Team:UESTC-Software/API.html
From 2014.igem.org
(Difference between revisions)
Tangying0608 (Talk | contribs) |
Tangying0608 (Talk | contribs) |
||
(One intermediate revision not shown) | |||
Line 33: | Line 33: | ||
<div class="parts" style="padding: 20px 50px 20px 100px;"> | <div class="parts" style="padding: 20px 50px 20px 100px;"> | ||
<div class="question" id="p2">Service API Documentation</div> | <div class="question" id="p2">Service API Documentation</div> | ||
- | <h2> | + | <h2>1 Main functions</h2> |
- | <h3>1. | + | <h3>1.1 Submit a Crisper-X request</h3><p>URL: getMain.php</p> |
- | <h3>1. | + | <h3>1.2 Get result</h3><p>Get the result given the request id.</p> |
<table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | <table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | ||
color: #999;max-width:400px;position: relative;margin: 20px auto;"><tbody> | color: #999;max-width:400px;position: relative;margin: 20px auto;"><tbody> | ||
Line 43: | Line 43: | ||
<tr><td class="ti">Example</td><td>POST: id=355Return: {“status”:2,“message”:“not finished yet”}</td></tr> | <tr><td class="ti">Example</td><td>POST: id=355Return: {“status”:2,“message”:“not finished yet”}</td></tr> | ||
</tbody></table> | </tbody></table> | ||
- | <h3>1. | + | <h3>1.3 Get requests History</h3> |
<p>Get requests history. Unregistered users will get the global history.</p> | <p>Get requests history. Unregistered users will get the global history.</p> | ||
<table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | <table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | ||
Line 50: | Line 50: | ||
<tr><td class="ti">POST</td><td>token</td></tr> | <tr><td class="ti">POST</td><td>token</td></tr> | ||
<tr><td class="ti">Return</td><td>Top ten records, ordered by time, in Json array style</td></tr> | <tr><td class="ti">Return</td><td>Top ten records, ordered by time, in Json array style</td></tr> | ||
- | <tr><td class="ti">Example</td><td>POST: token= | + | <tr><td class="ti">Example</td><td>POST: token=005536bf21179e54370c75b6fb136f2a<br/>Return: [{“request id”:“351”,“status”:“0”},{“request id”:“355”,“status”:“2”}]</td></tr> |
<tr><td>See also</td><td>Login [ section 2.1 ]</td></tr> | <tr><td>See also</td><td>Login [ section 2.1 ]</td></tr> | ||
</tbody></table> | </tbody></table> | ||
- | <h2> | + | <h2>2 User Management</h2> |
- | <h3>2. | + | <h3>2.1 Login</h3> |
- | <p>Login(Sign in) using Username and Password. A token will be returned | + | <p>Login(Sign in) using Username and Password. A token will be returned for future authentication.</p> |
<table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | <table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | ||
color: #999;max-width:400px;position: relative;margin: 20px auto;"><tbody> | color: #999;max-width:400px;position: relative;margin: 20px auto;"><tbody> | ||
Line 61: | Line 61: | ||
<tr><td class="ti">POST</td><td>name(username), pswd(password)</td></tr> | <tr><td class="ti">POST</td><td>name(username), pswd(password)</td></tr> | ||
<tr><td class="ti">Return</td><td>32 byte token when login succeed, or ’-’ otherwise.</td></tr> | <tr><td class="ti">Return</td><td>32 byte token when login succeed, or ’-’ otherwise.</td></tr> | ||
- | <tr><td class="ti">Example</td><td>POST: name=guest&pswd= | + | <tr><td class="ti">Example</td><td>POST: name=guest&pswd=1234<br/>Return: 005536bf21179e54370c75b6fb136f2a</td></tr> |
</tbody></table> | </tbody></table> | ||
- | <h3>2. | + | <h3>2.2 Log out</h3> |
<p>Delete user log information and Log out.</p> | <p>Delete user log information and Log out.</p> | ||
<table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | <table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | ||
Line 72: | Line 72: | ||
<tr><td class="ti">See also</td><td>Login [ section 2.1 ]</td></tr> | <tr><td class="ti">See also</td><td>Login [ section 2.1 ]</td></tr> | ||
</tbody></table> | </tbody></table> | ||
- | <h3>2. | + | <h3>2.3 Sign Up</h3> |
<p>Create a new account with username, password and email.</p> | <p>Create a new account with username, password and email.</p> | ||
<table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | <table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | ||
Line 80: | Line 80: | ||
<tr><td class="ti">Return</td><td>”Sign In Succeed” or error information.</td></tr> | <tr><td class="ti">Return</td><td>”Sign In Succeed” or error information.</td></tr> | ||
</tbody></table> | </tbody></table> | ||
- | <h3>2. | + | <h3>2.4 Update user’s Information</h3> |
<p>Update your password and/or email address.</p> | <p>Update your password and/or email address.</p> | ||
<table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | <table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | ||
Line 88: | Line 88: | ||
<tr><td class="ti">Return</td><td>’+’: ok, ’-’: failed.</td></tr> | <tr><td class="ti">Return</td><td>’+’: ok, ’-’: failed.</td></tr> | ||
</tbody></table> | </tbody></table> | ||
- | <h2> | + | <h2>3 File/Specie Upload</h2> |
- | <h3>3. | + | <h3>3.1 Check upload</h3> |
<p>Check if this token can upload files</p> | <p>Check if this token can upload files</p> | ||
<table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | <table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | ||
Line 98: | Line 98: | ||
<tr><td class="ti">Example</td><td>{”status”:1, ”message”:”Authentication failed”}</td></tr> | <tr><td class="ti">Example</td><td>{”status”:1, ”message”:”Authentication failed”}</td></tr> | ||
</tbody></table> | </tbody></table> | ||
- | <h3>3. | + | <h3>3.2 Upload file</h3> |
<p>Upload your file.</p> | <p>Upload your file.</p> | ||
<table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | <table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | ||
Line 106: | Line 106: | ||
<tr><td class="ti">Return</td><td>A(Upload succeed) or N(Something goes wrong)</td></tr> | <tr><td class="ti">Return</td><td>A(Upload succeed) or N(Something goes wrong)</td></tr> | ||
</tbody></table> | </tbody></table> | ||
- | <h3>3. | + | <h3>3.3 Import</h3> |
<p>Import data from file(s).</p> | <p>Import data from file(s).</p> | ||
<table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | <table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | ||
Line 114: | Line 114: | ||
<tr><td class="ti">Return</td><td>New specie Name(start with number), or ’N’ for ’Something goes wrong’</td></tr> | <tr><td class="ti">Return</td><td>New specie Name(start with number), or ’N’ for ’Something goes wrong’</td></tr> | ||
</tbody></table> | </tbody></table> | ||
- | <h3>3. | + | <h3>3.4 Viewmyfiles</h3> |
<p>View all my files.</p> | <p>View all my files.</p> | ||
<table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | <table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | ||
Line 123: | Line 123: | ||
<tr><td class="ti">Example</td><td>[{”fileName”:”NC 001133-chromosome1”,”note”:”Saccharomycetes’s chromosome”}]</td></tr> | <tr><td class="ti">Example</td><td>[{”fileName”:”NC 001133-chromosome1”,”note”:”Saccharomycetes’s chromosome”}]</td></tr> | ||
</tbody></table> | </tbody></table> | ||
- | <h3>3. | + | <h3>3.5 Viewmyspecies</h3> |
<p>View all my species.</p> | <p>View all my species.</p> | ||
<table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | <table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | ||
Line 132: | Line 132: | ||
<tr><td class="ti">Example</td><td>[ {”specie”:”Saccharomyces-cerevisiae”, ”PAMs”:[{”PAM”:”NGG”},{”PAM”:”NRG”}], ”chromosomes”:[{”chromosome”:”NC 001147-chromosome1”}, {”chromosome”:”NC 001147-chromosome16”} ]</td></tr> | <tr><td class="ti">Example</td><td>[ {”specie”:”Saccharomyces-cerevisiae”, ”PAMs”:[{”PAM”:”NGG”},{”PAM”:”NRG”}], ”chromosomes”:[{”chromosome”:”NC 001147-chromosome1”}, {”chromosome”:”NC 001147-chromosome16”} ]</td></tr> | ||
</tbody></table> | </tbody></table> | ||
- | <h3>3. | + | <h3>3.6 Deletemyfiles</h3> |
<p>Delete your file.</p> | <p>Delete your file.</p> | ||
<table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | <table border="1px" cellspacing="0px" style="border-collapse:collapse;word-break:break-word;border-color: #c7d3af; | ||
Line 140: | Line 140: | ||
<tr><td class="ti">Return</td><td>A(Delete succeed) or N(Something goes wrong)</td></tr> | <tr><td class="ti">Return</td><td>A(Delete succeed) or N(Something goes wrong)</td></tr> | ||
</tbody></table> | </tbody></table> | ||
- | <h3>3. | + | <h3>3.7 json.command.txt</h3> |
<p>How to write commands in Import(section 3.3) method.</p> | <p>How to write commands in Import(section 3.3) method.</p> | ||
<p>The structure of a command:</p> | <p>The structure of a command:</p> | ||
Line 153: | Line 153: | ||
<p>Example:</p> | <p>Example:</p> | ||
<p style="font-size: xx-small;text-indent: 4em;">{”specie”:”testSpecie”,”files”:[{”fileName”:”NC 012971”}],”PAM”:”NGG”}</p> | <p style="font-size: xx-small;text-indent: 4em;">{”specie”:”testSpecie”,”files”:[{”fileName”:”NC 012971”}],”PAM”:”NGG”}</p> | ||
- | <h2> | + | <h2>4 josn.txt</h2> |
- | <h3>4. | + | <h3>4.1 Input</h3> |
<pre style="font-size: xx-small;"> type 1 1=Knockout | <pre style="font-size: xx-small;"> type 1 1=Knockout | ||
specie E.coil Specie | specie E.coil Specie | ||
Line 166: | Line 166: | ||
rfc ”000000” 1 for use and 0 for not. | rfc ”000000” 1 for use and 0 for not. | ||
RFC: 10, 12, 12a, 21, 23, 25</pre> | RFC: 10, 12, 12a, 21, 23, 25</pre> | ||
- | <h3>4. | + | <h3>4.2 Input Example</h3> |
<pre style="font-size: xx-small;"> { | <pre style="font-size: xx-small;"> { | ||
“specie” : “Saccharomyces-cerevisiae”, | “specie” : “Saccharomyces-cerevisiae”, | ||
Line 173: | Line 173: | ||
“rfc” : “100101” | “rfc” : “100101” | ||
}</pre> | }</pre> | ||
- | <h3>4. | + | <h3>4.3 Output</h3> |
<pre style="font-size: xx-small;"> | <pre style="font-size: xx-small;"> | ||
status 0 Request Status. (0: ok, 1: failed, 2: still running) | status 0 Request Status. (0: ok, 1: failed, 2: still running) | ||
Line 206: | Line 206: | ||
} | } | ||
</pre> | </pre> | ||
- | <h3>4. | + | <h3>4.4 Output example when ok:</h3> |
<pre style="font-size: xx-small;"> { | <pre style="font-size: xx-small;"> { | ||
”status”: 0, | ”status”: 0, | ||
Line 325: | Line 325: | ||
<div id="logoRay" style="width:86px;height:86px;border-radius:1000px;position:fixed;bottom:-20px;z-index: 999999;"></div> | <div id="logoRay" style="width:86px;height:86px;border-radius:1000px;position:fixed;bottom:-20px;z-index: 999999;"></div> | ||
<a href="https://2014.igem.org/Team:UESTC-Software"><img src="https://static.igem.org/mediawiki/2014/e/e5/2014_UESTC_Software_logo.gif" id="logo" style="border-radius: 90px;width:100px;height:100px;position:fixed;bottom:-20px;z-index: 999999;"/></a> | <a href="https://2014.igem.org/Team:UESTC-Software"><img src="https://static.igem.org/mediawiki/2014/e/e5/2014_UESTC_Software_logo.gif" id="logo" style="border-radius: 90px;width:100px;height:100px;position:fixed;bottom:-20px;z-index: 999999;"/></a> | ||
- | <a class="iGEM" href="https://igem.org/Main_Page" style="position: fixed;top: 0;right: 0;"><img src="https://static.igem.org/mediawiki/2014/8/8d/2014-UESTC-Software-Igem.png"></a> | + | <a class="iGEM" href="https://2014.igem.org/Main_Page" style="position: fixed;top: 0;right: 0;"><img src="https://static.igem.org/mediawiki/2014/8/8d/2014-UESTC-Software-Igem.png"></a> |
</div> | </div> | ||
<script type="text/javascript"> | <script type="text/javascript"> |
Latest revision as of 18:11, 17 October 2014
API Documentation
Service API Documentation
1 Main functions
1.1 Submit a Crisper-X request
URL: getMain.php
1.2 Get result
Get the result given the request id.
URL | getResult.php |
POST | id |
Return | Result in json style,with status=0, 1, 2 means ok, error and not finished respectively. |
Example | POST: id=355Return: {“status”:2,“message”:“not finished yet”} |
1.3 Get requests History
Get requests history. Unregistered users will get the global history.
URL | getHistory.php |
POST | token |
Return | Top ten records, ordered by time, in Json array style |
Example | POST: token=005536bf21179e54370c75b6fb136f2a Return: [{“request id”:“351”,“status”:“0”},{“request id”:“355”,“status”:“2”}] |
See also | Login [ section 2.1 ] |
2 User Management
2.1 Login
Login(Sign in) using Username and Password. A token will be returned for future authentication.
URL | login/ |
POST | name(username), pswd(password) |
Return | 32 byte token when login succeed, or ’-’ otherwise. |
Example | POST: name=guest&pswd=1234 Return: 005536bf21179e54370c75b6fb136f2a |
2.2 Log out
Delete user log information and Log out.
URL | login/logout.php |
POST | token |
Return | Nothing. |
See also | Login [ section 2.1 ] |
2.3 Sign Up
Create a new account with username, password and email.
URL | login/signup.php |
POST | name(username, unique),pswd(password, encrypt using md5),email(unique). |
Return | ”Sign In Succeed” or error information. |
2.4 Update user’s Information
Update your password and/or email address.
URL | login/signup.php |
POST | name(username),pswd(old password),newpswd(new password *),newemail(new email *),* Not necessary |
Return | ’+’: ok, ’-’: failed. |
3 File/Specie Upload
3.1 Check upload
Check if this token can upload files
URL | upload/check.php |
POST | status=0(Yes)/1(No) and message if status=1 in JSON. |
Return | ’+’: ok, ’-’: failed. |
Example | {”status”:1, ”message”:”Authentication failed”} |
3.2 Upload file
Upload your file.
URL | upload/ |
POST | token, filename(no longer than 255),note(no longer than 1000), file |
Return | A(Upload succeed) or N(Something goes wrong) |
3.3 Import
Import data from file(s).
URL | upload/import.php |
POST | token, command(in json, see section3.7) |
Return | New specie Name(start with number), or ’N’ for ’Something goes wrong’ |
3.4 Viewmyfiles
View all my files.
URL | upload/viewmyfiles.php |
POST | token |
Return | All my files in JSON Array Style |
Example | [{”fileName”:”NC 001133-chromosome1”,”note”:”Saccharomycetes’s chromosome”}] |
3.5 Viewmyspecies
View all my species.
URL | upload/viewmyspecies.php |
POST | token |
Return | All my species in JSON Array Style |
Example | [ {”specie”:”Saccharomyces-cerevisiae”, ”PAMs”:[{”PAM”:”NGG”},{”PAM”:”NRG”}], ”chromosomes”:[{”chromosome”:”NC 001147-chromosome1”}, {”chromosome”:”NC 001147-chromosome16”} ] |
3.6 Deletemyfiles
Delete your file.
URL | upload/deletemyfiles.php |
POST | token, filename |
Return | A(Delete succeed) or N(Something goes wrong) |
3.7 json.command.txt
How to write commands in Import(section 3.3) method.
The structure of a command:
{ specie varchar(96) Name of the new Specie. files array All correlative chromosome files(.fna). [ fileName varchar(255) File name ] PAM varchar(20) PAM }
Example:
{”specie”:”testSpecie”,”files”:[{”fileName”:”NC 012971”}],”PAM”:”NGG”}
4 josn.txt
4.1 Input
type 1 1=Knockout specie E.coil Specie gene thrA Gene Name location Chr2:336..2798 Location pam NGG PAM Sequence [1] r1 0.65 r1, r2=1-r1 length 20 nt length region ”0000” Region filter. 1 for in and 0 for out. EXON,INTRON,UTR,INTERGENIC rfc ”000000” 1 for use and 0 for not. RFC: 10, 12, 12a, 21, 23, 25
4.2 Input Example
{ “specie” : “Saccharomyces-cerevisiae”, “location” : “NC 001144-chromosome12:1..500”, “pam” : “NGG”, “rfc” : “100101” }
4.3 Output
status 0 Request Status. (0: ok, 1: failed, 2: still running) message no args Return message specie E.coil Specie gene thrA Gene name location Chr2:336..2798 Location region array[] Selected sequence information { endpoint 1807 Region end point description intergenic Region information } result array[] Top 50 Only { grna TC. . . CGG(20) sgRNA sequence position Chr2:15413205 Location strand + Which DNA chain (+/-) region exon Region of this sgRNA total score 86 Sguide Sspe 93 Sspe Seff 7 Seff count 2 Nmm offtarget array[] Top 20 Only { osequence CT. . . TGGG(20) possible-offtarget sgRNA sequence oscore 3.5 Smm omms 4 Nmm oposition Chr3:4158 Location of po-sgRNA ostrand + Which DNA chain (+/-) oregion Intergenic Region of this sgRNA } }
4.4 Output example when ok:
{ ”status”: 0, ”message”: { ”specie”: ”E.coli”, ”kind”: ”E.coli K12-MG1655”, ”gene”: ””, ”location”: ”1:336..2798” }, ”result”: [{”key”: ”#1”, ”grna”: ”GAAGTTCGGCGGTACATCAGTGG”, ”position”: ”1:368”, ”total score”: 100, ”count”: 0, ”offtarget”: [] }, { ”key”: ”#2”, ”grna”: ”TAATGAAAAAGGCGAACTGGTGG”, ”position”: ”1:935”, ”total score”: 100, ”count”: 0, ”offtarget”: [] }, { ”key”: ”#3”, ”grna”: ”TGGAAAGCAATGCCAGGCAGGGG”, ”position”: ”1:427”, ”total score”: 100, ”count”: 0, ”offtarget”: [] }, { ”key”: ”#4”, ”grna”: ”CAAAATCACCAACCACCTGGTGG”, ”position”: ”1:479”, ”total score”: 100, ”count”: 0, ”offtarget”: [] },{ ”key”: ”#44”, ”grna”: ”ATTTTTGCCGAACTTTTGACGGG”, ”position”: ”1:564”, ”total score”: 91, ”count”: 2, ”offtarget”: [{ ”osequence”: ”ATTTTCGCCAAACATTTGGCAGG”, ”oscore”: 0.954750, ”omms”: 4, ”ostrand”: ”-”, ”oposition”: ”1:1924344”, ”oregion”: ”exco” }, { ”osequence”: ”ATTGTTGCGCAACTTTTGGCTGG”, ”oscore”: 0.480417, ”omms”: 4, ”ostrand”: ”-”, ”oposition”: ”1:3827949”, ”oregion”: ”exco” }] }] }
4.5 Output example when failed:
{ “status”: 1, “message”: “illegal args” }
4.6 Appendix. Equations
R=A,G; M=A,C; W=A,T; S=C,G; K=G,T; Y=C,T; H=A,C,T; V=A,C,G; B=C,G,T; D=A,G,T; N=A, G, C, T
Documentation & Download
Service API Documentation