspan="3" style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">30 loops</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">3</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">55°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">30 s</span>
+                </p>
+            </td>
+        </tr>
+        <tr>
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">4</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">72°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">30 s</span>
+                </p>
+            </td>
+        </tr>
+        <tr style="height:5px;">
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">5</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">72°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">10 min</span>
+                </p>
+            </td>
+            <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <br/>
+                </p>
+            </td>
+        </tr>
+        <tr style="height:5px;">
+            <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">6</span>
+                </p>
+            </td>
+            <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">15°C</span>
+                </p>
+            </td>
+            <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <span style="font-family:Arial;">5 min</span>
+                </p>
+            </td>
+            <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;">
+                <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;">
+                    <br/>
+                </p>
+            </td>
+        </tr>
+        <tr style="height:0;">
+            <td style="width:137px;border:none;"></td>
+            <td style="width:149px;border:none;"></td>
+            <td style="width:140px;border:none;"></td>
+            <td style="width:127px;border:none;"></td>
+        </tr>
+    </tbody>
+</table>
+<p style="font-family:Times New Roman;font-size:21px;">
+    <br/>
+</p>
+<p style="font-family:Times New Roman;font-size:21px;">
+    <br/>
+</p>
+<p style="font-family:Times New Roman;font-size:21px;">
+    <br/>
+</p>
+<p style="font-size: 18px;">
+    <b>References</b>
+</p>
+<p>
+    [1]Adler J. A method for measuring chemotaxis and use of the method to determine optimum conditions for chemotaxis by Escherichia coli[J]. Journal of General Microbiology, 1973, 74(1): 77-91.
+</p>
+<p>
+    [2]	S T, JP. G. Guiding bacteria with small molecules and RNA[J]. Journal of the American Chemical Society, 2007, (21):6807-6811.
+</p>
+<p>
+    [3]	Kawaji, H., T. Mizuno, and S. Mizushima. &quot;Influence of molecular size and osmolarity of sugars and dextrans on the synthesis of outer membrane proteins O-8 and O-9 of Escherichia coli K-12.&quot; Journal of bacteriology 140.3 (1979): 843-847.
+</p>
+<p>
+    [4] Liu C, Fu X, Liu L, et al. Sequential establishment of stripe patterns in an expanding cell population[J]. Science, 2011, 334(6053): 238-241.
+</p>
+<p>
+    [5]	Topp S, Gallivan J P. Guiding bacteria with small molecules and RNA[J]. Journal of the American Chemical Society, 2007, 129(21): 6807-6811.
+</p>
+<p>
+    <br/>
+</p>
+<p style="font-size: 50px;">
+    &nbsp;
 </p>
 				</div>
 			</div>
-	 <!--回到顶页的小图标-->
-	 <div id="gototop" style="width:60px; top:450px; right:25px; cursor:pointer; position:absolute;">
-      <img src="https://static.igem.org/mediawiki/2014/5/50/XMU-go_to_top.png" />
-	 </div>
-	 <!--小图标翻转特效-->
-	 <style type="text/css">
-	  #gototop {
-	     transition: all 0.2s linear;
-	    -ms-transition: all 0.2s linear;
-		-moz-transition: all 0.2s linear; /* Firefox 4 */
-        -webkit-transition: all 0.2s linear; /* Safari and Chrome */
-        -o-transition: all 0.2s linear; /* Opera */
-	  }
-	  #gototop:hover {
-	     transform:scaleX(-1);
-	    -ms-transform:scaleX(-1);
-        -moz-transform:scaleX(-1); /* Firefox 4 */
-        -webkit-transform:scaleX(-1); /* Safari and Chrome */
-        -o-transform:scaleX(-1); /* Opera */
-	  }
-	 </style>
-	 <!--小图标自动显示和隐藏的功能-->
-	 <script type="text/javascript">
-	    $(document).ready(function() {
-	    $("#gototop").hide();
-		$(window).scroll(function(){
-			if ($(window).scrollTop()>500) {$("#gototop").fadeIn();}
-			else {$("#gototop").fadeOut();}
-		});
-	    $("#gototop").click(function(){
-		  $('body,html').animate({scrollTop:0},500);
-		});
-	   });
-	 </script>
 	 <!--侧边栏自动显示和隐藏的功能-->
 		<script type="text/javascript">
@@ Line 2,442: / Line 3,422: @@
 	 </script>
 	 <script type="text/javascript" src="https://2014.igem.org/wiki/index.php?title=Team:XMU-China/main_js&action=raw&amp;ctype=text/javascript"></script>
+		<div id="side_bar">
+			<ul id="side_bar_main_1">
+				<li class="sidebar_main" id="side_bar_judging">
+					<h3><a href="https://2014.igem.org/Team:XMU-China/Notebook_Protocol">Protocol</a></h3>
+				</li>
+			</ul>
+			<img id="side_bar_img_x" src="https://static.igem.org/mediawiki/2014/2/24/Xmu_sidebar_x.png" />
+			<ul id="side_bar_main_2">
+				<li class="sidebar_main">
+					<h3><a href="https://2014.igem.org/Team:XMU-China/Notebook_Labnotes">Lab notes</a></h3>
+				</li>
+				<li class="sidebar_main" id="side_bar_safety">
+					<h3><a href="https://2014.igem.org/Team:XMU-China/Notebook_Calendar">Calendar</a></h3>
+				</li>
+			</ul>
+		</div>
 	</body>
 </html>
+{{:Team:XMU-China/UFO}}
+{{:Team:XMU-China/footer}}