Team:AMU-Poznan/Modeling

From 2014.igem.org

(Difference between revisions)
 
(13 intermediate revisions not shown)
Line 34: Line 34:
<td width="162px" align="center" onMouseOver="this.bgColor='#FEE5AD'" onMouseOut="this.bgColor='#e9eaed'" bgColor=#e9eaed >   
<td width="162px" align="center" onMouseOver="this.bgColor='#FEE5AD'" onMouseOut="this.bgColor='#e9eaed'" bgColor=#e9eaed >   
-
<a href="https://2014.igem.org/WikitemplateB_notebook" style="text-decoration:none;color:#1C140D">NOTEBOOK </a> </td>
+
<a href="https://2014.igem.org/Team:AMU-Poznan/Notebook" style="text-decoration:none;color:#1C140D">NOTEBOOK </a> </td>
<td width="162px" align="center" onMouseOver="this.bgColor='#FEE5AD'" onMouseOut="this.bgColor='#e9eaed'" bgColor=#e9eaed >   
<td width="162px" align="center" onMouseOver="this.bgColor='#FEE5AD'" onMouseOut="this.bgColor='#e9eaed'" bgColor=#e9eaed >   
-
<a href="https://2014.igem.org/WikitemplateB_safety" style="text-decoration:none;color:#1C140D">SAFETY </a></td>
+
<a href="https://2014.igem.org/wiki/index.php?title=Team:AMU-Poznan/Safety" style="text-decoration:none;color:#1C140D">SAFETY </a></td>
<td width="162px" align="center" onMouseOver="this.bgColor='#FEE5AD'" onMouseOut="this.bgColor='#e9eaed'" bgColor=#e9eaed >   
<td width="162px" align="center" onMouseOver="this.bgColor='#FEE5AD'" onMouseOut="this.bgColor='#e9eaed'" bgColor=#e9eaed >   
Line 57: Line 57:
</table>
</table>
</div>
</div>
 +
</br> Here we present Survey results and Modeling results (for Modeling results please scroll down the page)</br>
 +
 +
<br /><h1>Survey</h1><br /><br />
 +
14.10.2014<br />
 +
31 survey responses:<br />
 +
</br></br>what survey answerers think that RNAi is</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/d/d9/Chart10.png" width="60%"></br>
 +
</br></br>what they think that sh-miRs are</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/0/03/Chart8.png" width="60%"></br>
 +
</br></br>what they think that shRNAs are</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/4/47/Chart9.png" width="60%"></br>
 +
</br></br>what literature do they know about sh-miRs</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/6/69/Chart7.png" width="60%"></br>
 +
 +
 +
</br></br>what they find important in bioinformatic software</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/0/0a/Chart6.png" width="60%"></br>
 +
</br></br>what they find important in sh-miR designer</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/9/96/Chart4.png" width="60%"></br>
 +
</br></br>how long will they wait for software response</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/b/b4/Chart5.png" width="60%"></br>
 +
</br></br>survey answerers</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/b/b7/Chart1.png" width="60%"></br>
 +
</br></br>their sex</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/9/9b/Chart2.png" width="60%"></br>
 +
</br></br>and age</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/8/89/Chart3.png" width="60%"></br>
 +
<h3>Conclusions</h3>
 +
</br>
 +
Knowledge of RNAi is good. however people do not know what exactly sh-miR is.</br>
 +
Users are eager to wait up to 8h, 24h only 50% and 2 days only 20% (work without software will take 2 days).</br>
 +
What are the most important features of bioinformatic software:</br>
 +
user-friendly interface</br>
 +
documentation</br>
 +
easy user-guide</br>
 +
fast response from software</br></br>
 +
what is important in shmiR designer:</br>
 +
speed of software</br>
 +
possibilty to choose miRNA scaffold</br>
 +
experimental evaluation</br>
 +
</br></br></br>
 +
<h1>Modeling</h1>
 +
</br>
 +
<p>We decided to pay more attention to model sh-miR molecules with different RNA 2D structure prediction software (we use RNAfold in our software). Here are our results (however we only show modeling of one molecule the conclusions are obvious - we performed folding for over 10 molecules):</p>
 +
</br></br>
 +
example analyzed sequence:
 +
</br>CTAAAGAAGGTATATTGCTGTTGACAGTGAGCGACTGUUUGUAUUCGCCCUAGCGCCTGTGAAGCCACAGATGGGGCGCUAUGGCGAAUACAAACATGCC</br>TACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCA</br>
 +
We always take first generated structure made with default options</br>
 +
If there is difference in algorithm we always take RNA folding over DNA folding</br>
 +
mfold</br>
 +
<img src="https://static.igem.org/mediawiki/2014/2/20/Mfold.png" width="60%">
 +
</br>
 +
RNAstructure</br>
 +
<img src="https://static.igem.org/mediawiki/2014/2/22/RNAstructure.jpeg" width="60%">
 +
</br>
 +
RNAfold</br>
 +
<img src="https://static.igem.org/mediawiki/2014/6/61/Rnafold.png" width="60%">
 +
</br>
 +
</br>
 +
<img src="" width="60%">
 +
</br>
 +
</br>
 +
<img src="" width="60%">
 +
</br>
 +
</br>
 +
<img src="" width="60%">
 +
</br>
 +
<h3>Conclusions</h3>
 +
</br>
 +
Different algorithms gives very different results. To have the most reliable structure it recommended to check the structure</br>
 +
with different software.</br>
 +
</br>
<div class="footer">
<div class="footer">
<br>
<br>

Latest revision as of 21:02, 16 October 2014

Retrieved from "http://2014.igem.org/Team:AMU-Poznan/Modeling"