Team:UMaryland/project/results
From 2014.igem.org
(Difference between revisions)
(11 intermediate revisions not shown) | |||
Line 63: | Line 63: | ||
<div id="header"> | <div id="header"> | ||
<div id="logo"> | <div id="logo"> | ||
- | <a href=" | + | <a href="https://2014.igem.org/Main_Page"></a> |
</div> | </div> | ||
<!-- end logo --> | <!-- end logo --> | ||
Line 71: | Line 71: | ||
<div class="top_menu"> | <div class="top_menu"> | ||
<div id="horiznav" class="horiznav"> <ul class="megalegacy menunav"> | <div id="horiznav" class="horiznav"> <ul class="megalegacy menunav"> | ||
- | <li class="item101 level0 first"><span class="mymarg"><a class="yjanchor first" href="/ | + | <li class="item101 level0 first"><span class="mymarg"><a class="yjanchor first" href="https://2014.igem.org/Team:UMaryland"><span class="yjm_has_none"><span class="yjm_title">Homepage</span></span></a></span></li><li class="item104 level0"><span class="mymarg"><a class="yjanchor " href="https://2014.igem.org/Team:UMaryland/photos"><span class="yjm_has_none"><span class="yjm_title">Photos</span></span></a></span></li><li class="haschild item105 level0"><span class="child"><a class="yjanchor " href="https://2014.igem.org/Team:UMaryland/meetourteam"><span class="yjm_has_none"><span class="yjm_title">Team</span></span></a></span><ul class="subul_main level1"><li class="bl"></li><li class="tl"></li><li class="tr"></li><li class="item293 level1 first"><span class="mymarg"><a class="yjanchor first" href="https://2014.igem.org/Team:UMaryland/meetourteam"><span class="yjm_has_none"><span class="yjm_title">Meet Our Team Members</span></span></a></span></li><li class="item116 level1"><span class="mymarg"><a class="yjanchor " href="https://igem.org/Team.cgi?id=1489"><span class="yjm_has_none"><span class="yjm_title">iGEM Page</span></span></a></span></li><li class="item117 level1"><span class="mymarg"><a class="yjanchor " href="https://2014.igem.org/Team:UMaryland/team/attributions"><span class="yjm_has_none"><span class="yjm_title">Attributions</span></span></a></span></li><li class="item300 level1 lilast"><span class="mymarg"><a class="yjanchor last" href="https://2014.igem.org/Team:UMaryland/team/sponsors"><span class="yjm_has_none"><span class="yjm_title">Sponsors</span></span></a></span></li><li class="right"></li><li class="br"></li></ul></li><li class=" active haschild item112 level0"><span class="child"><a class="yjanchor activepath yjscroll" href="https://2014.igem.org/Team:UMaryland/project/overview"><span class="yjm_has_none"><span class="yjm_title">Project</span></span></a></span><ul class="subul_main level1"><li class="bl"></li><li class="tl"></li><li class="tr"></li><li class="item138 level1 first"><span class="mymarg"><a class="yjanchor first" href="https://2014.igem.org/Team:UMaryland/project/overview"><span class="yjm_has_none"><span class="yjm_title">Overview</span></span></a></span></li><li class="item145 level1"><span class="mymarg"><a class="yjanchor " href="https://2014.igem.org/Team:UMaryland/project/background"><span class="yjm_has_none"><span class="yjm_title">Background</span></span></a></span></li><li class="item144 level1"><span class="mymarg"><a class="yjanchor " href="https://2014.igem.org/Team:UMaryland/project/biobricks"><span class="yjm_has_none"><span class="yjm_title">parts (BioBricks)</span></span></a></span></li><li id="current" class=" active item102 level1"><a class="yjanchor activepath " href="https://2014.igem.org/Team:UMaryland/project/results" target="_blank" ><span class="yjm_has_none"><span class="yjm_title">Results</span></span></a></li><li class="item254 level1"><span class="mymarg"><a class="yjanchor " href="https://2014.igem.org/Team:UMaryland/project/futureapplications"><span class="yjm_has_none"><span class="yjm_title">future applications</span></span></a></span></li><li class="item301 level1 lilast"><span class="mymarg"><a class="yjanchor last" href="https://igem.org/Safety/Safety_Form?team_id=1489"><span class="yjm_has_none"><span class="yjm_title">Safety</span></span></a></span></li><li class="right"></li><li class="br"></li></ul></li><li class="haschild item234 level0"><span class="child"><a class="yjanchor " href="https://2014.igem.org/Team:UMaryland/notebook"><span class="yjm_has_none"><span class="yjm_title">Notebook</span></span></a></span><ul class="subul_main level1"><li class="bl"></li><li class="tl"></li><li class="tr"></li><li class="item303 level1 first lilast"><span class="mymarg"><a class="yjanchor firstlast" href="https://2014.igem.org/Team:UMaryland/notebook"><span class="yjm_has_none"><span class="yjm_title">Wetlab Notebook</span></span></a></span></li><li class="right"></li><li class="br"></li></ul></li><li class="haschild item123 level0"><span class="child"><a class="yjanchor " href="https://2014.igem.org/Team:UMaryland/humanprac/overview"><span class="yjm_has_none"><span class="yjm_title">Human Practices</span></span></a></span><ul class="subul_main level1"><li class="bl"></li><li class="tl"></li><li class="tr"></li><li class="item106 level1 first"><span class="mymarg"><a class="yjanchor first" href="https://2014.igem.org/Team:UMaryland/humanprac/overview"><span class="yjm_has_none"><span class="yjm_title">Overview | Mission Statement</span></span></a></span></li><li class="haschild item129 level1"><span class="child subparent"><a class="yjanchor grouptitle" href="https://2014.igem.org/Team:UMaryland/humanprac/publicschool"><span class="yjm_has_none"><span class="yjm_title">Public School Outreach</span></span></a></span><ul class="subul_main level2"><li class="bl"></li><li class="tl"></li><li class="tr"></li><li class="item134 level2 first lilast"><span class="mymarg"><a class="yjanchor firstlast" href="https://2014.igem.org/Team:UMaryland/humanprac/publicschool"><span class="yjm_has_none"><span class="yjm_title">HighSchool</span></span></a></span></li><li class="right"></li><li class="br"></li></ul></li><li class="item131 level1"><span class="mymarg"><a class="yjanchor " href="https://2014.igem.org/Team:UMaryland/humanprac/community"><span class="yjm_has_none"><span class="yjm_title">Community Interaction</span></span></a></span></li><li class="item132 level1 lilast"><span class="mymarg"><a class="yjanchor last" href="https://2014.igem.org/Team:UMaryland/humanprac/publicawareness"><span class="yjm_has_none"><span class="yjm_title">Public Awareness</span></span></a></span></li><li class="right"></li><li class="br"></li></ul></li></ul></div> |
</div> | </div> | ||
</div> | </div> | ||
Line 107: | Line 107: | ||
<p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"><img src="https://static.igem.org/mediawiki/2014/e/e0/UMFig1-1.jpg" border="0" width="213px;" height="248px;" style="border: NaNpx solid black; transform: rotate(0.00rad); -webkit-transform: rotate(0.00rad);" /></span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"><img src="https://static.igem.org/mediawiki/2014/2/28/UMFig1-2.png" border="0" width="354px;" height="148px;" style="border: NaNpx solid black; transform: rotate(0.00rad); -webkit-transform: rotate(0.00rad);" /></span></p> | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"><img src="https://static.igem.org/mediawiki/2014/e/e0/UMFig1-1.jpg" border="0" width="213px;" height="248px;" style="border: NaNpx solid black; transform: rotate(0.00rad); -webkit-transform: rotate(0.00rad);" /></span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"><img src="https://static.igem.org/mediawiki/2014/2/28/UMFig1-2.png" border="0" width="354px;" height="148px;" style="border: NaNpx solid black; transform: rotate(0.00rad); -webkit-transform: rotate(0.00rad);" /></span></p> | ||
<p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> A B</span></p> | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> A B</span></p> | ||
- | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Fig. 1 - Bovine Galectin | + | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Fig. 1 – A: Double RE digest (EcoRI and PstI) of pBAD-Bovine Galectin 1 and OmpA-Bovine Gibson assemblies. For pBAD-BtGal1, all lanes for after ladder have bands of the correct weight, while no lanes for OmpA-Bovine are of the correct weight. B: Expected band sizes after double digest for pBAD-Bovine Galectin 1. The EcoRI cut site in the Bovine Galectin 1 gene was subsequently removed via site directed mutagenesis.</span></p> |
<p><strong id="docs-internal-guid-809a97bc-f600-9f66-fada-73accace1d98" style="font-weight: normal;"> </strong></p> | <p><strong id="docs-internal-guid-809a97bc-f600-9f66-fada-73accace1d98" style="font-weight: normal;"> </strong></p> | ||
- | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> | + | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Mammalian galectins typically have a simpler quaternary structure than invertebrate galectins; they are usually dimers while invertebrate galectins are usually tetramers. Bovine galectin 1, from Bos taurus, is a simpler galectin than CvGal1 and can thus be utilized as a model galectin to anchor in the E. coli outer membrane. In addition, while the crystal structure of CvGal1 and the exact binding ligand on P. marinus that CvGal1 binds to are still under investigation, the crystal structure and nature of bovine galectin 1 have been well studied. We have cloned Bovine galectin 1 into the pSB1C3 backbone via Gibson assembly. The bovine galectin 1 gene was ordered as a gBlock from IDT and PCR amplified for Gibson assembly. All Gibson products were verified via sequencing. </span></p> |
- | + | ||
- | + | ||
<p><strong style="font-weight: normal;"> </strong></p> | <p><strong style="font-weight: normal;"> </strong></p> | ||
<p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"><img src="https://static.igem.org/mediawiki/2014/3/3f/UMFig2-1.jpg" border="0" width="233" height="331" style="border: 0;" />A<img src="https://static.igem.org/mediawiki/2014/e/ef/UMFig2-2.png" border="0" width="354px;" height="151px;" style="border: 0; transform: rotate(0.00rad); -webkit-transform: rotate(0.00rad);" /></span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">B</span></p> | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"><img src="https://static.igem.org/mediawiki/2014/3/3f/UMFig2-1.jpg" border="0" width="233" height="331" style="border: 0;" />A<img src="https://static.igem.org/mediawiki/2014/e/ef/UMFig2-2.png" border="0" width="354px;" height="151px;" style="border: 0; transform: rotate(0.00rad); -webkit-transform: rotate(0.00rad);" /></span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">B</span></p> | ||
Line 117: | Line 115: | ||
<p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Fig. 2 - </span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">OmpA-Bovine (cut with BamHI and HindIII, before SDM)</span></p> | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Fig. 2 - </span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">OmpA-Bovine (cut with BamHI and HindIII, before SDM)</span></p> | ||
<p><strong style="font-weight: normal;"> </strong></p> | <p><strong style="font-weight: normal;"> </strong></p> | ||
- | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Figure </span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">2A</span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> shows the Bovine galectin-1 assembled into pSB1C3-pBAD-RBS as a fusion protein with OmpA. When expressed in </span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: italic; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">E. coli</span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">, the galectin should continue off the C-terminus of the OmpA-linker and thus be transported to the extracellular matrix since it is attached to the OmpA transport protein. After plasmid assembly transfer of plasmid into a DH5α </span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: italic; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">E. coli</span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> cells strain, the plasmid was extracted and digested with EcoRI and PstI. The pattern of three bands appears again due to an additional EcoRI restriction site. </span></p> | + | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Fig. 2 – Double digest of OmpA-Bovine Galectin 1 (BamHI and HindIII) Lane 3 contains bands of the correct weight after digest B: Expected band sizes after double digest for pBAD-Bovine Galectin 1. Site directed mutagenesis was subsequently performed in order to remove an EcoRI site in the Bovine galectin 1 gene. Figure </span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">2A</span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> shows the Bovine galectin-1 assembled into pSB1C3-pBAD-RBS as a fusion protein with OmpA. When expressed in </span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: italic; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">E. coli</span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">, the galectin should continue off the C-terminus of the OmpA-linker and thus be transported to the extracellular matrix since it is attached to the OmpA transport protein. After plasmid assembly transfer of plasmid into a DH5α </span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: italic; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">E. coli</span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> cells strain, the plasmid was extracted and digested with EcoRI and PstI. The pattern of three bands appears again due to an additional EcoRI restriction site. </span></p> |
<p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> </span></p> | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> </span></p> | ||
<p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> </span></p> | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> </span></p> | ||
Line 135: | Line 133: | ||
<p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">To address this issue, site-directed mutagenesis was performed on these plasmids to change the EcoRI sequence within the bovine galectin-1 gene (5’-GAATTC-3’) to 5’-GAGTTT-3’, which will code for the same Glu-Phe sequence. Figure </span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">3A</span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> and </span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">3B</span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> demonstrate the two successfully mutagenized base pairs in the bovine galectin-1 gene, while preserving the rest of the plasmid.</span></p> | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">To address this issue, site-directed mutagenesis was performed on these plasmids to change the EcoRI sequence within the bovine galectin-1 gene (5’-GAATTC-3’) to 5’-GAGTTT-3’, which will code for the same Glu-Phe sequence. Figure </span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">3A</span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> and </span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">3B</span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> demonstrate the two successfully mutagenized base pairs in the bovine galectin-1 gene, while preserving the rest of the plasmid.</span></p> | ||
<p><strong style="font-weight: normal;"> </strong></p> | <p><strong style="font-weight: normal;"> </strong></p> | ||
- | <p> <img src="https://static.igem.org/mediawiki/ | + | <p> <img src="https://static.igem.org/mediawiki/parts/a/a5/UMFinalfigureigem.jpg" border="0" width="687" height="269" style="line-height: 12.0000009536743px; cursor: se-resize !important;" /></p> |
- | <p> | + | <p> Sequencing results: |
+ | NNNNNNNNNNNNNNNNTATANAAATAGGCGTATCNCGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGG | ||
+ | ATGATTTCTGGAATTCGCGGCCGCTTCTAGAGGGCATATGAAAGCTACTAAACTGGTACTGGGCGCGGTAATCCTGGGTT | ||
+ | CTACTCTGCTGGCAGGTTGCTCCAGCAACGCTAAAATCGATCAGGGAATTAACCCGTATGTTGGCTTTGAAATGGGTTAC | ||
+ | GACTGGTTAGGTCGTATGCCGTACAAAGGCAGCGTTGAAAACGGTGCATACAAAGCTCAGGGCGTTCAACTGACCGCTAA | ||
+ | ACTGGGTTACCCAATCACTGACGACCTGGACATCTACACTCGTCTGGGTGGCATGGTATGGCGTGCAGACACTAAATCCA | ||
+ | ACGTTTATGGTAAAAACCACGACACCGGCGTTTCTCCGGTCTTCGCTGGCGGTGTTGAGTACGCGATCACTCCTGAAATC | ||
+ | GCTACCCGTCTGGAATACCAGTGGACCAACAACATCGGTGACGCACACACCATCGGCACTCGTCCGGACAACGGCGGAGG | ||
+ | TTCTGGAGGAGGGAGCTCTACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTT | ||
+ | CTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGG | ||
+ | CGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCANGNNNAACATGTGAGCA | ||
+ | AAAGGCCAGCNNAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCAT | ||
+ | CACAAAAATCGACGCTCAAGTCAGANGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGNAGCTC | ||
+ | CCTCGTGCGCTCTCCTGTTCCNACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTT | ||
+ | CTCNTAGCTCACGCTGTAGGTATCNNCANNN</p> | ||
<p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Fig 4. - <strong>S</strong></span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">equencing Results and Chromatogram of OmpA moved into pSB1C3</span></p> | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Fig 4. - <strong>S</strong></span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">equencing Results and Chromatogram of OmpA moved into pSB1C3</span></p> | ||
<p><strong style="font-weight: normal;"> </strong></p> | <p><strong style="font-weight: normal;"> </strong></p> | ||
Line 149: | Line 161: | ||
<p> </p> | <p> </p> | ||
<p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Fig. 5 - <strong>S</strong></span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">equencing Results and Chromatogram of SDM’d OmpA in pSB1C3</span></p> | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Fig. 5 - <strong>S</strong></span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">equencing Results and Chromatogram of SDM’d OmpA in pSB1C3</span></p> | ||
- | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"><br /></span><span style="line-height: 12.777777671814px;"> | + | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"><br /></span><span style="line-height: 12.777777671814px;">The previous version of Lpp-OmpA-Linker (BBa_K103006), designed for the pSB1A2 vector backbone, contained the non-traditional restriction sites NdeI (CATATG) and SacI (GAGCTC) in order to attach proteins at the N-terminus and C-terminus of OmpA, respectively. While the NdeI site is still useful for RE cloning at the N-terminus of OmpA, the implementation of the new plasmid backbone pSB1C3 has made the SacI site difficult to use. This is due to the presence of a second SacI site in the chloramphenicol acetyltransferase gene in pSB1C3. We have thus decided to mutagenize the previous SacI site on Lpp-OmpA-Linker into a KasI site in order to remove this issue. The KasI site (GGCGCC) encodes the amino acids glycine and alanine, converting the sequence of the linker from Gly-Gly-Gly-Ser-Gly-Gly-Gly-Ser to Gly-Gly-Gly-Ser-Gly-Gly-Gly-Ala. We believe this to be a sufficiently minor alteration to the unfolded linker sequence as to not affect protein function.</span></p> |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | <p><strong style="font-weight: normal;"> </strong></p> | |
- | + | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"><span style="color: #3e454c; font-family: Helvetica, Arial, 'lucida grande', tahoma, verdana, arial, sans-serif; font-size: 12px; line-height: 15.3599996566772px; background-color: #f7f7f7;"></span></span></p> | |
- | + | <p style="line-height: 12.0000009536743px;"> </p> | |
+ | <p style="line-height: 12.0000009536743px;"><img src="https://static.igem.org/mediawiki/parts/0/0c/UMBovinegalectinexpression.jpg" border="0" width="687" height="269" /></p> | ||
+ | |||
+ | <p> </p> | ||
+ | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Fig. 6 - <strong>S</strong></span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Western Blot of expression of SDM’d OmpA-BovineGalectin in pSB1C3</span></p> | ||
+ | <p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"><br /></span><span style="line-height: 12.777777671814px;">"Fig. 6 - Expression test for pBAD-Bovine galectin 1 and OmpA-Bovine galectin 1. Western Blot with anti-His antibody was done on soluble and insoluble fractions of non-induced cells and induced cells (0.2% arabinose for 21 hours). Bands can be observed in induced cells for pBAD-Bovine galectin 1 and both induced and non-induced cells for OmpA-Bovine galectin 1"</span></p> | ||
+ | |||
+ | |||
+ | |||
+ | |||
</div> | </div> | ||
Line 174: | Line 195: | ||
<div class="yjsgspathway"> | <div class="yjsgspathway"> | ||
<ul class="breadcrumb "> | <ul class="breadcrumb "> | ||
- | <li class="active"><span class="divider"><span class="icon-yjsg-marker addtips" title="You are here: "></span></span></li><li itemscope itemtype="http://data-vocabulary.org/Breadcrumb"><a href="/ | + | <li class="active"><span class="divider"><span class="icon-yjsg-marker addtips" title="You are here: "></span></span></li><li itemscope itemtype="http://data-vocabulary.org/Breadcrumb"><a href="https://2014.igem.org/Team:UMaryland" class="pathway" itemprop="url"><span itemprop="title">Home</span></a><span class="icon-yjsg-pathway"></span></li><li itemscope itemtype="http://data-vocabulary.org/Breadcrumb"><a href="https://2014.igem.org/Team:UMaryland/project/overview" class="pathway" itemprop="url"><span itemprop="title">Project</span></a></li><li itemscope itemtype="http://data-vocabulary.org/Breadcrumb"><span class="icon-yjsg-pathway"></span><span itemprop="title">Results</span></li></ul> |
</div> | </div> | ||
</div> | </div> | ||
Line 180: | Line 201: | ||
</div> | </div> | ||
<!-- end centerbottom--> | <!-- end centerbottom--> | ||
- | <div class="yjsg7_before"><div id="yjsg7" class="yjsg_grid yjsgsitew"><div id="user23" class="yjsgxhtml only_mod"><div class="yjsquare modid117"><div class="h2_holder"><h2 class="module_title"><span class="title_split titlesplit0">About</span> <span class="title_split titlesplit1">Umaryland</span></h2></div><div class="yjsquare_in"><p> | + | <div class="yjsg7_before"><div id="yjsg7" class="yjsg_grid yjsgsitew"><div id="user23" class="yjsgxhtml only_mod"><div class="yjsquare modid117"><div class="h2_holder"><h2 class="module_title"><span class="title_split titlesplit0">About</span> <span class="title_split titlesplit1">Umaryland</span></h2></div><div class="yjsquare_in"><p>UMaryland 2014 is the inaugural iGEM team of the University of Maryland, College Park. We are a combined effort of several departments and numerous faculty mentors. Although it is only our first year, we believe our hard work and dedication has paid off. We can't wait for this year's competition! GO TERPS!</p></div></div></div></div></div> <div class="footer_holders footer"><!-- footer --> |
<!-- end footer --> | <!-- end footer --> | ||
- | <script type="text/javascript"> var logo_w = '240'; var site_w = '1200'; var site_f = '13px'; var sp=' | + | <script type="text/javascript"> var logo_w = '240'; var site_w = '1200'; var site_f = '13px'; var sp='https://2014.igem.org/Team:UMaryland'; var tp ='baseline'; var compileme =0; var fontc ='baseline_73331408039633'; var bootstrapv='bootstrap2'; var yver='2'; var yjsglegacy='1'; var yjsgrtl='2'; var menuanimation='fade';var menuanimationspeed=300; var YJSG_topmenu_font = '13px'; (function($){ $(window).load(function(){ $('.horiznav').SmoothDropJQ({ contpoz:0, horizLeftOffset: 20, horizRightOffset: -20, horizTopOffset: 20, verticalTopOffset:30, verticalLeftOffset: 10, maxOutside: 50 }); }) })(jQuery); </script> |
</div> <div id="mmenu_holder"> | </div> <div id="mmenu_holder"> | ||
<span class="yjmm_select" id="yjmm_selectid">Results</span> | <span class="yjmm_select" id="yjmm_selectid">Results</span> | ||
<select id="mmenu" class="yjstyled"> | <select id="mmenu" class="yjstyled"> | ||
- | <option value="/ | + | <option value="https://2014.igem.org/Team:UMaryland"> Homepage</option> |
<option value="https://2014.igem.org/Team:UMaryland/photos"> Photos</option> | <option value="https://2014.igem.org/Team:UMaryland/photos"> Photos</option> | ||
<option value="https://2014.igem.org/Team:UMaryland/meetourteam"> Team</option> | <option value="https://2014.igem.org/Team:UMaryland/meetourteam"> Team</option> |
Latest revision as of 19:42, 17 October 2014
About Umaryland
UMaryland 2014 is the inaugural iGEM team of the University of Maryland, College Park. We are a combined effort of several departments and numerous faculty mentors. Although it is only our first year, we believe our hard work and dedication has paid off. We can't wait for this year's competition! GO TERPS!