Team:Penn State/Parts

From 2014.igem.org

(Difference between revisions)
 
(10 intermediate revisions not shown)
Line 12: Line 12:
<!--welcome box -->
<!--welcome box -->
<tr>
<tr>
-
<td style="border:1px solid black;" colspan="3" align="center" height="150px" bgColor=navy>
+
<td style="border:1px solid black;" colspan="3" align="center" height="100px" bgColor=navy>
<h1 ><font color="white"> WELCOME TO PENN STATE iGEM 2014! </font></h1>
<h1 ><font color="white"> WELCOME TO PENN STATE iGEM 2014! </font></h1>
-
<p><font color="white"> (Page under construction) </font></p>
+
<p style="color:#E7E7E7"> <a href="https://2014.igem.org/wiki/index.php?title=Team:Penn_State/Parts&action=edit"style="color:#00008B"> Click here  to edit this page!</a> </p>
-
<br>
+
-
<p style="color:#E7E7E7"> <a href="https://2014.igem.org/wiki/index.php?title=Team:Penn_State/Parts&action=edit"style="color:#FFFFFF"> Click here  to edit this page!</a> </p>
+
</td>
</td>
</tr>
</tr>
Line 32: Line 30:
<td style="border:2px solid navy;" align="center" "height=1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>   
<td style="border:2px solid navy;" align="center" "height=1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>   
-
<a href="https://2014.igem.org/Team:Penn_State"style="color:#000000"><font color = "white"><FONT FACE="castellar"><b> Home </b></FONT></font> </a> </td>
+
<a href="https://2014.igem.org/Team:Penn_State"style="color:#000000"><font color = "white"><FONT FACE="castellar"><b>HOME</b></FONT></font> </a> </td>
<td style="border:2px solid navy;" align="center" "height=1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>  
<td style="border:2px solid navy;" align="center" "height=1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>  
-
<a href="https://2014.igem.org/Team:Penn_State/Team"style="color:#000000"> <font color="white"><FONT FACE="castellar"><b> Team </b></FONT></font> </a> </td>
+
<a href="https://igem.org/2014_Judging_Form?id=1506"style="color:#000000"> <font color="white"><FONT FACE="castellar"><b>JUDGING FORM</b></FONT></font> </a> </td>
<td style="border:2px solid navy;" align="center"  "height=1px"  onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>  
<td style="border:2px solid navy;" align="center"  "height=1px"  onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>  
-
<a href="https://igem.org/Team.cgi?year=2014&team_name=Penn_State"style="color:#000000"> <font color = "white"><FONT FACE="castellar"><b> Official Team Profile </b></FONT></font> </a></td>
+
<a href="https://igem.org/Team.cgi?year=2014&team_name=Penn_State"style="color:#000000"> <font color = "white"><FONT FACE="castellar"><b>OFFICIAL PROFILE</b></FONT></font> </a></td>
 +
 
 +
<td style="border:2px solid navy;" align="center" "height=1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>
 +
<a href="https://2014.igem.org/Team:Penn_State/Team"style="color:#000000"> <font color="white"><FONT FACE="castellar"><b>TEAM</b></FONT></font> </a> </td>
<td style="border:2px solid navy" align="center"  "height ="1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>   
<td style="border:2px solid navy" align="center"  "height ="1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>   
-
<a href="https://2014.igem.org/Team:Penn_State/Project"style="color:#000000"> <font color="white"><FONT FACE="castellar"><b> Projects</b></FONT></font></a></td>
+
<a href="https://2014.igem.org/Team:Penn_State/Project"style="color:#000000"> <font color="white"><FONT FACE="castellar"><b> PROJECTS</b></FONT></font></a></td>
<td style="border:2px solid navy;" align="center"  "height=1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>  
<td style="border:2px solid navy;" align="center"  "height=1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>  
-
<a href="https://2014.igem.org/Team:Penn_State/Parts"style="color:#000000"> <font color="white"><FONT FACE="castellar"><b> Parts </b></FONT></font></a></td>
+
<a href="https://2014.igem.org/Team:Penn_State/Parts"style="color:#000000"> <font color="white"><FONT FACE="castellar"><b>PARTS</b></FONT></font></a></td>
-
 
+
-
<td style="border:2px solid navy;" align="center" "height=1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>
+
-
<a href="https://2014.igem.org/Team:Penn_State/Modeling"style="color:#000000"><font color="white"> <FONT FACE="castellar"><b> Modeling </b></FONT></font></a></td>
+
<td style="border:2px solid navy;" align="center" "height ="1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>   
<td style="border:2px solid navy;" align="center" "height ="1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>   
-
<a href="https://2014.igem.org/Team:Penn_State/Notebook"style="color:#000000"><font color="white"> <FONT FACE="castellar"> <b> Notebook </b></FONT></font></a></td>
+
<a href="https://2014.igem.org/Team:Penn_State/Notebook"style="color:#000000"><font color="white"> <FONT FACE="castellar"> <b> WETLAB</b></FONT></font></a></td>
<td style="border:2px solid navy;" align="center"  "height=1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>  
<td style="border:2px solid navy;" align="center"  "height=1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>  
-
<a href="https://2014.igem.org/Team:Penn_State/Safety"style=" color:#000000"><font color="white"> <FONT FACE="castellar"> <b> Safety </b></FONT></font></a></td>
+
<a href="https://2014.igem.org/Team:Penn_State/Safety"style=" color:#000000"><font color="white"> <FONT FACE="castellar"> <b> SAFETY</b></FONT></font></a></td>
<td style="border:2px solid navy;" align="center"  "height=1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>  
<td style="border:2px solid navy;" align="center"  "height=1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>  
-
<a href="https://2014.igem.org/Team:Penn_State/HumanPractices2"style=" color:#000000"><font color="white"> <FONT FACE="castellar"><b> Human Practices </b></FONT></font></a></td>
+
<a href="https://2014.igem.org/Team:Penn_State/HumanPractices2"style=" color:#000000"><font color="white"> <FONT FACE="castellar"><b>HUMAN PRACTICES</b></FONT></font></a></td>
<td style="border:2px solid navy;" align="center"  "height=1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>  
<td style="border:2px solid navy;" align="center"  "height=1px" onMouseOver="this.bgColor='#0000FF'" onMouseOut="this.bgColor='#000080'" bgColor=navy>  
-
<a href="https://2014.igem.org/Team:Penn_State/Attributions"style="color:#000000"><font color="white"> <FONT FACE="castellar"><b> Attributions </b></FONT></font></a></td>
+
<a href="https://2014.igem.org/Team:Penn_State/Attributions"style="color:#000000"><font color="white"> <FONT FACE="castellar"><b>ATTRIBUTIONS</b></FONT></font></a></td>
Line 67: Line 65:
<!--end navigation menu -->
<!--end navigation menu -->
-
</tr>
 
-
 
-
 
-
</tr>
 
-
 
-
 
-
 
-
 
-
 
-
</td>
 
-
 
<tr> <td colspan="3"  height="15px"> </td></tr>
<tr> <td colspan="3"  height="15px"> </td></tr>
Line 85: Line 72:
<!--Parts Submitted to the Registry  -->
<!--Parts Submitted to the Registry  -->
-
<tr><td > <h3> Parts Submitted to the Registry </h3></td>
+
<tr><td > <h3> Parts Submitted to the Registry </h3>
-
<td ></td >
+
-
<td > <h3>What information do I need to start putting my parts on the Registry? </h3></td>
+
-
</tr>
+
-
<tr>
+
-
<td width="45%"  valign="top">
+
-
<p>
+
-
An important aspect of the iGEM competition is the use and creation of standard  biological parts. Each team will make new parts during iGEM and will submit them to the <a href="http://partsregistry.org"> Registry of Standard Biological Parts</a>. The iGEM software provides an easy way to present the parts your team has created. The "groupparts" tag will generate a table with all of the parts that your team adds to your team sandbox. 
+
-
<p>
+
<h5> Coding Sequence for BBa_K1506002 </h5>
-
<strong>Note that if you want to document a part you need to document it on the <a href="http://partsregistry.org Registry"> Registry</a>, not on your team wiki.</strong> Future teams and other users and are much more likely to find parts on the Registry than on your team wiki.
+
<p> atgcgtaaaggtgaagaactgttcactggtgttgttccgatcctggttgaactggacggtgacgttaacggtcacaaattctctgttcgtggtgaaggtg
-
</p>
+
aaggtgacgctactaacggtaaactgactctgaaattcatctgcactactggtaaactgccggttccgtggccgactctggttactactctgacttacgg
 +
tgttcagtgcttcgctcgttacccggaccacatgaaacagcacgacttcttcaaatctgctatgccggaaggttacgttcaggaacgtactatctctttc
 +
aaagacgacggtacttacaaaactcgtgctgaagttaaattcgaaggtgacactctggttaaccgtatcgaactgaaaggtatcgacttcaaagaagacg
 +
gtaacatcctgggtcacaaactggaatacaacttcaactctcacaacgtttacatcactgctgacaaacagaaaaacggtatcaaagctaacttcaaaat
 +
ccgtcacaacgttgaagacggttctgttcagctggctgaccactaccagcagaacactccgatcggtgacggtccggttctgctgccggacaaccactac
 +
ctgtctactcagtctgttctgtctaaagacccgaacgaaaaacgtgaccacatggttctgctggaattcgttactgctgctggtatcactcacggtatgg
 +
acgaactgtacaaataataa </p>  
 +
<h5> Explanation of part BBa_K1506002 </h5>
<p>
<p>
-
Remember that the goal of proper part documentation is to describe and define a part, so that it can be used without a need to refer to the primary literature. Registry users in future years should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.
+
Superfolder GFP <a href="http://parts.igem.org/Part:BBa_I746916">(part BBa_I746916)</a> has been modified so that the coding sequence contains only "fast" codons. This GFP was designed as one of five variants we optimized at the codon level using different criteria in order to develop a novel method for codon optimization.
-
</p>
+
Traditional methods of codon optimization rely primarily on the distinction between degenerate codons that are common throughout the entire genome of E. coli and those that are rare. This GFP was optimized instead using only degenerate codons that are more frequent in higher translation initiation regions of the genome, ie fast codons.
-
 
+
This criterion is based on the results of a recent project in which all the coding DNA sequences of E. coli are divided into five groups based on the naturally occurring TIR, from lowest to highest. Then, the codon usage profile of each group of genes is statistically analyzed to determine whether a codon is slow or fast. A fast codon is defined as one with high correlation between TIR and its frequency. Otherwise, it is a slow codon. 
-
 
+
Ng, C. Y., Farasat, I., Zomorrodi, A. R., Maranas, C. D. & Salis, H. M. Model-guided construction and optimization of synthetic metabolism for chemical product synthesis. Synthetic Biology Engineering Research Center Spring Retreat (2013), Berkeley, CA.
-
 
+
It is hypothesized that the groups of CDS with high TIR will hold more “fast” codons, which will lead to higher translation elongation rate and thus higher protein expression, whereas the slow regions will hold more “slow” codons leading to lower expression.</p>
-
<h3>When should you put parts into the Registry?</h3>
+
<p>
<p>
-
As soon as possible! We encourage teams to start completing documentation for their parts on the Registry as soon as you have it available. The sooner you put up your parts, the better recall you will have of all details surrounding your parts. Remember you don't need to send us the DNA to create an entry for a part on the Registry. However, you must send us the sample/DNA before the Jamboree. Only parts for which you have sent us samples/DNA are eligible for awards and medal requirements.  
+
Codons whose frequency increases with TIR are defined as fast codons. Those with declining frequency in relation to TIR are slow codons, and those with no correlation are defined as independent of TIR. This can be viewed in the figure above as the slope of the graphs for each codon showing ratio and TIR. If ratio increases with TIR, the codon is fast, and the graph displays positive slope. Slow codons slow negative slope, and TIR independent codons show essentially no slope.</p>
-
</p>
+
-
</td>
+
-
<td > </td>
 
-
<td width="45%" valign="top">
 
-
<p>
 
-
The information needed to initially create a part on the Registry is:
 
-
</p>
 
-
<ol>
 
-
 
-
<li>Part Name</li>
 
-
<li>Part type</li>
 
-
<li>Creator</li>
 
-
<li>Sequence</li>
 
-
<li>Short Description (60 characters on what the DNA does)</li>
 
-
<li>Long Description (Longer description of what the DNA does)</li>
 
-
<li>Design considerations</li>
 
-
</ol>
 
-
 
-
<p>
 
-
We encourage you to put up <em>much more</em> information as you gather it over the summer. If you have images, plots, characterization data and other information, please also put it up on the part page. Check out part <a href="http://parts.igem.org/Part:BBa_K404003">BBa_K404003</a> for an excellent example of a highly characterized part.
 
-
</p>
 
-
 
-
<p>
 
-
You can add parts to the Registry at our <a href="http://parts.igem.org/Add_a_Part_to_the_Registry"> Add a Part to the Registry</a> link.
 
-
</p>
 
-
</td>
 
-
</tr>
 
 +
<a href="http://parts.igem.org/Part:BBa_K1506002">For more information about this part, visit the iGEM registry for Penn State 2014</a></td></tr>
<tr> <td colspan="3"  height="15px"> </td></tr>
<tr> <td colspan="3"  height="15px"> </td></tr>
Line 150: Line 110:
</html>
</html>
-
<groupparts>iGEM013 Penn_State</groupparts>
+
<groupparts>iGEM014 Penn_State</groupparts>

Latest revision as of 03:06, 18 October 2014


WELCOME TO PENN STATE iGEM 2014!

Click here to edit this page!

HOME JUDGING FORM OFFICIAL PROFILE TEAM PROJECTS PARTS WETLAB SAFETY HUMAN PRACTICES ATTRIBUTIONS

Parts Submitted to the Registry

Coding Sequence for BBa_K1506002

atgcgtaaaggtgaagaactgttcactggtgttgttccgatcctggttgaactggacggtgacgttaacggtcacaaattctctgttcgtggtgaaggtg aaggtgacgctactaacggtaaactgactctgaaattcatctgcactactggtaaactgccggttccgtggccgactctggttactactctgacttacgg tgttcagtgcttcgctcgttacccggaccacatgaaacagcacgacttcttcaaatctgctatgccggaaggttacgttcaggaacgtactatctctttc aaagacgacggtacttacaaaactcgtgctgaagttaaattcgaaggtgacactctggttaaccgtatcgaactgaaaggtatcgacttcaaagaagacg gtaacatcctgggtcacaaactggaatacaacttcaactctcacaacgtttacatcactgctgacaaacagaaaaacggtatcaaagctaacttcaaaat ccgtcacaacgttgaagacggttctgttcagctggctgaccactaccagcagaacactccgatcggtgacggtccggttctgctgccggacaaccactac ctgtctactcagtctgttctgtctaaagacccgaacgaaaaacgtgaccacatggttctgctggaattcgttactgctgctggtatcactcacggtatgg acgaactgtacaaataataa

Explanation of part BBa_K1506002

Superfolder GFP (part BBa_I746916) has been modified so that the coding sequence contains only "fast" codons. This GFP was designed as one of five variants we optimized at the codon level using different criteria in order to develop a novel method for codon optimization. Traditional methods of codon optimization rely primarily on the distinction between degenerate codons that are common throughout the entire genome of E. coli and those that are rare. This GFP was optimized instead using only degenerate codons that are more frequent in higher translation initiation regions of the genome, ie fast codons. This criterion is based on the results of a recent project in which all the coding DNA sequences of E. coli are divided into five groups based on the naturally occurring TIR, from lowest to highest. Then, the codon usage profile of each group of genes is statistically analyzed to determine whether a codon is slow or fast. A fast codon is defined as one with high correlation between TIR and its frequency. Otherwise, it is a slow codon. Ng, C. Y., Farasat, I., Zomorrodi, A. R., Maranas, C. D. & Salis, H. M. Model-guided construction and optimization of synthetic metabolism for chemical product synthesis. Synthetic Biology Engineering Research Center Spring Retreat (2013), Berkeley, CA. It is hypothesized that the groups of CDS with high TIR will hold more “fast” codons, which will lead to higher translation elongation rate and thus higher protein expression, whereas the slow regions will hold more “slow” codons leading to lower expression.

Codons whose frequency increases with TIR are defined as fast codons. Those with declining frequency in relation to TIR are slow codons, and those with no correlation are defined as independent of TIR. This can be viewed in the figure above as the slope of the graphs for each codon showing ratio and TIR. If ratio increases with TIR, the codon is fast, and the graph displays positive slope. Slow codons slow negative slope, and TIR independent codons show essentially no slope.

For more information about this part, visit the iGEM registry for Penn State 2014

Parts Table

Any parts your team has created will appear in this table below:

<groupparts>iGEM014 Penn_State</groupparts>