From 2014.igem.org

(Difference between revisions)

Latest revision as of 01:05, 18 October 2014

Select a Lab Member

Eleanor's Lab Notebook

June 9, 2014

PCR for Constitutive Promoters (pTEF1(M6))

Materials	1x reaction	4.5x Master Mix
5x Phusion HF Buffer	10 µl	45 µl
dNTP's (10 mM)	1 µl	4.5 µl
Forward Primer (10µm)	2.5 µl	11.25 µl
Reverse Primer (10µm)	2.5 µl	11.25 µl
*Template DNA	0.3 µl	1.35 µl
Phusion Polymerase	0.5 µl	2.25 µl
Water	33.2 µl	149.4 µl

Total	50 µl	225 µl

*Added everything to template DNA. oops

Mix materials in a 4.5x Master Mix on ice. Mix well.
Pipetter 50 µl from the Master Mix into 4 labeled PCR tubes

Thermocycler for :

Initial Duration   | 98° C | 30s 
  35 Cycles of: 
      Denaturation | 98° C | 10s
      Annealing    | 55° C | 20s
      Extension    | 72° C | 30s
Final Extension    | 72° C | 5m
Hold               | 4°  C | Forever

Keep Samples for gel extraction on tje next day

June 10, 2014

Gel of Constitutive Promoters

Add 5 µl Bluejuice 10x to each of the tubes
Load all on gel.

Constitutive Promoters Gel

Gel Extraction

QlAquick Gel Extraction Kit

Cut Gel
Weigh it in a colorless tube
Add 3 volumes Buffer Q G to 1 volime Gel (100mg ~ 100µl)
Incubate @ 50° C for 10 min or until completely dissolved (vortex every 2-3 min to help dissolve)
Add 1 gel volume isopropanal to the sample and mix
Place a QlAquick soin column in a provided 2ml collection tube
Place sample in column & spin for 1 min --> discard flow through
To wash add 0.75 ml Buffer PE to column & centrifue for 1 min, then dry spin
Place column in 1.5 ml tube
Add 35µl H2O & centrifuge for 1 min.

Restriction Enzyme Digest with APA1

40 µl DNA
5 µl Cutsmart
0.5 µl APA1 Room Teperature Overnight

June 11, 2014

Digest with Xho1

-0.5µl let sit for a few hours

PCR Purification

5 volumes of Buffer PB (with ethanol) to 1 volume PCR sample
Apply sample to column and spin for 1 min
Discard flow through
To wash add 0.75 ml of Buffer PE to column and centrifuge for 1 min
Discard flow through and place column back in the same tube
Cetrifuge for an addtitional minute (Dry Spin)
Place column in clean 1.5 ml tube
[Elute DNA] Add 30µl water to column, let stand for 1 min and centrifuge for 1 min

M6 + PSV606 ligation

1:3 backbone + insert

insert concentration: 138 ng/µl

Reagents	1x
10x ligase buffer	1.0µl
DNA Backbone (PSV606)	0.2µl
Insert	0.2µl
T4 DNA Ligase	0.5µl
H2O	8.1µl

Total	10 µl

Room Temperature for 2 hours

E. Coli Transformation

 - 10 µl ligation
 - 50 µl competent cells
     --> 30m on ice
     --> 45s heatshock 42° C
     --> 2m on ice
 - 250 µl of SOC media
     --> 1h shake 37° C
 Plate

June 12, 2014

Colonies didn't grow
- Possibly because Kara gave us cheap cells to use
Redo:
- ligation - 0.4 µl backbone & 7.9 µl H2O
- transformation - used more expensive competent cells

June 13, 2014

Yeast Transformation (CB008 + Inducible Promoters)

Reagents
YPD
1 M LiOAc
10X TE pH 7.5
1X TE pH 7.5, 0.1 M LiOAc
50% PEG 3350
DMSO
Salmon Sperm DNA (ssDNA)

PEG = viscous, pipette slow
boil ssDNA aliquots

Previous Day : Grow yeast strain to be transformed in 5-10 mL YPD overnight at 30° C

Set up digest to linearize DNA
Dilute O/N culture ~ 1:20 in YPD grow 2-4 hours at 30° C
Prepare ssDNA - boil for 10m cool on ice for at least 10m (10 µl of 10 mg/mL stock per transformation)
Harvest cells in centrifuge - 3000 rpm, 2-5 min
Wash with 1 ml 0.1 M LiOAin TE
Pellet cells - 3000 rpm , 2-5 min
Resuspend pellet in 100 µl 0.1 M LiOAc in TE per 2.5 ml culture, split into 100 µl per epindorph tube for each transformation
to 100 µl cells add 100 µg ssDNA (10 µl of 10 mg/mL sock), 1-5 µl target DNA
Add (in order): 480 µl 50% PEG 3350, 60 µl 10X TE, 60 µl 1 M LiOAc (for final 40% PEG, 1X TE, 0.1 M LiOAc) Optional: Add 75 µl DMSO definitely did
Vortex
Incubate 42° C for 30m & begin drying plates
Pellet (6000 rpm - 2m), discard supernatant (remove PEG completely by pipetting), resuspend in 500 µl YPD (or selective media)
Pellet, discard supernatant, resuspend in risidual ~ 50 µl YPD
Plate on selective media
Incubate 1-3 days

June 16, 2014

Colony PCR for screening E. Coli (Constitutive promoters + GFP)

Pick single colonies ( 5 from each plate ) mix in 25 µl H2O in a tube. Use 5 µl in PCR reaction

Reagents	1X	6X
2X GoTaq Green PCR Master Mix	10 µl	60 µl
10 µM Forward primer	1 µl	6 µl
10 µM Reverse primer	1 µl	6 µl
Water	3 µl	18 µl
Bacterial cells (template)	5 µl	-----

Cycle:

95° C | 5m

   30x:
        95° C | 45s
        55° C | 30s
        72° C | 1m per kb

72° C | 10m 
 4° C | Forever

load 5 µl onto gel

for all positive bands - take the rest of the cells from step 1 and inoculate them into an overnight LB (+antibiotic) for miniprep

Colony PCR for E. Coli 6/16/14

Colony PCR for Yeast & Patching

Number colonies
Patch on plate
Mix in 10 µl NaOH
Boil for 20m
PCR

Cycle:

95° C | 5m

   30x:
        95° C | 45s
        55° C | 30s
        72° C | 1m per kb

72° C | 10m 
 4° C | Forever

Only 9 lanes worked Gel 1: SAG(1), ~~PRM3(1)~~, ASG7(1), ~~PRM3(3)~~, PCL2(2) [PRM3 mislabeled possibility of one being PRM6. unusable. Gel 2: EXM18(1), ECM18(2), PRM2(3), CLG(3) will redo

June 17, 2014

CB008(x)	CB008DB(DB)
CLG1	PRM1
PRM1	YDR124W
PRM3	PRM6
PRM2	HYM1
ECM18	PCL2
YDR124W	SAG1
PRM6	PRM3
--------	ASG7

Create new template by picking off patch plate
also pick 2 new colonies (4&5) from original growth plate and create new patch plate

Gel Photos

Colony PCR for Yeast Inducible Promoters 6/17/14

June 18, 2014

Frozen Glycerol Stocks Yeast

1) Grow Overnight in YPD (2-5 mL) then dilute 1:20 in YPD, grow to OD 0.4-0.5 2) Add 350 µl cells to 350 µl sterile 60% glycerol in cryovial, vortex to mix, snap freeze in liquid nitrogen and store at -80° C (but actually we just stuck it in the freezer because nobody will let us use liquid nitrogen).

Constitutive Promoters Miniprep

Resuspend pelleted bacterial cells in 250 µl Buffer PI and transfer to a microcentrifuge tube.
Add 250 µl Buffer P2 and gently invert tube 4-6 times to mix
Add 350 µl Buffer N3 and invert immediately 4-6 times
Centrifuge for 10 min at 13,000 rpm
Add supernatant to QIAprep spin column
Centrifuge for 30-60s - Discard flow through
Wash QIAprep spin column by adding 0.5 ml Buffer PB and centrifuging for 30-60s - Discard flow through
Wash column by adding 0.75 ml Buffer PE and centrifuginh for 30-60s
Discard flow through and centrifuge for an additional 1 min to remove residual wash buffer
Place column in clean 1.5 ml microcentrifuge tube. To elute DNA add 50 µl water or buffer EB, let stand for 1 min and centrifuge for 1 min.

June 19, 2014

Adding α Factor to CB008 Promoters and Flow Cytometry

Concentrations of α factor 3mM stock 0, 1 nm, 10 nm, 100 nm, 1 µm We want to use 10 µl of 100x concentration 100nm, 1000nm, 10 µm, 100 µm

Amount of reagents	desired concentration
30µl of 3mM + 870 µl H2O	100 uM
50 µl of 100 µm + 450 H2O	10 µM
50 µl of 10 µm + 450 H20	1000 nM
50 µl of 1000 nm + 450 H2O	100nM

1   2   3   4   5   6   7   8   9   10  11  12
A   [------NEG------]       [------NEG-------]
B   [------PRM2-----]       [------PRM1------]
C   [------ASG7-----]       [------EMC18-----]
D   [------PCL2-----]       [------PRM3------]
E   [------NEG------]       [------SAG1------]
F   [------CLG1-----]
G   [------YDR124W--]
H   [------PRM6-----]

Protocol : Night Before - Start overnight culture in SD coplete media (not YPD)

Day of: 1. Dilute cultures to final ~OD 0.05 - 0.1 in the 96 well shaker plate (saturated culture) should be ~OD 7 2. Allow cells to enter growth stage by putting on plate shaker for 3 hrs at 100 rpm 30° C 3. Induce w/ α factor concentrations [0 , 1nm, 10nm, 100nm, 1µm] 4. Allow induction to proceed on shaker for 90 min to 2 hrs 5. Transfer 250 µl of each culture to 96 well flow cytometry V-bottom plate using a multichannel pipette. Also arrested cells w/ cyclohexiimide - 10ml/well 6. Run on Flow Cytometer - Check fluid levels, press run - check voltage 7. Analyze data -> FloJo/MatLab

Flow Voltages Inspector : FSC: 250 SSC: 280 FITC: 550

Everything

yGEM16

June 20, 2014

Yeast Transformation w/ Constitutive Promoters

PTEF1, M3, M6, M7, M10 in CB008 and CB008DB

Linearize Plasmids - PSV606 10 µl DNA 5 µl Cutsmart Buffer 1 µl PME1 34 µl H2O 37 ° C for 2 hours

Procedure the same as June 13, 2014

June 23, 2014

Colony PCR and Gels (Constitutive Yeast)

protocol same as June 16

Gel Picture

Overnight Cultures in 5 ml YPD

June 25, 2014

Glycerol Stocks of Constitutive Promoters in Yeast

dilute cultures ~ 1:20 4-5 hours before
420 µl of 50% glycerol + 350 µl cells
vortex
store in -80° C freezer

m3 leaked during dilution

Parts Registry Inducible Promoters PCR with pSB1C3 overhang

Reagents	1x	12x
5x phusion HF Buffer	10 µl	120 µl
dNTP's (10 mM)	1 µl	12 µl
Phusion Polymerase	0.5 µl	6 µl
Water	33.2 µl	398.4

  .3 µl template DNA 
  44.7 µl master mix
  2.5 µl FW Primer
  2.5 µl RV Primer


    Initial Denaturation  | 98° C | 30s 
      35 Cycles of: 
          Denaturation    | 98° C | 10s
          Annealing       | 55° C | 20s
          Extension       | 72° C | 30s
    Final Extension       | 72° C | 5m
    Hold                  | 4°  C | Forever

25µl sybersafe used when pouring gel

Gel Picture

«Only pGEM's 2 & 3 worked»

June 26, 2014

PCR Constitutive and Inducible Promoters with PSB1C3 overhang

« pGEM's 1,4,5,6,7,8,9,10,11,12,13,14,15,16 »

Reagents	1x	17X
Template DNA	0.3 µl	N/A
FW Primer	2.5 µl	N/A
RV Primer	2.5 µl	N/A
DMSO	1.5 µl	25.5 µl
5x Phusion HF Buffer	10 µl	170 µl
dNTP's	1 µl	17 µl
Phusion Polymerase	0.5 µl	8.5 µl
Water	31.7 µl	538.9 µl

   Initial Denaturation   | 98° C | 30s 
      35 Cycles of: 
          Denaturation    | 98° C | 10s
          Annealing       | 55° C | 20s
          Extension       | 72° C | 30s
    Final Extension       | 72° C | 5m
    Hold                  | 4°  C | Forever

June 27, 2014

Gel Picture

«Still need to redo pGEM 5,6,8»

Constitutive Promoter Digest

pGEM12 - pGEM16

Removing GFP to insert rtTA

Not1 HF & Xho1

Reagents 1x

DNA 15 µl

Cutsmart 2.5 µl

Xho1 0.5 µl

Not1 HF 0.5 µl

6.5 µl H20

incubate at 37° C for ~ 2 hours

Parts Registry PCR Redo & PCR Purification

«Same protocol as on the 26th»

Gel Picture

#finally

PCR Purification (pGEM 1,2,3,4,7,9,10-16) ( Same as June 11)

5 volumes of Buffer PB (with ethanol) to 1 volume PCR sample
Apply sample to column and spin for 1 min
Discard flow through
To wash add 0.75 ml of Buffer PE to column and centrifuge for 1 min
Discard flow through and place column back in the same tube
Cetrifuge for an addtitional minute (Dry Spin)
Place column in clean 1.5 ml tube
[Elute DNA] Add 30µl water to column, let stand for 1 min and centrifuge for 1 min

Gibson Assembly

Reagents	1X
pSB1C3 (25ng/µl)	2 µl
insert	3 µl
Gibson Master Mix	5 µl

50° C fro 1 hour -> ice

Transformation

    10µl Gibson
    25 µl Mach I cells

    30 m ice
    45 s heat shock (42° C)

    2 m ice
    +250 SOC Media

    1 hr. 37°C

    Plate on LB + CAM 
    Keep in drawer over the weekend

Didn't Work

June 30, 2014

Colony PCR for Yeast ( pTET GFP & pAGA GFP CB008 + CB008 DB )

Number colonies
Patch on plate
Mix in 10 µl NaOH
Boil for 20m
PCR

Cycle:

95° C | 5m

   30x:
        95° C | 45s
        55° C | 30s
        72° C | 1m per kb

72° C | 10m 
 4° C | Forever

pTET patch plate -leu had an orange and tellow stripe which was kind of sketchy. It isnt growing either so we are going to replate from one of the original colonies just to check. (7/2/14)

Primers Used - pAGA - regular pSV606 primers pTET - pTET primers

July 1, 2014

pTET-GFP/pAGA-GFP Colony PCR's

Gel Picture

Making iGEM Backbone

5 tubes - 50 µl reaction each

Reagents	1x	5x
Phusion Polymerase	0.5 µl	2.5 µl
Template DNA	1 µl	5 µl
Phusion HF Buffer	10 µl	50 µl
dNTP's	1 µl	5 µl
FW Primer (SB prep 3P1)	2.5 µl	12.5 µl
RV Primer (SB Prep 2-Ga)	2.5 µl	12.5 µl
Water	32.5 µl	162.5 µl

*iGEM provides different template DNA than pSB1C3

Initial Denaturation   | 98° C | 30s 
      35 Cycles of: 
          Denaturation    | 98° C | 10s
          Annealing       | 55° C | 20s
          Extension       | 72° C | 30s
    Final Extension       | 72° C | 5m
    Hold                  | 4°  C | Forever

Different times for a bulk reaction but we went with the one above

-Failed

Redone 7/2/14 using pSB1C3 as template 7/2/14

July 2, 2014

Glycerol Stocks for pTET-GFP & pAGA-GFP

«still need to check if pTET is okay (patch plate)»

PCR Cleanup of pSB1C3

5 volumes of Buffer PB (with ethanol) to 1 volume PCR sample
Apply sample to column and spin for 1 min
Discard flow through
To wash add 0.75 ml of Buffer PE to column and centrifuge for 1 min
Discard flow through and place column back in the same tube
Cetrifuge for an addtitional minute (Dry Spin)
Place column in clean 1.5 ml tube
[Elute DNA] Add 30µl water to column, let stand for 1 min and centrifuge for 1 min

Digestion of pGEM insert with pSB1C3 overhang and pSB1C3 backbone

Gibson didn't work, so we are going the standard "cut & paste" route

Reaction is as follows:

            5 µl cutsmart
            1 µl enzymes
            _ µl H20
            _ µl DNA
        + ___________
           50 µl Total 

 We want 1000 ng of DNA

pGEM #	concentration	µl for digestion	µl H20
1	245.1 ng/µl	4.1 µl	39.9 µl
2	116.9 ng/µl	8.6 µl	35.4 µl
3	81.77 ng/µl	12.3 µl	31.7 µl
4	87.00 ng/µl	11.5 µl	32.5 µl
5	12.26 ng/µl	81µl* (30µl)	14 µl
6	60.79 ng/µl	16.45 µl	27.5 µl
8	55.62 ng/µl	18 µl	26 µl
9	87.86 ng/µl	11.38 µl	32.62 µl
10	25.02 ng/µl	40µl* (30µl)	14 µl
11	54.95 ng/µl	18.2 µl	25.8 µl
12	45.29 ng/µl	22.1 µl	21.9 µl
13	55.37 ng/µl	18.06 µl	25.94 µl
14	35.62 ng/µl	28.07 µl	15.93 µl
15	107.1 ng/µl	9.3 µl	34.7 µl
16	24.08 ng/µl	41.52µl* (30 µl)	14 µl

37° C for 2 hours or overnight

Wanted to keep DNA 30 µl or under*

«pGEM7 wasn't used because it isnt biobrick compatible»

July 3 - July 6, 2014

-out- Check Roberts Lab Notebook for what happened

(He ligated and transformed)

July 7, 2014

All plates grew including the negative control.

Colony PCR

Pick single colonies ( 5 or so from each plate ) mix in 25 µl H2O in a tube. Use 5 µl in PCR reaction

Reagents	1X	6X
2X GoTaq Green PCR Master Mix	10 µl	60 µl
10 µM Forward primer	1 µl	6 µl
10 µM Reverse primer	1 µl	6 µl
Water	3 µl	18 µl
Bacterial cells (template)	5 µl	-----

Cycle:

95° C | 5m

   30x:
        95° C | 45s
        55° C | 30s
        72° C | 1m per kb

72° C | 10m 
 4° C | Forever

Gel Picture

Made liquid cultures of ones that worked Re - Colony PCR pGEM 3,10,13

July 8, 2014

Liquid cultures didn't work

Used LB-Carb instead of LB Cam -oops- Re-Culturing

Colony PCR (Redo pGEM's 3, 10, 13)

Gel Picture

Made cultures of 3 & 10
Redo 13 (13.7-13.11 labelled 1-5)

Gel Picture

July 9, 2014

Parts Registry Miniprep

pGEM #	Colony #
1	1
2	1
3	4
4	1
5	1
6	1
7	1
8	1
9	1
10	4
11	1
12	1
14	1
15	1
16	1

Resuspend pelleted bacterial cells in 250 µl Buffer PI and transfer to a microcentrifuge tube.
Add 250 µl Buffer P2 and gently invert tube 4-6 times to mix
Add 350 µl Buffer N3 and invert immediately 4-6 times
Centrifuge for 10 min at 13,000 rpm
Add supernatant to QIAprep spin column
Centrifuge for 30-60s - Discard flow through
Wash QIAprep spin column by adding 0.5 ml Buffer PB and centrifuging for 30-60s - Discard flow through
Wash column by adding 0.75 ml Buffer PE and centrifuginh for 30-60s
Discard flow through and centrifuge for an additional 1 min to remove residual wash buffer
Place column in clean 1.5 ml microcentrifuge tube. To elute DNA add 50 µl water or buffer EB, let stand for 1 min and centrifuge for 1 min.

Transformation of pGEM 13

10µl plasmid
25 µl cells

30m on ice
45s heat shock
2m on ice

+250 µl SOC Media

1hr. 37° C
Plate on LB CAM

July 10, 2014

Colony PCR and overnight cultures

Gel Picture

( shared gel with Jessica )

July 11, 2014

Miniprep pGEM 13

Resuspend pelleted bacterial cells in 250 µl Buffer PI and transfer to a microcentrifuge tube.
Add 250 µl Buffer P2 and gently invert tube 4-6 times to mix
Add 350 µl Buffer N3 and invert immediately 4-6 times
Centrifuge for 10 min at 13,000 rpm
Add supernatant to QIAprep spin column
Centrifuge for 30-60s - Discard flow through
Wash QIAprep spin column by adding 0.5 ml Buffer PB and centrifuging for 30-60s - Discard flow through
Wash column by adding 0.75 ml Buffer PE and centrifuginh for 30-60s
Discard flow through and centrifuge for an additional 1 min to remove residual wash buffer
Place column in clean 1.5 ml microcentrifuge tube. To elute DNA add 50 µl water or buffer EB, let stand for 1 min and centrifuge for 1 min.

July 12, 2014

Check Sequencing and nanodrop of all parts(concentrations written on tubes)

July 17, 2014

500µl Carb + 500ml LB = LB + Carb

July 21, 2014

Colony PCR PTET-GFP + pTET-mfα + Constitutive Promoter-rtTA

CB008	CB008DB
PTEF1	m6
m6	m7
m7	-
m10	-

others are still being made

only 3 worked - m7 #2 & m10 #3 & #4

Gel Picture

Will repeat

July 22, 2o14

Gel Picture

July 23, 2014

Fluorescent Protein Transformations for Exploratoreum

GFP
Citrine
mT BFP2
mRuby
ECFP
mKitr

EGFP

 .5 µl DNA
 25 µl cells

 30m on ice
 45s heat shock
 2m on ice

+250 µl SOC Media

1hr. 37° C
Plate

Didn't work. Found in old UCSF iGEM teams stuff. Possibly for yeast.

July 25, 2014

Yeast Transformations

pTET-mfα in 11E3128 into	pAGA1-mCherry into
pTEF1 DB	pTEF1
pTEF1(m10) DB	pTEF1(m6)
-	pTEF1(m7)
-	pTEF1(m10)
-	pTEF1(m6) DB
-	pTEF1(m7) DB

Digest w/ PME1

5µl 11E3128 
1µl PME1
1µl cutsmart
3µl H20

and 

10µl pTET-GFP pTET mfα
1 µl PME1
1.5µl cutsmart
2.5µl H20

37° C for 1h

E. Coli Transformation pGEM 22 ( pAGA1-mCherry)

0.2 µl plasmid
25 µl cells (DH5α)

30m ice
45s 42°C
2m ice

+250 µl SOC Media
1h 37°C

Plate on LB Carb
Place in drawer over the weekend

August 5, 2014

Streak Plates for Jessica

CB008 pTET+GFP AFRP +rtTA
PRM1
PRM2
PRM3
YDR124W
CLG1
ASG7
HYM1

Glycerol Stocks of

pTET+GFP + m3+rtTA + pTET+mfAlpha
pTET+GFP + m10+rtTA + pTET+mfAlpha + pAGA mCherry

Streak & Overnight culture of m6 & m7 CB008 & DB pTET GFP +rtTA +mfalpha + mCherry

August 6, 2014

Glycerol Stocks of

CB008 m6/m7+(GFP rtTA mfalpha)+pAGA mCherry
CB008DB m7+(GFP rtTA mfalpha)+pAGA mCherry

August 8, 2014

BFP Miniprep

August 11, 2014

Flow Cytometry Set Up

pTET GFP

Dox and alpha factor inductions

YDR124W, pASG7, HYM1, CLG1

Dox Dilutions by Ianto:

Stock: 100mg/mL 
**1x**           **100x**          Prep
60µg/mL       A: 6mg/mL            (6:100) 60µL of Stock in 940µL of water
30µg/mL       B: 3mg/mL            30µL of Stock in 970µL of waterb
9µg/mL        C: 900µg/mL          150µL of A in 850µL of water
6µg/mL        D: 600µg/mL          100µL of A in 900µL of water
3µg/mL        E: 300µg/mL          50µL of A in 950µL of water          0.9µg/mL      F: 90µg/mL           100µL of C in 900µL of water
0.6µg/mL      G: 60µg/mL           100µL of D in 900µL of water
0.3µg/mL      H: 30µg/mL           100µL of E in 900µL of water
0.09µg/mL     I: 9µg/mL            100µL of F in 900µL of water
0.06µg/mL     J: 6µg/mL            100µL of G in 900µL of water
0.03µg/mL     K: 3µg/mL            100µL of H in 900µL of water

Alpha Factor Dilutions :

1x	100x
0 nm	0 nm
0.5 nm	50 nm
1 nm	100 nm
10 nm	1000 nm
100 nm	10000 nm
1000 nm	100000 nm
3000 nm	300000 nm

30 µl 3Mm stock + 270 µl H2O = 300,000 nm

100 µl 300,000 nm stock + 200 µl H2O = 100,000 nm

50 µl 100,000 nm + 450 µl H2O = 10,000 nm

50 µl 10,000 nm + 450 µl H2O = 1,000 nm

50 µl 1000 nm + 450 µl H2O = 100 nm

200 µl 100 nm + 200 µl H20 + 50 nm

Cutures of AFRP's + rtTA & pTET GFP (PRM1, PRM2 , PRM3)

August 13, 2014

Flow

Const. +rtTA mCherry pTET GFP

In triplicate

Time Course

0, 1.5, 3, 5 hours

dox concentrations

0, 0.03, 0.06, 0.09, .6, 6

pTEF1, m3, m6, m7, m10

August 14, 2014

Flow

Const. + mCherry

Same as August 13 except includes 8hr time point.

Weird clumps found in shaker plate - cancelled

August 15, 2014

1:200 dilutions 7:50 AM

Redo of August 14

  1  2  3  4  5  6  7  8  9  10 11 12 
A { --- pTEF 1 ---} { ----- m7 ------}
B { --- pTEF 1 ---} { ----- m10 -----}
C { --- pTEF 1 ---} { ----- m10 -----}
D { ----- m6 -----} { ----- m10 -----}
E { ----- m6 -----}
F { ----- m6 -----}
G { ----- m7 -----}
H { ----- m7 -----}

 dox concentration increases from left to right. 
 0, 0.03, 0.06, 0.09, 0.6, 6

August 19, 2014

Flow

1:200 dilution 7:40 AM

mCherry( +pTET GFP mfAlpha const. rtTA) DB strains

 1  2  3  4  5  6  7  8  9  10 11 12 
A { --- pTEF 1 ---} { ----- m6 ------}
B { --- pTEF 1 ---} { ----- m7 ------}
C { --- pTEF 1 ---} { ----- m7 ------}
D { ----- m3 -----} { ----- m7 ------}
E { ----- m3 -----} { ----- m10 -----}
F { ----- m3 -----} { ----- m10 -----}
G { ----- m6 -----} { ----- m10 -----}
H { ----- m6 -----}

 dox concentration increases from left to right. 
 0, 0.03, 0.06, 0.09, 0.6, 6

 0, 1.5, 3, 5, 8 hours

August 28, 2014

Start cultures for CB008 const. +rtTA pTET GFP pTET mfAlpha for PCL2 mCherry transformation

Flow data does not show RFP - same for m6 pAGA mCherry

streak yeast strains from glycerol stocks - yGEM's 17, 20, 53, 54, 68, 69, 70, 88, 96

August 29, 2014

Transform yGEM 47-50 + PCL2 mCherry Const. rtTA, pTET GFP, pTET mfAlpha

September 2, 2014

Forgot to linearize plasmid August 29 - will colony PCR since some colonies grew but probably didn't work
Prepared dilutions to retransform using linearized plasmid in Jeffrey's box

September 4, 2014

Colony PCR PCL2 mCherry's

Transform :

CB008 m3 rtTA w/ pTET mfAlpha

CB008 m6 mfAlpha w/ pAGA1 mCherry

linearized plasmid in Jeffrey's box

mfAlpha auxotrophic marker - HIS

mCherry on TRP site

Gel Photo machine wasn't working - pTEF (1,2,3) and m7 (3) worked

Redo m6 & m10

Overnight cultures od pTEF&m7&m10 pAGA mCherry for flow

September 5, 2014

Flow (Co-cultures) pAGA mCherry CBoo8

Same Dox concentrations
1.5 ml SD in the growth plate

final dilution OD 0.03 so OD 0.015 for each strain

  1  2  3  4  5  6  7  8  9 10 11 12
A { -pTEF1 x M7- }  { -pTEF1 x M10- }
B { -pTEF1 x M7- }  { -pTEF1 x M10- }
C { -pTEF1 x M7- }  { -pTEF1 x M10- }
D { --M7 x M10-- }
E { --M7 x M10-- }
F { --M7 x M10-- }
G
H

x	ptef1	m7	m10
OD	0.39	0.39	0.39
Actual OD	3.9	3.9	3.9

Actual OD / Target OD = Dilution Factor

3.9/0.015 = 260

µl / Dilution Factor = µl to be added

1500 µl/260 = 5.77 µl

Colony PCR

Failed

Try again with Zymalase

 25 µl Zymalase
 + Cells

 37 °C 10m

 5 µl ^ in PCR reaction 

 Only m10 b/c m6 is growing weird

Need to:

Retransform M6 with PCL2 mCherry
Colony PCR m3 mfAlpha & m6 pAGA RFP

All m6-mfAlpha strains when transformed grow weird

September 8, 2014

Streak Plates of yGEM 75 & 76

Colony PCR - m3 w/ mfAlpha retransform m6 w/ pAGA1/pPCL2 +mCherry

-Grows weird

Transform m3+mfAlpha

September 9, 2014

Flow - New PCL2s -m7 m10 pTEF1

September 10, 2014

yGEM 48 (m6-mfAlpha) developed a weird mutation allowing it to grow strangely on an SD-TRP plate without integrating the plasmid.

Will retransform m6-rtTA with mfAlpha

3 Transformations:

m6+rtTA w/mfAlpha
m6+rtTA w/mfAlpha & pCL2 mCherry
- m6+rtTA w/mfAlpha & pAGA1 mCherry

September 11, 2014

Flow and Transformations

      1  2  3  4  5  6  7  8  9  10 11 12 
A { --- pTEF 1 ---} { ----- m10 -----}
B { --- pTEF 1 ---} { --- m7+pTEF1 --}
C { --- pTEF 1 ---} { --- m7+pTEF1 --}
D { ----- m7 -----} { --- m7+pTEF1 --}
E { ----- m7 -----} { --- m10 + M7---}
F { ----- m7 -----} { --- m10 + M7---}
G { ----- m10 ----} { --- m10 + M7---}
H { ----- m10 ----}

dox concentration increases from left to right. 0, 0.03, 0.06, 0.09, 0.6, 6

0, 1.5, 3, 5, 8 hours Cancelled

September 14, 2014

Colony PCR with Zymalase

Reagents	1X	10X
2X GoTaq Green PCR Master Mix	10 µl	100µl
10 µM Forward primer	1 µl	10 µl
10 µM Reverse primer	1 µl	10 µl
Water	3 µl	30 µl
Bacterial cells (template)	5 µl	------
DMSO	1.5 µl	15 µl
Zymalase	0.5 µl	5 µl

37° C | 5m
95° C | 5m

   30x:
        95° C | 45s
        55° C | 30s
        72° C | 1m per kb

72° C | 10m 
 4° C | Forever

Didnt Work

September 15, 2014

Flow Repeat (9/11)

  1  2  3  4  5  6  7  8  9  10 11 12 
A { --- pTEF 1 ---} { ----- m10 -----}
B { --- pTEF 1 ---} { --- m7+pTEF1 --}
C { --- pTEF 1 ---} { --- m7+pTEF1 --}
D { ----- m7 -----} { --- m7+pTEF1 --}
E { ----- m7 -----} { --- m10 + M7---}
F { ----- m7 -----} { --- m10 + M7---}
G { ----- m10 ----} { --- m10 + M7---}
H { ----- m10 ----}

x	ptef1	m7	m10
OD	0.64	0.67	0.67
Actual OD	6.4	6.7	6.7

Actual OD / Target OD = Dilution Factor

6.4/0.015 = 427
6.7/0.015 = 447

µl / Dilution Factor = µl to be added

1500/427 = 3.5µl
1500/447 = 3.4µl

Colony PCR from day before failed.

Repeat

To Check for mfAlpha

Reagents	1X	10X
2X GoTaq Green PCR Master Mix	10 µl	100 µl
10 µl RA146	1 µl	10 µl
10 µl RA145	1 µl	10 µl
Water	3 µl	30 µl
Bacterial cells (template)	5 µl	------

pAGA

Reagents	1X	6X
2X GoTaq Green PCR Master Mix	10 µl	50 µl
10 µl RA148	1 µl	5 µl
10 µl RA145	1 µl	5 µl
Water	3 µl	15 µl
Bacterial cells (template)	5 µl	-----

pTET mfAlpha Digestion

Reagents	1X
plasmid	23 µl
Cutsmart	3 µl
PME1	1 µl
H2O	3 µl

September 22, 2014

Digest

PCL2 - Bar1 w/ APA1 & Not1

CLG1 - Bar1 w/ APA1 & Not1

CLG - Bar1 w/ Xho1 & Not 1

APA1 - 1hr RT Not 1 37° O/n

Not1 + Xho1 - 37° O/n

PJW608 APA1/Not1 HF

September 23, 2014

Gel Extraction

CLG - Bar1
PCL2 - Bar1
Bar1

PCR Purification

PJW608

Reagents	Bar1	PCL2	CLG1
10x Buffer	2 µl	2 µl	2 µl
Vector DNA	1 µl	1 µl	1 µl
Insert DNA	6 µl	2.3 µl	1.6 µl
H20	10 µl	13.7 µl	14.4 µl
Ligase	1 µl	1 µl	1 µl

September 24, 2014

pAGA1 + Bar1 + PJW608

1 µl Ligase 2 µl Buffer 1 µl Vector 6.2 + x µl insert 9.8 µl H2O

Colony PCR

pCL2 Bar1 CLG Bar1

September 25, 2014

Colony PCR pAGA Bar1

LB Cultures: CLG Bar1 PCL2 Bar1

September 26, 2014

Miniprep PJW608 - CLG (or PCL2) Bar1

Transform into DB strains

linearize plasmids
- 6 µl Plasmid
- 2.5 µl cutsmart
- 1 µl PME1
- 13.5 µl H2O

Colony PCR pAGA Bar1 again

September 29, 2014

Colony PCR

CLG1	PCL2
m6	pTEF1
m3	m3
pTEF1	m6
-----	m10

m10 CLG did not grow

September 30, 2014

Bar 1 Flow

  1  2  3  4  5  6  7  8  9  10 11 12 
A { --- pTEF 1 ---} { ----- m6 ------}
B { --- pTEF 1 ---} { ----- m10 -----}
C { --- pTEF 1 ---} { ----- m10 -----}
D { ----- m3 -----} { ----- m10 -----}
E { ----- m3 -----} { ---- m3+m6 ----}
F { ----- m3 -----} { ---- m3+m6 ----}
G { ----- m6 -----} { ---- m3+m6 ----}
H { ----- m6 -----}

x	m3	m6
OD	0.4	0.45
Actual OD	4	4.5

Actual OD / Target OD = Dilution Factor

4/0.015 = 266.66
4.5/0.015 = 300

µl / Dilution Factor = µl to be added

1500/266.66 = 5.6 µl
1500/300 = 5 µl

October 2, 2014

Flow Cocultures w/ Dye

Stain m7 with blue dye (Cell Tracker?)

Find OD.
OD/0.015 = DF
1000µl/DF = x per well
xµlperwell x 100 = y amount of overnight culture to dye
Split y into 2 1.5 ml tubes
Pellet - 8000 rpm for 3 min
Remove liquid, no cells
add 1 ml HEPES and 10 µl Cell Tracker to each tube
gently resuspend and keep at RT for 30m
Flick tube every 5m or so (protect from light)
Pellet
Remove Liquid and Replace w/ 1ml SD media
Pellet
Remove liquid
Add y/2 µl SD to each tube.

Resuspend 2xµl in m7 only wells (OD 0.03) xµl in coculture wells (OD 0.015)

   1  2  3  4  5  6  7  8  9  10 11 12 
A { --- pTEF 1 ---} { ----- m10 -----}
B { --- pTEF 1 ---} { --- m7+pTEF1 --}
C { --- pTEF 1 ---} { --- m7+pTEF1 --}
D { ----- m7 -----} { --- m7+pTEF1 --}
E { ----- m7 -----} { --- m10 + M7---}
F { ----- m7 -----} { --- m10 + M7---}
G { ----- m10 ----} { --- m10 + M7---}
H { ----- m10 ----}

x	ptef1	m7	m10
OD	0.44	0.62	0.47
Actual OD	4.4	6.2	4.7

Actual OD / Target OD = Dilution Factor

4.4/0.015 = 293.33
6.2/0.015 = 413.33
4.7/0.015 = 313.33

µl / Dilution Factor = µl to be added

1000/293.33 = ~3.41µl
1000/413.33 = ~2.42µl
1000/313.33 = ~3.19µl

Sabrina's Lab Notebook

06/09/14

PCR for Constitutive Promoters - pTEF1 (M3)

Materials	1x reaction	4.5x Master Mix
5x Phusion HF Buffer	10 µl	45 µl
dNTP's (10 mM)	1 µl	4.5 µl
Forward Primer (10µm)	2.5 µl	11.25 µl
Reverse Primer (10µm)	2.5 µl	11.25 µl
*Template DNA	0.3 µl	1.35 µl
Phusion Polymerase	0.5 µl	2.25 µl
Water	33.2 µl	149.4 µl
Total	50 µl	225 µl

(Note: Add enzymes last)

PCR Reaction Procedures:

Mix the regents in a 4.5x Master mix on ice. Make sure to mix well since enzyme is viscous and sinks to the bottom.
Pipette 50ul from the Master Mix into four labled PCR tubes

Put in the thermocycler for the following cycles:

Initial Denaturation   | 98° C | 30s 
  35 Cycles of: 
      Denaturation | 98° C | 10s
      Annealing    | 55° C | 20s
      Extension    | 72° C | 30s
Final Extension    | 72° C | 5m
Hold               | 4°  C | Forever

Keep samples for gel extraction on the following day.

06/10/14

Loading the Gel

*Add 5ul of Loading Dye (10X Blue Juice) to samples.

Gel Map:

1  2  3  4  5  6  7  8  9  10  11  12  13  14  15
   [----M6---][----M7----] [-----M3-----]

1  2  3  4  5  6  7  8  9  10  11  12  13  14  15
   [----TEF1----]   [-M10]

Both lane #1 are 100 bp ladder

*George had less to PCR due to a spill accident when spinning tubes

Gel Extraction Procedure:

Cut Gel
Weigh it in a colorless tube
Add 3 volumes Buffer QG to 1 volime Gel (100mg ~ 100µl)
Incubate @ 50° C for 10 min or until completely dissolved (vortex every 2-3 min to help dissolve)
Add 1 gel volume isopropanal to the sample and mix
Place a QlAquick soin column in a provided 2ml collection tube
Place sample in column & spin for 1 min -> discard flow through
To wash add 0.75 ml Buffer PE to column & centrifue for 1 min, then dry spin
Place column in 1.5 ml tube
Add 30µl H2O & centrifuge for 1 min.

Restriction Enzyme Digest with ApaI (Backbone Digestion):

40ul of Gel Extraction DNA
5ul of Cutsmart Buffer
0.5ul of ApaI

*Digest at room temperature overnight

06/11/14

PCR Purification and Ligation

Digest with XhoI

Add 0.5ul of XhoI Enzyme (in Enzyme Box) to ApaI Digest from 06/10/14
Incubate in the 37°C shaker for ~2 hours.

PCR Purification

5 volumes of Buffer PB (with ethanol) to 1 volume PCR sample
To bind DNA, apply sample to column and spin for 1 min
Discard flow through
To wash, add 0.75 ml of Buffer PE to column and centrifuge for 1 min
Discard flow through and place column back in the same tube
Cetrifuge for an addtitional minute (Dry Spin)
Place column in clean 1.5 ml tube
Add 30µl water to column, let stand for 1 min and centrifuge for 1 min

Ligation (pSV606 and pTEF1-M3)

1:3 Backbone to Insert

Concentration of M3 Digest = 127.1 ng/ul

Materials:

Reagents	1x
10x ligase buffer	1.0µl
DNA Backbone (PSV606)	0.2µl
Insert	0.2µl
T4 DNA Ligase	0.5µl
H2O	8.1µl
Total	10 µl

Keep at room temperature for at least 2 hours.

Transformation

Materials	1x
Ligation (pSV606 and M3)	10µl
E. Coli Competent Cells	50ul

Mix both together and keep on ice for 30 minutes
42°C Heat shock for 45 seconds
Put immediately on ice for at least 2 minutes
Add 250 ul of SOC media, shake for 1 hr at 37°C.
Plate on selective media and store at 37°C.

06/12/14

Re-Ligation and Tranformation of M3

Note: Most of our plates did not form colonies, with the exceptions of pTEF1-M10 and pTEF1-M3.

Due to this, we will all have to re-ligate using higher concentration of the pSV606 backbone.
Kara belives that the failure in our transformation was due to mediocre competent cells. We will be using better competent cells.
Forgot to make a Negative control. Make sure to make one next time.

Ligation #2:

Materials:

Reagents	1x
10x ligase buffer	1.0µl
DNA Backbone (PSV606)	0.4µl
Insert	0.2µl
T4 DNA Ligase	0.5µl
H2O	7.9µl
Total	10 µl

-Added 0.2ul more Backbone.

Keep at room temperature for at least 2 hours.

Transformation

Materials	1x
Ligation (pSV606 and M3)	10µl
E. Coli Competent Cells	50ul

Mix both together and keep on ice for 30 minutes
42°C Heat shock for 45 seconds
Put immediately on ice for at least 2 minutes
Add 250 ul of SOC media, shake for 1 hr at 37°C.
Plate on selective media and store at 37°C.

06/13/14

Yeast Transformation (CB008 + Inducible Promoters)

Assisted Ianto and others in Transforming Inducible Promoters into Yeast.

| Reagents                  |
| ------------------------- |
| YPD                       |
| 1 M LiOAc                 |
| 10X TE pH 7.5             |
| 1X TE pH 7.5, 0.1 M LiOAc |
| 50% PEG 3350              |
| DMSO                      |
| Salmon Sperm DNA (ssDNA)  |

PEG is viscous, so pipette slowly to prevent air bubbles from forming.
boil ssDNA aliquots for 10 min, then ice down for 10 min before use.

Previous Day : Grew yeast strain to be transformed in 5-10 mL YPD overnight at 30° C

Set up digest to linearize DNA
Dilute O/N culture ~ 1:20 in YPD grow 2-4 hours at 30° C
Prepare ssDNA - boil for 10m cool on ice for at least 10m (10 µl of 10 mg/mL stock per transformation)
Harvest cells in centrifuge - 3000 rpm, 2-5 min
Wash with 1 ml 0.1 M LiOAin TE
Pellet cells - 3000 rpm , 2-5 min
Resuspend pellet in 100 µl 0.1 M LiOAc in TE per 2.5 ml culture, split into 100 µl per epindorph tube for each transformation
to 100 µl cells add 100 µg ssDNA (10 µl of 10 mg/mL sock), 1-5 µl target DNA
Add (in order): 480 µl 50% PEG 3350, 60 µl 10X TE, 60 µl 1 M LiOAc (for final 40% PEG, 1X TE, 0.1 M LiOAc) Optional: Add 75 µl DMSO definitely did
Vortex
Incubate 42° C for 30m & begin drying plates
Pellet (6000 rpm - 2m), discard supernatant (remove PEG completely by pipetting), resuspend in 500 µl YPD (or selective media)
Pellet, discard supernatant, resuspend in risidual ~ 50 µl YPD
Plate on selective media
Incubate 1-3 days

06/16/14

Colony PCR for Screening E.Coli Procedure:

Using a sterile pipette tip (p200 tip is good), innoculate a single colony and mix in 25ul of water.Do this for 5 colonies. Use 5ul for PCR reaction below.

Set up PCR Reaction below:

Reagents	1X	6X
2X GoTaq Green PCR Master Mix	10 µl	60 µl
10 µM Forward primer	1 µl	6 µl
10 µM Reverse primer	1 µl	6 µl
Water	3 µl	18 µl
Bacterial cells (template)	5 µl	-----
Total		90 ul

Add 15 ul of Master Mix into each tube.

    Initial Denaturation   | 95° C | 5 min 
  35 Cycles of: 
      Denaturation | 95° C | 45s
      Annealing    | 55° C | 30s
      Extension    | 72° C | 1min per kb
Final Extension    | 72° C | 10m
Hold               |  4°C  | Forever

Load PCR products on a gel. (5ul) (GoTaq already has loading dye)
For all positive bands on the gel, add rest of bacterial cells from PCR tubes to 5ml LB and grow overnight at 37°C for miniprep on the following day.

Result of E.Coli Colony PCR (Constitutive Promoters): All lanes worked.

Grew 2 out of 5 Successful Colony PCR E.Coli Colonies in liquid culture.
- Unfortunately, the rack which contained our cultures was not secured and caused our cultures to fall down and possibly be contaminated.
- We re-inocculated the colonies due to possible contamination.

Colony PCR for Yeast (Inducible Promoters CB008 and CB008DB) Procedure:

Boil Yeast at 95°C for 1 hour.

Using a sterile pipette tip (p200 tip is good), innoculate a single colony and mix in 15ul of NaOH. Take 3 colonies from each plate. Use 5ul for PCR reaction below.

Set up PCR reaction below:

Reagents	1X	67X
2X GoTaq Green PCR Master Mix	10 µl	670 µl
10 µM Forward primer	1 µl	67 µl
10 µM Reverse primer	1 µl	67 µl
Water	3 µl	201 µl
cells (template)	5 µl	-------
Total		1005 ul

Add 15 ul of Master Mix into each tube.

Initial Denaturation    | 95°C | 5 min 
  35 Cycles of: 
      Denaturation | 95°C | 45s
      Annealing    | 55°C | 30s
      Extension    | 72°C | 1min per kb
Final Extension    | 72°C | 10m
Hold               |  4°C | Forever

Load PCR products on a gel. (5ul) (GoTaq already has loading dye)
Results: only 4 positive lanes
- Possible Explanation: Not enough DNA in PCR tubes.

06/17/14

Miniprep of Constitutive Promoters

Miniprep Precedure:

Obtain E.Coli Cultures from 06/16/14 in 37°C Incubation Room.

Resuspend pelleted bacterial cells in 250 µl Buffer PI and transfer to a microcentrifuge tube.
Add 250 µl Buffer P2 and gently invert tube 4-6 times to mix. DO NOT VORTEX.
Add 350 µl Buffer N3 and invert immediately 4-6 times.
Centrifuge for 10 min at 13,000 rpm.
Add supernatant to QIAprep spin column.
Centrifuge for 30-60s - Discard flow through.
Wash QIAprep spin column by adding 0.5 ml Buffer PB and centrifuging for 30-60s - Discard flow through.
Wash column by adding 0.75 ml Buffer PE and centrifuginh for 30-60s
Discard flow through and centrifuge for an additional 1 min to remove residual wash buffer.
Place column in clean 1.5 ml microcentrifuge tube. To elute DNA add 50 µl water or buffer EB, let stand for 1 min and centrifuge for 1 min.

Sent miniprep into sequencing. Results came out positive. Constitutive promoters successfully transformed into plasmids.

06/18/14

Cultures Set up for Yeast Tranformation

Made cultures of CB008 and CB008DB for each of our constitutive promoters.

06/20/14

Linearization of Plasmids with Constitutive Promoters - PSV606

Linearization Materials:

10 µl DNA (miniprep in my box in -20°C Fridge)
5 µl Cutsmart Buffer
1 µl PME1
34 µl H2O

Incubate at 37 ° C for 2 hours

Transformation of Constitutive Promoters into Yeast (CB008 and CB008DB)

| Reagents                  |
| ------------------------- |
| YPD                       |
| 1 M LiOAc                 |
| 10X TE pH 7.5             |
| 1X TE pH 7.5, 0.1 M LiOAc |
| 50% PEG 3350              |
| DMSO                      |
| Salmon Sperm DNA (ssDNA)  |

PEG is viscous, so pipette slowly to prevent air bubbles from forming.
boil ssDNA aliquots for 10 min, then ice down for 10 min before use.
Make sure to add reagents in order!

Previous Day : Grew yeast strain to be transformed in 5-10 mL YPD overnight at 30° C

Set up digest to linearize DNA (see procedure above)
Dilute O/N culture ~ 1:20 in YPD grow 2-4 hours at 30° C
Prepare ssDNA - boil for 10m cool on ice for at least 10m (10 µl of 10 mg/mL stock per transformation)
Harvest cells in centrifuge - 3000 rpm, 2-5 min
Wash with 1 ml 0.1 M LiOAin TE
Pellet cells - 3000 rpm , 2-5 min
Resuspend pellet in 100 µl 0.1 M LiOAc in TE per 2.5 ml culture, split into 100 µl per epindorph tube for each transformation
to 100 µl cells add 100 µg ssDNA (10 µl of 10 mg/mL sock), 1-5 µl target DNA
Add (in order): 480 µl 50% PEG 3350, 60 µl 10X TE, 60 µl 1 M LiOAc (for final 40% PEG, 1X TE, 0.1 M LiOAc) Optional: Add 75 µl DMSO definitely did
Vortex
Incubate 42° C for 30m & begin drying plates
Pellet (6000 rpm - 2m), discard supernatant (remove PEG completely by pipetting), resuspend in 500 µl YPD (or selective media)
Pellet, discard supernatant, resuspend in risidual ~ 50 µl YPD
Plate on selective media
Incubate 1-3 days

06/23/14

Yeast Colony PCR of Constitutive Promoters

Boil Yeast at 95°C for 1 hour.

Using a sterile pipette tip (p200 tip is good), innoculate a single colony and mix in 15ul of NaOH. Take 3 colonies from each plate. Use 5ul for PCR reaction below.

Set up PCR reaction below:

Reagents	1X	67X
2X GoTaq Green PCR Master Mix	10 µl	670 µl
10 µM Forward primer	1 µl	67 µl
10 µM Reverse primer	1 µl	67 µl
Water	3 µl	201 µl
cells (template)	5 µl	-------
Total		1005 ul

Add 15 ul of Master Mix into each tube.

Initial Denaturation    | 95°C | 5 min 
  35 Cycles of: 
      Denaturation | 95°C | 45s
      Annealing    | 55°C | 30s
      Extension    | 72°C | 1min per kb
Final Extension    | 72°C | 10m
Hold               |  4°C | Forever

Load 5ul of PCR products on a gel. (GoTaq already has loading dye)
Results: All Constitutive Promoters were successfully Transformed.
Made cultures to be diluted for glycerol stocks. Cultures made of the yeast transformations of the constitutive promoters.

06/24/14

Flow Cytometry Protocol:

Day Before:
- Start overnight cultures of your strains to be tested in 5-10ml SD Complete media. (Do not use YPD. YPD has fluorescence background which would cause problems for FACS testing.)
Day Of:

Flow Procedures:

Dilute overnight cultures 1:100 in the 96 well shaker plate. (Shaker plates can be found in the Lim Lab in the back glass cabinet where large glass bottles can also be found.)
Allow cells to enter growth stage by putting on plate shaker at 30°C going 1000rpm (found in Flow room or the 30°C room in the other hall)for 2-3 hours after dilution.
Induce with alpha factor. The stock alpha factor in the freezer is 3mM and we use it at the final concentrations of: 0, 1nM, 10nM, 100nM, and 1uM.
Allow introduction to proceed on plate shaker for 90 min to 2 hrs, no longer.
Transfer 250ul of each culture to the 96 well flow cytometry v-bottom plate. (found in flow room on shelf) Arrest cells with 10ul of cycloheximide. (stops translations of proteins; stops growth)
Run on flow cytometer.
Analyze Data.

Things to check for Flow:

Check that machine is on standby and not run. (Should be on standby when not in use)
Make sure that a clean plate has been ran by the person before you. Otherwise, run a clean plate. (A1-A4 bleach, B1-B4 water)
Check fluid buffer box and storage tanks. Discard waste fluid in sink 2 doors down (remember to add bleach to tank when done) and replace buffer box if needed.
Make sure you have a positive and negative control so that you can set the parameters.
Open up FACSDiva. Sign into iGEM account.
Create new FACS experiment. Highlight needed wells and use the blue button to create wells for use. Create specimens among the wells and rename them.
Open up inspector to check parameters.
Run well. (Do not click 'Run Plate'.)
Once finished, export data onto a USB.
Run a clean plate.

* Note: NEVER TURN THE WIFI ON! THE COMPUTER WILL CRASH!

Voltage Parameters:

FSC:  250 
SSC:  280 
FITC: 550

Sample Loading Parameters:

Sample Volume: 200
Mixing Volume: 150
Flow Speed: 0.5ul/sec when adjusting, otherwise 1ul/sec
Mixing quantity: 3

Using Flowjo and Matlab to Analyze Data

Flowjo:

Export Data from USB and transfer to iGEM2014 folder.
Open Flowjo and drag data over to box.
Set an appropriate gate.
Go to data, select all data and press 'Σ'. Select median, mean, and count.
Press the refresh button. Additional numerical data should be present.

Matlab:

Open up a new script. and comment the title of the script. (Use '%' for comments.)
Enter the alpha factor info that will serve as the x-axis. (Put in log form.)
Enter the yGEM data. This will serve as the y-axis.
Type your figure info and press the "go".

Example of Matlab script to create graphs based on Flowjo Data:

%14-6-19 Alpha-Factor Promoter ASG7

clear % this will get rid of all previous graphs

Clear all % same as above but for ALL graphs

alpha = [0 1 10 100 1000] % nanomolar nM, spaces show a new number

alpha = [0.01 1 10 100 1000] % 0.01 is really 0. Flowjo cannot comput 0s

yGEM = [558 715 1040 2230 4731] %mean GFP C1-C5 ASG7

figure(1)

semilogx(alpha,yGEM4,'--c'), %('--c') means dotted line, cyan colored line, and star for points.

hold on

xlabel'alpha') % [] denotes concentration, () denotes "in"

ylabel('mean GFP (au)') % au means arbitrary unit

title('Alpha-factor vs mean GDP yGEM4')

legend('yGEM4')

axis([0.01 1500 200 4000]); % axis([xmin xmax ymin ymax])

Use Adobe Illustrator to beautify graphs. Newer Matlab versions may have the option to beautify graph without the use of Illustrator.
Code available in dropbox.

06/24/14

Plate Map for Flow Cytometry of Inducible Promoters:

PCR of rtTA Promoter

Became part of Jessica's rtTA portion of the project.
- Inducible Promoters + rtTA into CB008 and CB008DB
PCR Purification of remaining pHY4 + inducible promoters + GFP (Digestion done by Derrick) (Backbone)

PCR of inducible promoter primer + rtTA with new rtTA RV primer

Materials	1x reaction	12x Master Mix
5x Phusion HF Buffer	10 µl	120 µl
dNTP's (10 mM)	1 µl	12 µl
Forward Primer (10µm)	2.5 µl	30 µl
Reverse Primer (10µm)	2.5 µl	30 µl
Template DNA: rtTA	0.5 µl	6 µl
Phusion Polymerase	0.5 µl	6 µl
Water	33 µl	396 µl
Total	50 µl	600 µl

(Note: Add enzymes last)

PCR Reaction Procedures:

Mix the regents in a 4.5x Master mix on ice. Make sure to mix well since enzyme is viscous and sinks to the bottom.
Pipette 50ul from the Master Mix into four labled PCR tubes

Put in the thermocycler for the following cycles:

Initial Denaturation  | 95°C | 5 min 
  30 Cycles of: 
      Denaturation | 95°C | 30s
      Annealing    | 50°C | 20s
      Extension    | 72°C | 2 min
Final Extension    | 72°C | 5 min
Hold               | 4°C  | Forever

Keep samples for gel extraction on the following day.

Promoter Concentration

PRM2 0.451

YDR124W 15.46

SAG1 12.10

PRM6 21.74

PRM1 4.186

PCL2 6.348

E. Coli Transformation for Increase of Plasmids:

Plasmids: HY3E (rtTA), HY130E (TRP), HY12E1 (URA3), HY34E2 (HIS2), HY111E2 (LEU2), HY4 (stock plasmid)

06/25/14

Glycerol Stocks of Constitutive Promoters in Yeast (CB008 and CB008 DB)

Diluted overnight cultures of constitutive promoters in yeast (CB008 and CB008DB)

added 250ul culture to 5ml YPD
put in 30°C incubator for 2 hours

Glycerol Stocks Procedure:

Obtain Glycerol Stock tubes from drawer near autoclave box. (Tubes have orange caps)
Add 350ul of 60% Glycerol or 420ul of 50% Glycerol to 350ul of cells.
Vortex well.
Label tubes and put into -70°C Freezer. (3rd row, 1st drawer)

Graphs of Flow for yGEM4:

Gel Map of pTEF1 Strains Yeast Homology:

Graph of Flow for All Inducible Promoters:

|  yGEM#  | Promoter|                       
|---------|---------|
|yGEM4    |   ASG7  |
|yGEM5    |   PCL2  |
|yGEM6    |   SAG1  |
|yGEM10   |   PRM2  |
|yGEM11   |   CLG1  |
|yGEM12   | YDR124W |
|yGEM13   |   PRM6  |
|yGEM14   |   PRM2  |
|yGEM15   |   ECM18 |
|yGEM16   |   PRM3  |

|  yGEM#  |          Strain            |
|---------|----------------------------|
|yGEM23   |CB008 pTEF1-GFP-URA3        |
|yGEM24   |CB008 pTEF1(M3)-GFP-URA3    |
|yGEM25   |CB008 pTEF1(M6)-GFP-URA3    |
|yGEM26   |CB008 pTEF1(M7)-GFP-URA3    |
|yGEM27   |CB008 pTEF1(M10)-GFP-URA3   |
|yGEM28   |CB008DB pTEF1-GFP-URA3      |
|yGEM29   |CB008DB pTEF1(M3)-GFP-URA3  | 
|yGEM30   |CB008DB pTEF1(M6)-GFP-URA3  |
|yGEM31   |CB008DB pTEF1(M7)-GFP-URA3  |
|yGEM32   |CB008DB pTEF1(M10)-GFP-URA3 |

| Promoter|  Owner  |                   
|---------|---------|
|PRM2     | George  |
|ASG7     | Sabrina |
|PCL2     | Eric    |
|CLG1     | Derrick |
|YDR124W  | Ianto   |
|PRM6     | Ianto   |
|PRM1     | Robert  |
|ECM18    | Robert  |
|PRM3     | Eleanor |
|SAG1     | Jessica |

Diluted Overnight Cultures - Constitutive Promoters

Added 250ul of culture to 5ml YPD - put in incubator 30°C. Finished ~ 9:30am

06/26/14

Miniprep of Plasmids for rtTA

Miniprep Precedure:

Obtain E.Coli Cultures from 06/25/14 in 37°C Incubation Room.

Resuspend pelleted bacterial cells in 250 µl Buffer PI and transfer to a microcentrifuge tube.
Add 250 µl Buffer P2 and gently invert tube 4-6 times to mix. DO NOT VORTEX.
Add 350 µl Buffer N3 and invert immediately 4-6 times.
Centrifuge for 10 min at 13,000 rpm.
Add supernatant to QIAprep spin column.
Centrifuge for 30-60s - Discard flow through.
Wash QIAprep spin column by adding 0.5 ml Buffer PB and centrifuging for 30-60s - Discard flow through.
Wash column by adding 0.75 ml Buffer PE and centrifuginh for 30-60s
Discard flow through and centrifuge for an additional 1 min to remove residual wash buffer.
Place column in clean 1.5 ml microcentrifuge tube. To elute DNA add 50 µl water or buffer EB, let stand for 1 min and centrifuge for 1 min.

Nanodrop Concentrations:

PRM2 = 107.0 ng/ul
ASG7 = 111.2 ng/ul
PCL2 = 96.49 ng/ul
CLG1 = 114.8 ng/ul
YDR124W = 90.53 ng/ul
HYM1 = 77.29 ng/ul
PRM6 = 99.83 ng/ul
PRM1 = 75.35 ng/ul
ECM18 = 18.81 ng/ul (to be remade)
PRM3 = 130.8 ng/ul
SAG1 = 104.1 ng/ul
pTEF1 = 182.3 ng/ul

PCR of rtTA Promoter

PCR done on 6/24/14 failed.
Added DMSO this time.
Became part of Jessica's rtTA portion of the project.
- Inducible Promoters + rtTA into CB008 and CB008DB
PCR Purification of remaining pHY4 + inducible promoters + GFP (Digestion done by Derrick) (Backbone)

PCR of inducible promoter primer + rtTA with new rtTA RV primer

Materials	1x reaction	12x Master Mix
5x Phusion HF Buffer	10 µl	120 µl
dNTP's (10 mM)	1 µl	12 µl
Forward Primer (10µm)	2.5 µl	30 µl
Reverse Primer (10µm)	2.5 µl	30 µl
Template DNA: rtTA	0.5 µl	6 µl
Phusion Polymerase	0.5 µl	6 µl
Water	31.5 µl	396 µl
DMSO	1.5ul	30 ul
---------------------	-------------	----------------
Total	50 µl	600 µl

(Note: Add enzymes last)

PCR Reaction Procedures:

Mix the regents in a 4.5x Master mix on ice. Make sure to mix well since enzyme is viscous and sinks to the bottom.
Pipette 50ul from the Master Mix into four labled PCR tubes

Put in the thermocycler for the following cycles:

Initial Denaturation  | 95°C | 5 min 
  30 Cycles of: 
      Denaturation | 95°C | 30s
      Annealing    | 50°C | 20s
      Extension    | 72°C | 2 min
Final Extension    | 72°C | 5 min
Hold               | 4°C  | Forever

Keep samples for gel extraction on the following day.

06/27/14

rtTA PCR Purification

PCR Purification Prodedure:

5 volumes of Buffer PB (with ethanol) to 1 volume PCR sample
To bind DNA, apply sample to column and spin for 1 min
Discard flow through
To wash, add 0.75 ml of Buffer PE to column and centrifuge for 1 min
Discard flow through and place column back in the same tube
Cetrifuge for an addtitional minute (Dry Spin)
Place column in clean 1.5 ml tube
Add 30µl water to column, let stand for 1 min and centrifuge for 1 min

Streak Plate of Constitutive Promoters

As instructed by Kara, I made a streak plate with all 5 Constitutive Promoters on it.
- Accidentally made the plate by stamping it instead of actually streaking it. It looks kinda funny.
Along with the streak plate, I also made cultures of of CB008 SAG1 and CB008 ECM18, along with two negative cultures of CB008. Cultures of the Contitutive Promoters were made also.
- All cultures made with SD-Complete. (for Flow)

Gibson Assembly and Transformation

Gibson Assembly Procedures:

|        Materials       |  Amount  |   
|------------------------|----------|
|Gibson Master Mix (2x)  |   5ul    |
|Backbone (pHY4+AFRP+GFP)|   3ul    |
|Insert (rtTA + primer)  | Varies   |
|ddH2O                   | Varies   |

    Promoter|Concentration of Insert| Amount of Insert Needed  |H2O Needed| 
    --------| --------------------- | ------------------------ | -------- |
    PRM2    | 107.0 ng/ul           | 1 ul                     |    1ul   |
    ASG7    | 111.2 ng/ul           | 1 µl                     |    1ul   |
    PCL2    | 96.49 ng/ul           | 1 µl                     |    1ul   |
    CLG1    | 114.8 ng/ul           | 1 µl                     |    1ul   |
    YDR124W | 90.53 ng/ul           | 1 µl                     |    1ul   |
    HYM1    | 72.29 ng/ul           | 1 µl                     |    1ul   |
    PRM6    | 99.83 ng/ul           | 1 µl                     |    1ul   |
    PRM1    | 75.35 ng/ul           | 1 µl                     |    1ul   |
    ECM18   | 18.87 ng/ul           | 3 µl                     |    0ul   |
    PRM3    | 130.8 ng/ul           | 1 µl                     |    1ul   |
    SAG1    | 104/1 ng/ul           | 1 µl                     |    1ul   |
    Pos Ctrl| Gibson Positive Ctrl  | 2 µl Backbone, 2ul Insert|    1ul   |
    Neg Ctrl| ASG7 Backbone         | 3 ul Backbone, 0ul Insert|    2ul   |

PRM2 did not have a backbone and thus could not be transformed yet.

Obtain Mach1 Cells from -70°C Freezer
- 25ul for 10ul Gibson Mix.

Mix Materials.
Incubate at 50°C for 1 hour.
Add 25ul Competent Cells to 10ul Gibson Mix. (ADD ON ICE)
Incubate on ice for 30 min.
Incubate at 42°C for 45 sec.
Incubate on ice for at least 2 min.
Add 250ul SOC Media (Make sure it isn't cloudy) to cells.
Shake in 37°C Incubator Room for 1 hr. (Warm plates also)
Plate on LB-CARB and keep in drawer over the weekend.

06/30/14

Results of Transformation:

| Promoter | Colonies|                  
|----------|---------|
| PRM2     |   N/A   |
| ASG7     |    7    |
| PCL2     |    6    |
| CLG1     |   15    |
| YDR124W  |    2    |
| HYMI     |    0    |
| PRM6     |    9    |
| PRM1     |    8    |
| ECM18    |    8    |
| PRM3     |    5    |
| SAG1     |    7    |
| Pos Ctrl |  TMTC   |
| Neg Ctrl |   10    |

Colony PCR of rtTA Transformation:

Using a sterile pipette tip (p200 tip is good), innoculate a single colony and mix in 25ul of water. Do this for 3-5 colonies. Use 5ul for PCR reaction below.

Set up PCR Reaction below:

Reagents	1X	6X
2X GoTaq Green PCR Master Mix	10 µl	60 µl
10 µM Forward primer	1 µl	6 µl
10 µM Reverse primer	1 µl	6 µl
Water	3 µl	18 µl
Bacterial cells (template)	5 µl	-----
Total		90 ul

Add 15 ul of Master Mix into each tube.

    Initial Denaturation   | 95°C | 5 min 
  30 Cycles of: 
      Denaturation | 95°C | 45s
      Annealing    | 55°C | 30s
      Extension    | 72°C | 1min per kb
Final Extension    | 72°C | 10m
Hold               |  4°C  | Forever

Load PCR products on a gel. (5ul) (GoTaq already has loading dye)
For all positive bands on the gel, add rest of bacterial cells from PCR tubes to 5ml LB and grow overnight at 37°C for miniprep on the following day.

Gel of rtTA Tranformation Colony PCR:

Original Gel failed due to the bottom part of the gel disappearing. (possibly due to the bottom part not solidifying enough)
Jessica made PRM2 Backbone
ECM18 PCR'ed
Both were Gibson'ed and transformed.

Cultures were made of pHY4 AFRP's + rtTA.

5ml YPD + Transformed Colonies
Put in 37°C Incubator Room Shaker overnight.

07/01/14

Miniprep of Inducible Promoters + rtTA

Note: Try not to do more than one miniprep per promoter.

Miniprep Precedure: (did in triplicate for some reason)

Obtain E.Coli Cultures from 06/30/14 in 37°C Incubation Room.

Resuspend pelleted bacterial cells in 250 µl Buffer PI and transfer to a microcentrifuge tube.
Add 250 µl Buffer P2 and gently invert tube 4-6 times to mix. DO NOT VORTEX.
Add 350 µl Buffer N3 and invert immediately 4-6 times.
Centrifuge for 10 min at 13,000 rpm.
Add supernatant to QIAprep spin column.
Centrifuge for 30-60s - Discard flow through.
Wash QIAprep spin column by adding 0.5 ml Buffer PB and centrifuging for 30-60s - Discard flow through.
Wash column by adding 0.75 ml Buffer PE and centrifuginh for 30-60s
Discard flow through and centrifuge for an additional 1 min to remove residual wash buffer.
Place column in clean 1.5 ml microcentrifuge tube. To elute DNA add 50 µl water or buffer EB, let stand for 1 min and centrifuge for 1 min.

Nanodrop Concentrations (ng/ul):

ASG7 1 = 203.0 ng/ul
ASG7 2 = 282.9 ng/ul
ASG7 3 = 244.9 ng/ul
PCL2 1 = 205.5 ng/ul
PCL2 2 = 205.3 ng/ul
PCL2 3 = 305.3 ng/ul
CLG1 1 = 155.5 ng/ul
CLG1 2 = 187.6 ng/ul
CLG1 3 = 230.0 ng/ul
YDR124W 1 = 89.44 ng/ul
PRM6 1 = 246.4ng/ul
PRM6 2 = 17.32 ng/ul
PRM6 3 = 154.0 ng/ul
PRM3 1 = 244.9 ng/ul
PRM3 3 = 180.1 ng/ul
SAG1 1 = 146.5 ng/ul
SAG1 2 = 243.8 ng/ul
SAG1 3 = 137.8 ng/ul

*Did not use PRM 1 #1, 2, and 3 or PRM3 #2 because the cultures did not grow.

Sent into sequencing.

Colony PCR for Screening Yeast - Constitutive Promoters + GFP

Used Streak plate in 4°C Fridge.

Reagents	1X	6X
2X GoTaq Green PCR Master Mix	10 µl	60 µl
10 µM Forward primer	1 µl	-----
10 µM Reverse primer	1 µl	6 µl
Water	5 µl	30 µl
Bacterial cells (template)	3 µl	-----
Total		96 ul

add 15ul of master mix to each tube.

    Initial Denaturation   | 95°C | 5 min 
  30 Cycles of: 
      Denaturation | 95°C | 45s
      Annealing    | 55°C | 30s
      Extension    | 72°C | 1min per kb
Final Extension    | 72°C | 10m
Hold               |  4°C  | Forever

Load 5ul of PCR products on a gel. (GoTaq already has loading dye)

10uM RV Primer = GFP RV Primer - kept in Primer Working Stock (2014 Primers)
10uM FW Primer = Individual pTEF1/mutant Primers kept in the -20°C freezer boxes of the respective owners. (pTEF1=Jeffrey, M3=Sabrina, M6=Eleanor, M7=Robert, M10=George)
- M7 used M10 primer due to the primers being so similar. M7 ran out of its own primer.

Gel of Yeast Colony PCR (Constitutive Promoters)

Gel mostly failed - to be redone the following day.

Sent into sequencing.

Sequencing for pTEF promoters cancelled due to the absence of primers that were supposed to be sent in or selected on the promoter catalog.

07/02/14

Re-Colony PCR for Yeast - Constitutive Promoters + GFP

Colony PCR for Screening Yeast - Constitutive Promoters + GFP

Used Streak plate in 4°C Fridge.

picked 3 different colonies.

Reagents	1X	6X
2X GoTaq Green PCR Master Mix	10 µl	60 µl
10 µM Forward primer	1 µl	-----
10 µM Reverse primer	1 µl	6 µl
Water	5 µl	30 µl
Bacterial cells (template)	3 µl	-----
Total		96 ul

add 15ul of master mix to each tube.

    Initial Denaturation   | 95°C | 5 min 
  30 Cycles of:
      Denaturation | 95°C | 45s
      Annealing    | 55°C | 30s
      Extension    | 72°C | 1min per kb
Final Extension    | 72°C | 10m
Hold               |  4°C  | Forever

Load 5ul of PCR product on a gel. (GoTaq already has loading dye)

10uM RV Primer = GFP RV Primer - kept in Primer Working Stock (2014 Primers)
10uM FW Primer = Individual pTEF1/mutant Primers kept in the -20°C freezer boxes of the respective owners. (pTEF1=Jeffrey, M3=Sabrina, M6=Eleanor, M7=Robert, M10=George)
- M7 used M10 primer due to the primers being so similar. M7 ran out of its own primer.

Gel of Yeast Colony PCR (Const. + GFP):

Yeast PCR Purification

To extract Yeast DNA for Sequencing

PCR Purification Prodedure:

5 volumes of Buffer PB (with ethanol) to 1 volume PCR sample
To bind DNA, apply sample to column and spin for 1 min
Discard flow through
To wash, add 0.75 ml of Buffer PE to column and centrifuge for 1 min
Discard flow through and place column back in the same tube
Cetrifuge for an addtitional minute (Dry Spin)
Place column in clean 1.5 ml tube
Add 30µl water to column, let stand for 1 min and centrifuge for 1 min

Nanodrop Concentrations:

pTEF1 = 12.30 ng/ul
pTEF1 (M3) = 6.242 ng/ul
pTEF1 (M6) = 33.68 ng/ul
pTEF1 (M7) = 39.72 ng/ul
pTEF1 (M10) = 19.43 ng/ul

Did not send into sequencing due to the conclusion that the constitutive promoters were successfully transformed based on past sequencing and flow cytometry.

I restreaked the streak plate from the patch plate with the colonies marked (✓) on them. I did not trust the other streak plate. Incubated in 30°C incubator.

Re-Transformation of pHY4 Inducuble Promoters + rtTA

Gibson Assembly Procedures:

|        Materials       |  Amount  |   
|------------------------|----------|
|Gibson Master Mix (2x)  |   5ul    |
|Backbone (pHY4+AFRP+GFP)|   4ul    |
|Insert (rtTA + primer)  |   1ul    |
|ddH2O                   |   0ul    |
|Total                   |   10ul   |

Obtain NEB5α (C2987) Cells instead of Mach1 cells from -70°C Freezer
- 25ul for 10ul Gibson Mix.

Mix Materials.
Incubate at 50°C for 1 hour.
Add 25ul Competent Cells to 10ul Gibson Mix. (ADD ON ICE)
Incubate on ice for 30 min.
Incubate at 42°C for 45 sec.
Incubate on ice for at least 2 min.
Add 250ul SOC Media (Make sure it isn't cloudy) to cells.
Shake in 37°C Incubator Room for 30 min rather than 1 hr. (Warm plates also)
Plate on LB-CARB and incubate in 37°C Incubator Room.

Re-Transformed Promoters: (never been transformed, not enough colonies, etc)

PCL2
YDR124W
HYM1
PRM6
PRM1
ECM18
PRM3
PRM2
Negative Control (heated at 55°C for 40 min due to being made late)

ALWAYS MAKE A NEGATIVE CONTROL!

Jessica did a Colony PCR for rtTA Promoters and a Miniprep for the 1st Transformation.

07/03/14

Results of Re-Transformtation of Inducible Promoters + GFP

Few to no colonies grew onthe transformed plates, which leads me to think that the Gibson Assembly failed because only PRM2 worked and was Gibson'ed prior to the other transformed promoters.
PRM2 grew many tiny colonies.

Promoter Colonies

PRM2 TMTC

PCL2 2

PRM6 3

PRM3 2

YDR124W ~ 40

PRM1 0

ECM18 0

HYM1 0

Neg Ctrl 0

Possible Explanations for Failure:

Gibson Assembly failed due to bad Gibson Master Mix
Backbone concentrations were not high enough, which would make sense because PRM2 had a new backbone which had a higher concentration than the rest of the promoters.
- PRM2 Backbone Concentration: 208.7 ng/ul

Backbone Digestion

Jessica remade the backbones, but the concentrations are still very low.
- Used the minipreps from my box in the -20°C fridge.

Colony PCR of Miniprep (Inducible Promoter + GFP)

|Reagents                      | 1X   | 20X   |
|----------------------------- |------| ----- |
|2X GoTaq Green PCR Master Mix | 10µl | 200µl |
|10 µM Forward primer          | 1µl  | ----- |
|10 µM Reverse primer          | 1µl  | 20µl  |
|Water                         | 5µl  | 100µl |
|Miniprep                      | 1µl  | ----- | 
|Total                         | ---- | 320ul |

    Initial Denaturation   | 95°C | 5 min 
      30 Cycles of:
          Denaturation | 95°C | 45s
          Annealing    | 55°C | 30s
          Extension    | 72°C | 1min per kb
    Final Extension    | 72°C | 10m
    Hold               |  4°C  | Forever

10uM FW Primer = individual inducible promoter primers - kept in Jessica's box.
10uM RV Primer = rtTA primer - kept in 2014 iGEM primer working stock box.

Sent into sequencing.

Gel of Miniprep Colony PCR (Inducible Promoter + GFP):

07/07/14

Confusion with Minipreps

Due to a confusion on 7/3/14, all minipreps from before 7/7/14 are to be thrown away from my box. Only the needed minipreps are to be kept.
Inserts were remade for no reason. (old inserts were fine)
Backbones may not have been digested properly. (minimum of 2 hrs needed)

07/08/14

PCR Amplification of new rtTA

Amplification of new rtTA with homology to AFRP's.

extract rtTA from pTS47 (~100ng/ul)

Materials	1x reaction	12x Master Mix
5x Phusion HF Buffer	10 µl	120 µl
dNTP's (10 mM)	1 µl	12 µl
Forward Primer (10µm)	2.5 µl	individually added
Reverse Primer (10µm)	2.5 µl	30 µl
Template DNA:rtTA	1 µl	12 µl
Phusion Polymerase	0.5 µl	6 µl
Water	31 µl	372 µl
DMSO	1.5 µl	18 µl
Total	50 ul	570 ul

(Note: Add enzymes last)

PCR Reaction Procedures:

Mix the regents in a 4.5x Master mix on ice. Make sure to mix well since enzyme is viscous and sinks to the bottom.
Pipette 50ul from the Master Mix into four labled PCR tubes

Put in the thermocycler for the following cycles:

Initial Denaturation   | 95°C | 5 min 
  30 Cycles of: 
      Denaturation | 95°C | 30 sec
      Annealing    | 55°C | 30 sec
      Extension    | 72°C | 2 min
Final Extension    | 72°C | 5 min
Hold               | 4° C | Forever

Keep samples for gel extraction on the following day.

Nanodrop Concentration:

PRM1 = 115.9 ng/ul
PRM2 = 176.6 ng/ul
PRM3 = 169.2 ng/ul
PRM6 = 154.9 ng/ul
ECM18 = 122.5 ng/ul
SAG1 = 161.9 ng/ul
YDR124W = 99.70 ng/ul
CLG1 = 153.5 ng/ul
ASG7 = 139.9 ng/ul
HYM1 = 123.5 ng/ul
PCL2 = 1-2.3 ng/ul

07/09/14

Gibson Assembly of rtTA Inducible Promoters (Transformation #3)

Gibson Assembly Procedures:

|        Materials       |  Amount  |   
|------------------------|----------|
|Gibson Master Mix (2x)  |   5ul    |
|Backbone (pHY4+AFRP+GFP)|   3ul    |
|Insert (rtTA + primer)  |   1ul    |
|ddH2O                   |   1ul    |
|Total                   |   10ul   |

Mix Materials.
Incubate at 50°C for 1 hour.
Add 25ul Competent Cells to 10ul Gibson Mix. (ADD ON ICE)
Incubate on ice for 30 min.
Incubate at 42°C for 45 sec.
Incubate on ice for at least 2 min.
Add 250ul SOC Media (Make sure it isn't cloudy) to cells.
Shake in 37°C Incubator Room for 1 hr. (Warm plates also)
Plate on LB-CARB and incubate in 37°C Incubator Room overnight.

07/10/14

Results of Transformation from 7/9/14

Most of the plates grew well except:
- PRM1
- PRM2
- PRM6
- HYM1
Positive control worked.
Negative control also worked.
- maybe the backbones were not digested enough?
- Going to redo backones for PRM1 and PRM2 (to be redigested)

Backbone Digest for PRM1 and PRM2

Materials	PRM1	PRM2
NotI	0.5 ul	0.5 µl
XhoI	0.5 µl	0.5 µl
CutSmart	5 µl	5 ul
pGEM	0 µl	4 µl
Original Digest	28 µl	40 µl
H2O	16 µl	0 µl
Total	50 ul	50 ul

Incubate at 37°C for at least 2 hours.
PCR Purify.

PCR Purification Procedure:

5 volumes of Buffer PB (with ethanol) to 1 volume PCR sample
To bind DNA, apply sample to column and spin for 1 min
Discard flow through
To wash, add 0.75 ml of Buffer PE to column and centrifuge for 1 min
Discard flow through and place column back in the same tube
Cetrifuge for an addtitional minute (Dry Spin)
Place column in clean 1.5 ml tube
Add 30µl water to column, let stand for 1 min and centrifuge for 1 min

Concentrations of Backbone Digestions of PRM1 and PRM2 were too low; not usable.

Colony PCR Gel of Transformation #3:

07/11/14

Miniprep of Transformation #3

Made cultures of the the transformations.

Sent Transformation #3 into sequencing.

07/14/14

Results of Sequencing and Colony PCR

PCR showed that rtTA and GFP were both present.
Sequencing showed that GFP was in the backbone, not rtTA
- rtTA was probably not in the backbone and was floating near the colonies instead, so when we picked up the colonies for Colony PCR, we also picked up the rtTA with them.
- Will use Backbone set #2 in Jessica's box along with Derrick's PRM1 and PRM2 backbones from 6/09/14.
- Will use the new inserts from 7/11/14 in my box.

Gibson Assembly and Transformation #4

Gibson Assembly Procedures:

|        Materials       |  Amount  |   
|------------------------|----------|
|Gibson Master Mix (2x)  |   5ul    |
|Backbone (pHY4+AFRP+GFP)|  Varies  |
|Insert (rtTA + primer)  |   1ul    |
|ddH2O                   |  Varies  |
|Total                   |   10ul   |

Promoter |Concentration of Backbone| Amount of Insert Needed  |H2O Needed| 
|------- | ----------------------- | ------------------------ | -------- |
PRM1     | ~50.0 ng/ul             | 1 ul                     |   3 ul   |
PRM2     | ~50.0 ng/ul             | 1 µl                     |   3 ul   |
PRM3     | 15.20 ng/ul             | 1 µl                     |   1 ul   |
PRM6     | 21.74 ng/ul             | 1 µl                     |   1 ul   |
ECM18    | 21.39 ng/ul             | 1 µl                     |   1 ul   |
SAG1     | 12.10 ng/ul             | 1 µl                     |   1 ul   |
YDR124W  | 15.46 ng/ul             | 1 µl                     |   1 ul   |
CLG1     | 16.59 ng/ul             | 1 µl                     |   1 ul   |
ASG7     | 23.77 ng/ul             | 3 µl                     |   1 ul   |
HYM1     | 12.96 ng/ul             | 1 µl                     |   1 ul   |
PCL2     | 6.348 ng/ul             | 1 µl                     |   0 ul   |
Pos Ctrl | Gibson Positive Ctrl    | 3 µl Backbone 1 ul Insert|   0 ul   |
Neg Ctrl | PRM1 Backbone           | 1 ul Backbone 0 ul Insert|   4 ul   |

Concentrations of PRM1 and PRM2 Backbones were around 200 ng/ul. I diluted them 1:4 down to 50 ng/ul.

Mix Materials.
Incubate at 50°C for 1 hour.
Add 25ul Competent Cells to 10ul Gibson Mix. (ADD ON ICE)
Incubate on ice for 30 min.
Incubate at 42°C for 45 sec.
Incubate on ice for at least 2 min.
Add 250ul SOC Media (Make sure it isn't cloudy) to cells.
Shake in 37°C Incubator Room for 1 hr. (Warm plates also)
Plate on LB-CARB and keep in drawer over the weekend.

07/15/14

Glycerol Stocks for pTET + GFP + rtTA

Made cultures of pTET + GFP + Const. Promoter + rtTA.
CB008: pTEF1, M6, M7, and M10
CB008DB: M6, and M7

Made a streak plate with the strains on them.

Did a PCR of the rtTA Backbone and Inducible Promoter Insert.
- Used pGEM20 rtTA backbone (~100 ng/ul dilution)

Gel Picture of PCR:

Transformation of HY130E into DH5Fα Cells

All of DNA (~2ul) + 50ul DH5α.
Put on ice for 10 min.
Heatshock for 45 sec at 42°C.
Put on ice for at least 2 min.
Add 250ul SOC.
Incubate for 30 min in 37°C Room Shaker.
Plate 100ul on LB-CARB plate.
Plate 200ul on another LB-CARB plate.

07/16/14

rtTA Insert

Used pGEM16 Template to make rtTA insert.

Gel Extraction of rtTA PCR

Gel Extraction Procedure:

Cut Gel
Weigh it in a colorless tube
Add 3 volumes Buffer QG to 1 volime Gel (100mg ~ 100µl)
Incubate @ 50°C for 10 min or until completely dissolved (vortex every 2-3 min to help dissolve)
Add 1 gel volume isopropanal to the sample and mix
Place a QlAquick soin column in a provided 2ml collection tube
Place sample in column & spin for 1 min -> discard flow through
To wash add 0.75 ml Buffer PE to column & centrifue for 1 min, then dry spin
Place column in 1.5 ml tube
Add 30µl H2O & centrifuge for 1 min.

Gel #1:

Gel #2:

Fragment Weights: (try to cut smaller pieces)

PRM1 = 0.54 g = 540ul
PRM2 = 0.56 g = 560ul
PRM3 = 1.15 g = 1150ul
PRM6 = 1.21 g = 1210ul
ECM18 = 0.61 g = 610ul
SAG1 = 0.68 g = 680ul
YDR124W = 0.45 g = 450ul
CLG1 = 0.4 g = 400ul
ASG7 = 0.31 g = 310ul
HYM1 = 0.50 g = 500ul
PCL2 = 0.42 g = 420ul
M3 = 0.69 g = 690ul

Initial Concentrations of Gel Extraction were too low. Re-PCRed and obtained new concentrations. See Jeffrey's notebook for initial concentrations.
Assisted Jeffrey in doing gel extraction for M3.

New Concentrations:

PRM1 = 102.2 ng/ul
PRM2 = 110.6 ng/ul
PRM3 = 135.5 ng/ul
PRM6 = 130.7 ng/ul
ECM18 = 136.8 ng/ul
SAG1 = 152.4 ng/ul
YDR124W = 78.89 ng/ul
CLG1 = 133.7 ng/ul
ASG7 = 68.15 ng/ul
HYM1 = 91.08 ng/ul
PCL2 = 86.63 ng/ul
M3 = 47.19 ng/ul

Stored in Jessica's box in -20°C fridge.

07/17/14

Gibson and Transformation (Inducible Promoter + rtTA) #5

Gibson Assembly Procedure:

|        Materials       |  Amount  |   
|------------------------|----------|
|Gibson Master Mix (2x)  |   5ul    |
|Backbone (pHY4+AFRP+GFP)|  Varies  |
|Insert (rtTA + primer)  |  Varies  |
|ddH2O                   |  Varies  |
|Total                   |   10ul   |

Promoter |Amount of Backbone Needed| Amount of Insert Needed  |H2O Needed| 
|--------| ----------------------- | ------------------------ | -------- |
PRM1     | 1ul                     | 1 ul                     |   3 ul   |
PRM2     | 3ul                     | 1 µl                     |   3 ul   |
PRM3     | 3ul                     | 1 µl                     |   1 ul   |
PRM6     | 3ul                     | 1 µl                     |   1 ul   |
ECM18    | 3ul                     | 1 µl                     |   1 ul   |
SAG1     | 3ul                     | 1 µl                     |   1 ul   |
YDR124W  | 3ul                     | 1 µl                     |   1 ul   |
CLG1     | 3ul                     | 1 µl                     |   1 ul   |
ASG7     | 3ul                     | 2 µl                     |   0 ul   |
HYM1     | 3ul                     | 1 µl                     |   1 ul   |
PCL2     | 4ul                     | 1 µl                     |   0 ul   |
Pos Ctrl | 3ul                     | 2 ul                     |   0 ul   |
Neg Ctrl | 3ul                     | 1 ul                     |   1 ul   |

Used YDR124W Backbone for Negative Control

Mix Materials.
Incubate at 50°C for 1 hour.
Add 25ul Competent Cells to 10ul Gibson Mix. (ADD ON ICE)
Incubate on ice for 30 min.
Incubate at 42°C for 45 sec.
Incubate on ice for at least 2 min.
Add 250ul SOC Media (Make sure it isn't cloudy) to cells.
Shake in 37°C Incubator Room for 1 hr. (Warm plates also)
Plate on LB-CARB and keep in drawer over the weekend.

07/18/14

Results of Transformation #5

| Promoter | Colonies|                  
|----------|---------|
| PRM1     |    0    |
| PRM2     |    4    |
| PRM3     |    0    |
| PRM6     |  TMTC   |
| ECM18    |    0    |
| SAG1     |  ~25    |
| YDR124W  |    0    |
| CLG1     |    0    |
| ASG7     |    0    |
| HYM1     |    0    |
| PCL2     |    0    |
| Pos Ctrl |    0    |
| Neg Ctrl |    0    |

Used only 100ul for transformation.
Going to try again with the remaining 150ul.
Stored in drawer at room temperature for transformation over the weekend.
Since Positive Control did not work, I suspect that either the positive control was bad or that the Gibson was bad.

07/21/14

Results of Transformation #6

| Promoter | Colonies|                  
|----------|---------|
| PRM1     |   30    |
| PRM2     |   30    |
| PRM3     |   40    |
| PRM6     |  TMTC   |
| ECM18    |   30    |
| SAG1     |   50    |
| YDR124W  |   20    |
| CLG1     |   20    |
| ASG7     |   20    |
| HYM1     |   30    |
| PCL2     |   30    |
| Pos Ctrl |   20    |
| Neg Ctrl |   20    |

Since Positive Control did grow very much and the Negative Control worked, I suspect that either the positive control was bad or that the Gibson was bad.
Incubated for 4 more hours in the 37°C Incubator Room so that the colonies could grow slightly bigger. (All the colonies are very tiny)
Made cultures for PRM2, PRM6, and SAG1 for Colony PCR/Miniprep.

Sent Colony PCR/Miniprep of PRM2, PRM6, and SAG1 into sequencing.

Since most of the transformations did not actually seem to work, we will be trying Seamless to see if the transformations are any better.

Backbone Redigestion

Decided to redigest backbones for higher concentrations

Backbones: PRM3, SAG1, YDR124W, HYM1, PCL2

pGEM #: pGEM3, pGEM6, pGEM7, pGEM10, pGEM11

Materials	PRM3	SAG1	YDR124W	HYM1	PCL2
NotI	0.5 ul	0.5 µl	0.5 ul	0.5 ul	0.5 ul
XhoI	0.5 µl	0.5 µl	0.5 ul	0.5 ul	0.5 ul
CutSmart	5 µl	5 ul	5 ul	5 ul	5 ul
pGEM	5 µl	4 µl	4 ul	7 ul	7 ul
H2O	34 µl	40 µl	40 ul	37 ul	37 ul
Total	50 ul	50 ul	50 ul	50 ul	50 ul

Incubate at 37°C for at least 2 hours.
Heat inactivate at 65°C for 20 min.
Add 10ul of 6x loading dye to each sample.
Gel extract.

Gel Extraction Procedure:

Cut Gel
Weigh it in a colorless tube
Add 3 volumes Buffer QG to 1 volime Gel (100mg ~ 100µl)
Incubate @ 50° C for 10 min or until completely dissolved (vortex every 2-3 min to help dissolve)
Add 1 gel volume isopropanal to the sample and mix
Place a QlAquick soin column in a provided 2ml collection tube
Place sample in column & spin for 1 min -> discard flow through
To wash add 0.75 ml Buffer PE to column & centrifue for 1 min, then dry spin
Place column in 1.5 ml tube
Add 30µl H2O & centrifuge for 1 min.

New Concentrations of Backbones:

Promoter	Concentration
PRM3	13.48 ng/ul
SAG1	44.26 ng/ul
YDR124W	82.00 ng/ul
HYM1	39.66 ng/ul
PCL2	82.97 ng/ul

Seamless Cloning and Assembly Reaction

Seamless Procedure:

Promoter |Amount of Backbone Needed| Amount of Insert Needed  | Seamless | 
|--------| ----------------------- | ------------------------ | -------- |
PRM1     | 1ul                     | 2 ul                     |   3 ul   |
PRM2     | 3ul                     | 2 µl                     |   3 ul   |
PRM3     | 3ul                     | 1.5 µl                   |   1 ul   |
PRM6     | 3ul                     | 1.5 ul                   |   1 ul   |
ECM18    | 3ul                     | 1.5 µl                   |   1 ul   |
SAG1     | 3ul                     | 1.3 µl                   |   1 ul   |
YDR124W  | 3ul                     | 2.5 µl                   |   1 ul   |
CLG1     | 3ul                     | 1.5 µl                   |   1 ul   |
ASG7     | 3ul                     | 3 µl                     |   0 ul   |
HYM1     | 3ul                     | 2.2 µl                   |   1 ul   |
PCL2     | 4ul                     | 2.3 µl                   |   0 ul   |

|        Materials                |  Amount  |
|---------------------------------|----------|
|Inserts (200ng each)             |   x ul   |
|Linear Cloning Vector (50ng each)|   y ul   |
|GeneArt 2X Enzyme Mix            | x+y ul   |

In a microcentrifuge tube, set up the seamless cloning and assembly reaction. It is CRUTIAL that you add the GeneArt 2x Enzyme Mix as the LAST COMPONENT.
Quickly thaw the GeneArt 2x Enzyme Mix on ice and pipette up and down to mix thoroughly. Add (x+y) ul of thawed enzyme. Mix to each reaction. Immediately return GeneArt 2x Enzyme Mix to -80°C Freezer.
Mix the reaction components completely by pipetting up and down SLOWLY 3 times and then gently tap the side of the tubed 3-5 times to mix.
If needed, briefly centrifge (< 500rpm for < 5sec) to collect reaction components to the bottom of the microcentrifuge tube.
Incubate the reaction mix at room temperature for 15-30 min. Do not incubate longer than 30 min!
After incubation is complete, plate the reaction mix on ice for 2-5 min before proceeding to transformation step. Do not let the samples stay on ice for more than 5 min before transformation.

Transformation:

Use 3ul of the seamless cloning and assembly reaction to transform NEB5α cells. Do not use electrocompetent cells.
Follow normal Transformation procedures.
Add 25ul Competent Cells to 10ul Gibson Mix. (ADD ON ICE)
Incubate on ice for 30 min.
Incubate at 42°C for 45 sec.
Incubate on ice for at least 2 min.
Add 250ul SOC Media (Make sure it isn't cloudy) to cells.
Shake in 37°C Incubator Room for 1 hr. (Warm plates also)
Plate on LB-CARB and keep in drawer over the weekend.

Miniprep of Transformations (PRM2, PRM6, SAG1)

Used cultures made on 7/18/14 (put in incubator on 7/20/14)

Miniprep Precedure:

Obtain E.Coli Cultures from 06/16/14 in 37°C Incubation Room.

Resuspend pelleted bacterial cells in 250 µl Buffer PI and transfer to a microcentrifuge tube.
Add 250 µl Buffer P2 and gently invert tube 4-6 times to mix. DO NOT VORTEX.
Add 350 µl Buffer N3 and invert immediately 4-6 times.
Centrifuge for 10 min at 13,000 rpm.
Add supernatant to QIAprep spin column.
Centrifuge for 30-60s - Discard flow through.
Wash QIAprep spin column by adding 0.5 ml Buffer PB and centrifuging for 30-60s - Discard flow through.
Wash column by adding 0.75 ml Buffer PE and centrifuginh for 30-60s
Discard flow through and centrifuge for an additional 1 min to remove residual wash buffer.
Place column in clean 1.5 ml microcentrifuge tube. To elute DNA add 50 µl water or buffer EB, let stand for 1 min and centrifuge for 1 min.

Promoter Concentration

PRM2 225.0 ng/ul

PRM6 491.5 ng/ul

SAG1 439.0 ng/ul

Stored in my box in -20°C fridge.

Sent into sequencing.

Anasuya came in and talked to us about some useful articles to read: mine is the one about "Binding of the B cell Activation..."

07/22/14

Results of Transformation

Seamless Transformation from 7/21/14

| Promoter | Colonies|                  
|----------|---------|
| PRM1     |  some   |
| PRM2     |  some   |
| PRM3     |    0    |
| PRM6     |    0    |
| ECM18    |    0    |
| SAG1     |    0    |
| YDR124W  |    0    |
| CLG1     |    0    |
| ASG7     |    0    |
| HYM1     |    0    |
| PCL2     |    0    |
| Pos Ctrl |  some   |
| Neg Ctrl |  some   |

Possible Explanations:

Used wrong inserts
Seamless went wrong
Mutations of template
Backbones not digested properly (not likely)
PRM1 and PRM2 backbones have GFP
Concentrations of both insert and backbone too low

Final Concensus: We will use another method to transform the cells:

Instead of using Gibson or Seamless, we will PCR with primers for all 7kb.
Currently ordering primers.

Meanwhile, transformations from 7/18/14 worked - colonies grew for all plates

will attempt colony PCR to determine the presence of rtTA
plates to be PCR'ed: PRM3, ECM18, YDR124W, CLG1, ASG7, HYM1, and PCL2
plates to be excluded: PRM1 and PRM2 (both backbones have GFP), PRM6 (has both mutation and rtTA, determined by previous sequencing), SAG1 (backbone has GFP but has recently been redigested), '+' control, '-' control

Culturing pGEM #1-11 (except pGEM7) to make pGEM for backbone digestion tomorrow.

07/23/14

pGEM Miniprep and Overnight Backbone Digestion

Collected cultures from 37°C incubator room - shaker was off for some reason - I turned it back on
Cells grew ok despite shaker incident
pGEM 4 and pGEM6 did not grow very well
Did a miniprep and gel extraction for backbone digestion

07/24/14

Digested Backbones

Did a gel extract.

Concentrations of Backbones:

PRM1 = 60.10 ng/ul
PRM2 = 61.79 ng/ul
PRM3 = 41.36 ng/ul
PRM6 = 55.34 ng/ul
ECM18 = 55.11 ng.ul
SAG1 = 89.55 ng/ul
YDR124W = 35.55 ng/ul
CLG1 = 49.42 ng/ul
ASG7 = 40.27 ng/ul
HYM1 = 33.18 ng/ul
PCL2 = 29.47 ng/ul

Backbones stored in my bix in -20°C fridge.

07/25/14

Transformation

Collected overnight digests of rtTA and Msn2 from 37°C incubator room.

PCR Purification

5 volumes of Buffer PB (with ethanol) to 1 volume PCR sample
To bind DNA, apply sample to column and spin for 1 min
Discard flow through
To wash, add 0.75 ml of Buffer PE to column and centrifuge for 1 min
Discard flow through and place column back in the same tube
Cetrifuge for an addtitional minute (Dry Spin)
Place column in clean 1.5 ml tube
Add 30µl water to column, let stand for 1 min and centrifuge for 1 min

Concentrations of digests:
- rtTA = 28.98 ng/ul
- Msn2 = 34.86 ng/ul

Ligation

1:3 Backbone to Insert

Materials:

Reagents	1x
10x ligase buffer	1 µl
Backbone	2 µl
Msn2	1 µl
rtTA	1 ul
T4 DNA Ligase	1 µl
H2O	4 µl
Total	10 µl

Keep at room temperature for at least 2 hours.

Transformation

Materials	1x
Ligation	10µl
E. Coli Competent Cells	25ul

Mix both together and keep on ice for 30 minutes.
42°C Heat shock for 45 seconds.
Put immediately on ice for at least 2 minutes.
Add 250 ul of SOC media, shake for 1 hr at 37°C.
Plate on selective media and store at room temperature over the weekend.

Had extra cells, so I added 50ul to PCL2.

07/29/14

Colony PCR of AFRP + rtTA

Use rtTA FW primer instead of individual promoter primers
Cultures to use for Colony PCR: PRM2-1, PRM3-2, PRM6-1, ECM18-1, SAG1-3, ASG7-2, HYM1-3
- use plates for the rest of the AFRPs
Use primers 40 and 41, rtTA FW and RV

Colony PCR Procedure:

Using a sterile pipette tip (p200 tip is good), innoculate a single colony and mix in 25ul of water.Do this for 5 colonies. Use 5ul for PCR reaction below.
Set up PCR Reaction below:

Reagents	1X	34X
2X GoTaq Green PCR Master Mix	10 µl	340 µl
10 µM Forward primer	1 µl	34 µl
10 µM Reverse primer	1 µl	34 µl
Water	1.5µl	51 µl
Bacterial cells (template)	5 µl	------
DMSO	1.5 µl	51 ul

Add 15 ul of Master Mix into each tube.

Initial Denaturation   | 95° C | 5 min 
  35 Cycles of: 
      Denaturation | 95° C | 45s
      Annealing    | 55° C | 30s
      Extension    | 72° C | 1min per kb
Final Extension    | 72° C | 10m
Hold               |  4°C  | Forever

Load PCR products on a gel. (5ul) (GoTaq already has loading dye)
For all positive bands on the gel, add rest of bacterial cells from PCR tubes to 5ml LB and grow overnight at 37°C for miniprep on the following day.

Gel Map of Colony PCR:

07/30/14

Re-Colony PCR of SAG1

Redid Colony PCR for SAG1

Miniprep of Colony PCR

Cultures to be miniprep-ed:
- PRM1.6
- PRM2.1
- PRM3.2
- PRM6.4
- ECM18.1
- YDR124W.6
- CLG1.5
- ASG7.4
- HYM1.3
- PCL2.6

Resuspend pelleted bacterial cells in 250 µl Buffer PI and transfer to a microcentrifuge tube.
Add 250 µl Buffer P2 and gently invert tube 4-6 times to mix. DO NOT VORTEX.
Add 350 µl Buffer N3 and invert immediately 4-6 times.
Centrifuge for 10 min at 13,000 rpm.
Add supernatant to QIAprep spin column.
Centrifuge for 30-60s - Discard flow through.
Wash QIAprep spin column by adding 0.5 ml Buffer PB and centrifuging for 30-60s - Discard flow through.
Wash column by adding 0.75 ml Buffer PE and centrifuginh for 30-60s
Discard flow through and centrifuge for an additional 1 min to remove residual wash buffer.
Place column in clean 1.5 ml microcentrifuge tube. To elute DNA add 50 µl water or buffer EB, let stand for 1 min and centrifuge for 1 min.

07/31/14

Sequencing of AFRP + rtTA

Sequencing of 7/30/14 Minipreps
- Sent in: PRM1, PRM2, PRM3, PRM6, ECM18, YDR124W, CLG1, ASG7, HYM1, PCL2
- SAG1 on hold - PRM6 and PCL2 need to be re-Colony PCRed.
Did a Colony PCR for PRM6, SAG1, and PCL2
- Made cultures with 5ml LB+CARB and 20ul cells
- PRM6 = 7, 8, 9
- SAG1 = 10, 11, 12
- PCL2 = 7, 8, 9 (plate may have been contaminated, used white colonies)
Colony PCR failed - no rtTA - decided to re-transform
Ligation
- see procedure above
- stored at 16°C overnight (room temperature)

08/01/14

Transformation of Ligation into NEB5α (C2987) cells

see procedure above - used 25ul cells - stored in 37°C incubator room -Transformed PCL2, PRM6, SAG1, and negative control
Yeast Transformation
- linearized DNA
- boiled salmon sperm at 100°C for 10 min

Yeast Transformation Procedure:

Reagents
YPD
1 M LiOAc
10X TE pH 7.5
1X TE pH 7.5, 0.1 M LiOAc
50% PEG 3350
DMSO
Salmon Sperm DNA (ssDNA)

PEG is viscous, so pipette slowly to prevent air bubbles from forming.
boil ssDNA aliquots for 10 min, then ice down for 10 min before use.

Previous Day : Grew yeast strain to be transformed in 5-10 mL YPD overnight at 30° C

Set up digest to linearize DNA
Dilute O/N culture ~ 1:20 in YPD grow 2-4 hours at 30° C
Prepare ssDNA - boil for 10m cool on ice for at least 10m (10 µl of 10 mg/mL stock per transformation)
Harvest cells in centrifuge - 3000 rpm, 2-5 min
Wash with 1 ml 0.1 M LiOAin TE
Pellet cells - 3000 rpm , 2-5 min
Resuspend pellet in 100 µl 0.1 M LiOAc in TE per 2.5 ml culture, split into 100 µl per epindorph tube for each transformation
to 100 µl cells add 100 µg ssDNA (10 µl of 10 mg/mL sock), 1-5 µl target DNA
Add (in order): 480 µl 50% PEG 3350, 60 µl 10X TE, 60 µl 1 M LiOAc (for final 40% PEG, 1X TE, 0.1 M LiOAc) Optional: Add 75 µl DMSO definitely do
Vortex
Incubate 42° C for 30m & begin drying plates
Pellet (6000 rpm - 2m), discard supernatant (remove PEG completely by pipetting), resuspend in 500 µl YPD (or selective media)
Pellet, discard supernatant, resuspend in risidual ~ 50 µl YPD
Plate on selective media
Incubate 1-3 days at 30°C

08/04/14

Results of E.Coli and Yeast Transformations

E.Coli plates:
- PRM6 = 30
- SG1 = 20
- PCL2 = 20
- Negative Control = 20
Yeast plates:
- CB008: all plates grew at least 30+ colonies
- CB008DB: all plates grew at least 30+ colonies
- YPD became contaminates - plates may be compromised

Did a Colony PCR on successful E.Coli plates.

FW primer = rtTA FW #40
RV primer = rtTA RV #41
cultures = 5ml LB+CARB + 20ul cells

SD, YPD, and LB were contaminated, as a result, some of our yeast plates became contaminated.

Jessica did a Colony PCR for the successful Yeast Plates
Used the uncontaminated colonies for Colony PCR

See Colony PCR procedures for both E.Coli and Yeast above.

08/05/14

Miniprep of E.Coli Cultures

Cultures = PRM6, SAG1, PCL2
- AFRP+rtTA

Miniprep Precedure:

Obtain E.Coli Cultures from 8/4/14 in 37°C Incubation Room.

Resuspend pelleted bacterial cells in 250 µl Buffer PI and transfer to a microcentrifuge tube.
Add 250 µl Buffer P2 and gently invert tube 4-6 times to mix. DO NOT VORTEX.
Add 350 µl Buffer N3 and invert immediately 4-6 times.
Centrifuge for 10 min at 13,000 rpm.
Add supernatant to QIAprep spin column.
Centrifuge for 30-60s - Discard flow through.
Wash QIAprep spin column by adding 0.5 ml Buffer PB and centrifuging for 30-60s - Discard flow through.
Wash column by adding 0.75 ml Buffer PE and centrifuginh for 30-60s
Discard flow through and centrifuge for an additional 1 min to remove residual wash buffer.
Place column in clean 1.5 ml microcentrifuge tube. To elute DNA add 50 µl water or buffer EB, let stand for 1 min and centrifuge for 1 min.

Miniprep Concentrations:

PRM6 = 611.2 ng/ul
SAG1 = 478.1 ng/ul
PCL2 = 384.8 ng/ul

Sent into sequencing

Linearization of E.Coli Minipreps

DIgestion Materials:

Reaction	Amount
DNA	~2000ng
Pme1	0.5ul
CutSmart	2.5ul
H2O	x ul
Total	25ul

Concentration Calculation:

Promoter	Concentration of Miniprep	Amount of Miniprep Needed	H2O
PRM1	376.7 ng/ul	6 ul	16 ul
PRM2	356.8 ng/ul	6 µl	16 ul
PRM3	364.5 ng/ul	6 µl	16 ul
PRM6	611.2 ng/ul	4 ul	18 ul
ECM18	371.7 ng/ul	6 µl	16 ul
SAG1	478.1 ng/ul	5 µl	17 ul
YDR124W	328.4 ng/ul	6 µl	16 ul
CLG1	543.1 ng/ul	4 µl	18 ul
ASG7	348.8 ng/ul	6 µl	16 ul
HYM1	449.6 ng/ul	5 µl	17 ul
PCL2	384.8 ng/ul	6 µl	16 ul

Add reagents and incubate for 2 hours at 37°C Incubation Room.
Also assisted Jeffrey in lineaerizing 11E3128 (423.0 ng/ul) and pGEM22 (384.8 ng/ul).

Transformed linearizations into yeast

CB008: PRM6, ECM18, SAG1, PCL2
CB008DB: all 11 promoters
Forgot to make negative control

Yeast Transformation Procedure:

Reagents
YPD
1 M LiOAc
10X TE pH 7.5
1X TE pH 7.5, 0.1 M LiOAc
50% PEG 3350
DMSO
Salmon Sperm DNA (ssDNA)

PEG is viscous, so pipette slowly to prevent air bubbles from forming.
boil ssDNA aliquots for 10 min, then ice down for 10 min before use.

Previous Day : Grew yeast strain to be transformed in 5-10 mL YPD overnight at 30° C

Set up digest to linearize DNA
Dilute O/N culture ~ 1:20 in YPD grow 2-4 hours at 30° C
Prepare ssDNA - boil for 10m cool on ice for at least 10m (10 µl of 10 mg/mL stock per transformation)
Harvest cells in centrifuge - 3000 rpm, 2-5 min
Wash with 1 ml 0.1 M LiOAin TE
Pellet cells - 3000 rpm , 2-5 min
Resuspend pellet in 100 µl 0.1 M LiOAc in TE per 2.5 ml culture, split into 100 µl per epindorph tube for each transformation
to 100 µl cells add 100 µg ssDNA (10 µl of 10 mg/mL sock), 1-5 µl target DNA
Add (in order): 480 µl 50% PEG 3350, 60 µl 10X TE, 60 µl 1 M LiOAc (for final 40% PEG, 1X TE, 0.1 M LiOAc) Optional: Add 75 µl DMSO definitely do
Vortex
Incubate 42° C for 30m & begin drying plates
Pellet (6000 rpm - 2m), discard supernatant (remove PEG completely by pipetting), resuspend in 500 µl YPD (or selective media)
Pellet, discard supernatant, resuspend in risidual ~ 50 µl YPD
Plate on selective media
Incubate 1-3 days

08/08/14

Results of Transformation

CB008 = all plates grew 20-30 colonies except for PRM6, which did not grow.
CB008DB = all plates grew 20-30 colonies
Both plates had small colonies

Did a Colony PCR on the Transformations

Flow Testing

CB008 Const+rtTA+GFP+mfa+pAGA mCherry

Plate map for all time points (4 plates):

  1   2   3   4   5   6   7   8   9   10  11  12
A [CB008 m6-1]----]       [CB008 m10-3]----]
B [CB008 m6-2]----]       [CB008DB m7-1]---]
C [CB008 m6-3]----]       [CB008DB m7-2]---]
D [CB008 m7-1]----]       [CB008DB m7-3]---]
E [CB008 m7-2]----] 
F [CB008 m7-3]----]           
G [CB008 m10-1]---] 
H [CB008 m10-2]---]

[Dox] Concentration Map:

        H   G   F   E   D   C   B   A   
1       [--------0 µg/ml------------]
2       [--------0.03 µg/ml---------]
3       [--------0.06 µg/ml---------]
4       [--------0.09 µg/ml---------]
5       [--------0.6 µg/ml----------]
6 
7       [--------0 µg/ml------------]
8       [--------0.03 µg/ml---------]
9       [--------0.06 µg/ml---------]
10      [--------0.09 µg/ml---------]
11      [--------0.6 µg/ml----------]
12

See notes on flow in Eric's notebook.

08/12/14

Colony PCR of Yeast for rtTA and mfa

Boil Yeast at 95°C for 20 minutes.

Using a sterile pipette tip (p200 tip is good), innoculate a single colony and mix in 15ul of NaOH. Take 3 colonies from each plate. Use 5ul for PCR reaction below.
Set up PCR reaction below:

Reagents (rtTA)	1X	43X
2X GoTaq Green PCR Master Mix	10 µl	430 µl
10 µM Forward primer	1 µl	43 µl
10 µM Reverse primer	1 µl	43 µl
Water	1.5µl	64.5 µl
cells (template)	5 µl	-------
DMSO	1.5ul	64.5 ul

FW primer = pSV606

Reagents (rtTA)	1X	7X
2X GoTaq Green PCR Master Mix	10 µl	70 µl
10 µM Forward primer	1 µl	7 µl
10 µM Reverse primer	1 µl	7 µl
Water	1.5µl	10.5 µl
cells (template)	5 µl	-------
DMSO	1.5ul	10.5 ul

Add 15 ul of Master Mix into each tube.

Initial Denaturation    | 95°C | 5 min 
  35 Cycles of: 
      Denaturation | 95°C | 45s
      Annealing    | 55°C | 30s
      Extension    | 72°C | 1min per kb
Final Extension    | 72°C | 10m
Hold               |  4°C | Forever

Load PCR products on a gel. (5ul) (GoTaq already has loading dye)

Results of Colony PCR:

08/13/14

Doxycyline Dilutions (Dilutions by Ianto)

Stock in Siberia Fridge (Middle Shelf, Middle Rack, Top Drawer, 3rd Box) 100 mg/ml

x	Concentration	Take from x	Amount of x Needed	H2O Needed
A	60	Stock	60 ul	940 ul
B	30	Stock	30 ul	970 ul
C	9	A	150 ul	850 ul
D	6	A	50 ul	900 ul
E	3	A	50 ul	950 ul
F	0.9	C	100 ul	900 ul
G	0.6	D	100 ul	900 ul
H	0.3	E	100 ul	900 ul
I	0.09	F	100 ul	900 ul
J	0.06	G	100 ul	900 ul
K	0.03	H	100 ul	900 ul

Vortex while like making and before adding to each dilution.

Assisted Derrick in running plates (time points: 0, 1.5, 3, 5)

See Derrick's lab norebook for reference.

08/17/14

Due to contamination of the plates from the flow run of 8/13/14, another run will be needed of the same experiment.
- Plate had large clumps of cells due to not being cleaned out well.
- Make sure to put finished shaker plate in bleach bin (near Hyun's desk, under the table in a blue bin)

prepared cultures of pTEF1, M6, M7, and M10 to be diluted on the following day for flow.

CB008 const+rtTA+GFP+mfa+pAGA1+mCherry

Plate Map

	1	2	3	4	5	6	7	8	9	10	11	12
A	1	1	1	1	1	1	7	7	7	7	7	7
B	1	1	1	1	1	1	10	10	10	10	10	10
C	1	1	1	1	1	1	10	10	10	10	10	10
D	6	6	6	6	6	6	10	10	10	10	10	10
E	6	6	6	6	6	6
F	6	6	6	6	6	6
G	7	7	7	7	7	7
H	7	7	7	7	7	7

1 = PTEF1 6 = M6 7 = M7 10 = M10

[Dox] Concentration Map:

        H   G   F   E   D   C   B   A   
1       [--------0 µg/ml------------]
2       [--------0.03 µg/ml---------]
3       [--------0.06 µg/ml---------]
4       [--------0.09 µg/ml---------]
5       [--------0.6 µg/ml----------]
6       [----------6 µg/ml----------]
7       [--------0 µg/ml------------]
8       [--------0.03 µg/ml---------]
9       [--------0.06 µg/ml---------]
10      [--------0.09 µg/ml---------]
11      [--------0.6 µg/ml----------]
12      [----------6 µg/ml----------]

08/18/14

CB008 Const+rtTA+GFP+mfa+pAGA1+mCherry Round 2

Ran plate with 5 time points (0, 1.5, 3, 5, 8)

added 15ul of dox to induce
Added 10ul of cycloheximide to each well to stop growth.

Finished running the first two plates (0hr and 1.5hr)

Slow run may be due to the cells being overdilute. (source: Kara)
Plate run to be continued and finished on 8/19/14

CB008DB Const+rtTA+GFP+mfa+pAGA+mCherry

Started cultures for this experiment.

To be ran on 8/20/14

All 5 Const. Promoters available.

	1	2	3	4	5	6	7	8	9	10	11	12
A	1	1	1	1	1	1	6	6	6	6	6	6
B	1	1	1	1	1	1	7	7	7	7	7	7
C	1	1	1	1	1	1	7	7	7	7	7	7
D	3	3	3	3	3	3	7	7	7	7	7	7
E	3	3	3	3	3	3	10	10	10	10	10	10
F	3	3	3	3	3	3	10	10	10	10	10	10
G	6	6	6	6	6	6	10	10	10	10	10	10
H	6	6	6	6	6	6

1 = PTEF1 3 = M3 6 = M6 7 = M7 10 = M10

[Dox] Concentration Map:

        H   G   F   E   D   C   B   A   
1       [--------0 µg/ml------------]
2       [--------0.03 µg/ml---------]
3       [--------0.06 µg/ml---------]
4       [--------0.09 µg/ml---------]
5       [--------0.6 µg/ml----------]
6       [----------6 µg/ml----------]
7       [--------0 µg/ml------------]
8       [--------0.03 µg/ml---------]
9       [--------0.06 µg/ml---------]
10      [--------0.09 µg/ml---------]
11      [--------0.6 µg/ml----------]
12      [----------6 µg/ml----------]

08/20/14

CB008DB Const+rtTA+GFP+pAGA1+mCherry Run

Ran plate with 5 time points (0, 1.5, 3, 5, 8)

Ran first plate and noticed that specimen 5 only had 10ul loaded due to the addition of a new speciment (parameters were reset)
- Readjusted the parameters and reran the well that only had 10ul loaded
- Make sure to check parameters for all wells before running plate.
Stopped plate run at 3hr plate - D7

08/21/14

CB008DB Const+rtTA+GFP+pAGA1+mCherry Run (Cont.)

Continued running 3hr plate from 8/20/14
Finished 3 and 5 hr plates but could not do 8 hr plate because the plate was dropped.

Hyun said not to run DB plates

08/25/14

CB008 Const+rtTA+GFP+mfa+pPCL2+mCherry Preparation

Plate Map

	1	2	3	4	5	6	7	8	9	10	11	12
A	1	1	1	1	1	1	7	7	7	7	7	7
B	1	1	1	1	1	1	10	10	10	10	10	10
C	1	1	1	1	1	1	10	10	10	10	10	10
D	6	6	6	6	6	6	10	10	10	10	10	10
E	6	6	6	6	6	6
F	6	6	6	6	6	6
G	7	7	7	7	7	7
H	7	7	7	7	7	7

1 = PTEF1 6 = M6 7 = M7 10 = M10

Grew cultures and put into 30°C incubator.

[Dox] Concentration Map:

        H   G   F   E   D   C   B   A   
1       [--------0 µg/ml------------]
2       [--------0.03 µg/ml---------]
3       [--------0.06 µg/ml---------]
4       [--------0.09 µg/ml---------]
5       [--------0.6 µg/ml----------]
6       [----------6 µg/ml----------]
7       [--------0 µg/ml------------]
8       [--------0.03 µg/ml---------]
9       [--------0.06 µg/ml---------]
10      [--------0.09 µg/ml---------]
11      [--------0.6 µg/ml----------]
12      [----------6 µg/ml----------]

08/26/14

CB008 Const+rtTA+GFP+mfa+pPCL2+mCherry Run

Was only able to finish running 0 hr plate and 5 hr plate up to C2.
Wells D4 and G3 on plates should not have sample due to error during dilutions.
All of M10 seems to not have grown compared to the other strains.

08/27/14

CB008 Const+rtTA+GFP+mfa+pPCL2+mCherry Run (Cont.)

Accidentally did not run the last specimen (M10) on the 5hr plate due to Eric's advice on not wasting time because M10 did not grow.

Re-streaking of old plates

Started restreaking old streak plates onto organized plates. (organized by pGEM #s)

08/28/14

Data Analysis of CB008 Const+rtTA+GFP+mfa+pPCL2+mCherry Run

After using FlowJo and Matlab to analyze data, we have come to the conclusion that CB008 Const+rtTA+GFP+mfa+pPCL2+mCherry does not have RFP.
Compared pPCL2 RFP to pAGA1 RFP runs. pAGA1 has much RFP levels.

Prepared cultures of CB008DB Const+rtTA+GFP+mfa+pPCL2+mCherry M3, M6, M7, and M10 to be ran on the following day to confirm the presence or lack of presence of RFP.

pTEF1 missing, may need to grow a glycerol stock streak plate of it.

09/02/14

CB008DB Const+rtTA+GFP+mfa+pPCL2+mCherry Run

Shaker plate not completely clean, I attemped to clean it out with water. Saw chunks of dried cells on the bottom of some of the wells. MAKE SURE YOU PUT THE SHAKER PLATE IN THE BLEACH BIN AFTER USE!!!
M10 may be contaminated due to the shaker plate.
M6 culture was not labeled correctly in the incubator shaker, M6 may not actually be the right specimen.

Ran 2 time points: 0 hr and 5 hrs.

Data to be analyzed in the near future after asking Ianto how to run only two time points.

09/04/14

Co-culture of CB008 Const+rtTA+GFP+mfa+pAGA1+mCherry (pTEF1, M7, M10)

Plate Map:

A1-A6 = pTEF1+M7
B1-B6 = pTEF1+M7
C1-C6 = pTEF1+M7
D1-D6 = M7+M10
E1-E6 = M7+M10
F1-F6 = M7+M10
G1-G6 = M10+pTEF1
H1-H6 = M10+pTEF1
A7-A12 = M10+pTEF1

Dox Map:

Lane 1 = 0
Lane 2 = 0.03
Lane 3 = 0.06
Lane 4 = 0.09
Lane 5 = 0.6
Lane 6 = 6
Lane 7 = 0
Lane 8 = 0.03
Lane 9 = 0.06
Lane 10 = 0.09
Lane 11 = 0.6
Lane 12 = 6
Grew cultures of CB008 Const+rtTA+GFP+mfa+pAGA1+mCherry
- pTEF1
- M7
- M10
  - stored in 30°C incubator shaker.

09/05/14

Co-culture of CB008 Const+rtTA+GFP+mfa+pAGA+mCherry Run

5 Timepoints: 0, 1.5, 3, 5, 8.
Successfully ran all the plates.

09/10/14

Data Analysis of Co-culture of CB008 Const+rtTA+GFP+mfa+pAGA+mCherry Run

After running the data on FlowJo and Matlab, we compared the data to the original pAga1+mCherry pTEF1, M7, and M10 data.
The comparison showed slight variation and unexpected results.
- Maybe due to the larger cells being too stressed from producing so many proteins, and the overall population producing less as a result of this.
After comparing the data, it was decided that the best option would be to rerun this experiment but with pTEF1, M7, and M10 separately put on the plate as a comparison.
Started growing cultures of pTEF1, M7, and M10 in the incubator.

09/11/14

Co-Culture of CB009 Const+rtTA+GFP+mfa+pAGA+mCherry Round 2

Plate Map:

A1-A6 = pTEF1
B1-B6 = pTEF1
C1-C6 = pTEF1
D1-D6 = M7
E1-E6 = M7
F1-F6 = M7
G1-G6 = M10
H1-H6 = M10
A7-A12 = M10
B7-B12 = M7+pTEF1
C7-C12 = M7+pTEF1
D7-D12 = M7+pTEF1
E7-E12 = M7+M10
F7-F12 = M7+M10
G7-G12 = M7+M10

Dox Map:

Lane 1 = 0
Lane 2 = 0.03
Lane 3 = 0.06
Lane 4 = 0.09
Lane 5 = 0.6
Lane 6 = 6
Lane 7 = 0
Lane 8 = 0.03
Lane 9 = 0.06
Lane 10 = 0.09
Lane 11 = 0.6
Lane 12 = 6

Did not make a co-culture of pTEF1+M10 because the two promoters are too close in activity to make much of a difference.

09/12/14

Attempt of Co-Culture CB008 Const+rtTA+GFP+mfa+pAGA1+mCherry Round 2 Run

Cancelled due to wrong culture being grown and due to the absence of induction.
Make sure that Eleanor and George pay attention when growing cultures and when inducing with doxycycline.
pPCL2 was grown instead of pAGA1. pPCL2 cannot be used in a co-culture due to its lack of RFP.

Experiment to be continued at another time.

09/14/14

Co-Culture CB008 Const+rtTA+GFP+mfa+pAGA1+mCherry Round 2 Preparation

Plate Map:

A1-A6 = pTEF1
B1-B6 = pTEF1
C1-C6 = pTEF1
D1-D6 = M7
E1-E6 = M7
F1-F6 = M7
G1-G6 = M10
H1-H6 = M10
A7-A12 = M10
B7-B12 = M7+pTEF1
C7-C12 = M7+pTEF1
D7-D12 = M7+pTEF1
E7-E12 = M7+M10
F7-F12 = M7+M10
G7-G12 = M7+M10

Dox Map:

Lane 1 = 0
Lane 2 = 0.03
Lane 3 = 0.06
Lane 4 = 0.09
Lane 5 = 0.6
Lane 6 = 6
Lane 7 = 0
Lane 8 = 0.03
Lane 9 = 0.06
Lane 10 = 0.09
Lane 11 = 0.6
Lane 12 = 6

Did not make a co-culture of pTEF1+M10 because the two promoters are too close in activity to make much of a difference.

Made sure to use pAGA1 this time.
Cultures growing in yeast incubator.

09/15/14

Co-Culture CB008 Const+rtTA+GFP+mfa+pAGA1+mCherry Round 2 Run

Time Points: 0, 1.5, 3, 5, 8.

Made sure to induce with doxycycline this time.
Also made sure to create the right file name this time.

Successfully finished running the plate

Analyzed the data and made scatter plots

Made cultures of AFRP+rtTA+GFP+mfa+pAGA+mCherry

PRM1
PRM2
PRM3
YDR124W
CLG1

AFRP+rtTA+GFP+mfa+pAGA+mCherry Preparation

Plate Map:

A1-A6 = PRM1
B1-B6 = PRM1
C1-C6 = PRM1
D1-D6 = PRM2
E1-E6 = PRM2
F1-F6 = PRM2
G1-G6 = PRM3
H1-H6 = PRM3
A7-A12 = PRM3
B7-B12 = YDR124W
C7-C12 = YDR124W
D7-D12 = YDR124W
E7-E12 = CLG1
F7-F12 = CLG1
G7-G12 = CLG1

Dox Map:

Lane 1 = 0
Lane 2 = 0.03
Lane 3 = 0.06
Lane 4 = 0.09
Lane 5 = 0.6
Lane 6 = 6
Lane 7 = 0
Lane 8 = 0.03
Lane 9 = 0.06
Lane 10 = 0.09
Lane 11 = 0.6
Lane 12 = 6

09/16/14

AFRP+rtTA+GFP+mfa+pAGA+mCherry Run

Time Points = 0, 1.5, 3, 5, 8.

Successfully ran all plates.

09/17/14

Absent due to doctor's appointment.

09/18/14

Data Analysis of AFRP+rtTA+GFP+mfa+pAGA+mCherry Run

Ran the data on FlowJo and Matlab.

Got interesting results like bimodal populations and large amounts of noise.

Eleanor's Transformations

Assisted Eleanor in her transformations of CB008 M3 and M6 with pTET+mfa, pAGA1+mCherry, and pPCL2+mCherry.

None of her transformations worked other than M3+mfa which had 2 colonies. I put the plates back into the incubator in case they worked.

Made cultures of M3+rtTA and M6+mfa to re-transform the following day.

09/19/14

Results of Eleanor's Transformations

Plates that grew colonies:

CB008 M3 pAGA1+mCherry = 1 colony
CB008 M3 mfa = 2 colonies
CB008 M6 mfa+pPCL2+mCherry = 4 colonies
Will do a Colony PCR to check plates - unlikely that plates worked
Linearized plasmids: mfa and pAGA1+mCherry

Kara advises us to not used previously linearized plasmid.

will attempt to use Jeffret's digested pPCL2+mCherry for M6.

Re-transformed and put into incubator:

CB008 M3+mfa
CB008 M3+pAGA1+mCherry
CB008 M3+mfa+pAGA1+mCherry
CB008 M6+mfa+pAGA1+mCherry
CB008 M6+mfa+pPCL2+mCherry

9/22/14

Colony PCR of Transformations

Ran colony PCR's of the Transformations from 9/19 and 9/15 of the CB008 Constitutive Promoters.

Checked for mfa and pPCL2/pAGA1+mCherry separately.

Colony PCR Gel: (Eleanor said that M6 already has mfa even if there is no band)

09/25/14

PCR Amplification of Bar1, mfa, and pGEM1-16 (except 7 and 10)

Due to the primers not covering all of the needed insert parts, new primers with new overhangs were ordered. I was put in charge of PCR amplifying the plasmids with these new primers.

Used primers #103-110.

mfa Template: Shuaixin's PRM2 + mfa (7.606) Plasmid

Bar1 Template: Shuaixin's PCL2 + Bar1 (6.62) Plasmid

George did the PCR for Ste2.

Used Seamless to transform all the plasmids. George made a pGEM10 PCR insert, which I used for transformation.

Used pSB1C3 as backbone. Used cleaned up undigested one.

09/26/14

Results of Transformation

All the pGEM plates transformed very well.

Bar1, Ste2, and mfa did not transform very well.

Negative control grew for some reason also, hopefully because of a contamination of PCR product.

Colony PCR of Transformation

After a few more hours of growing in the incubator, Bar1, Ste2, and mfa grew more cells.

Did a colony PCR on all the plates (3 colonies from each plate) (a total of 62 Colony PCRs including 5 colonies of Eleanor's Bar1 Transformations)

Jeffrey ran the gel for my Colony PCR.

Colony PCR Gel:

09/28/14

I moved to UC Davis and will be taking a break from lab work to concentrate on classes.

Kara made cultures from the plates for the successful Colony PCR's to miniprep on Monday.

09/29/14

Miniprep of Cultures

Eleanor did the miniprep of the cultures from 9/28/14 and sent them into sequencing.

09/30/14

Results of Sequencing

Sequencing showed that the miniprep was wrong. May have to redo everything or pick new colonies off the plates? Need to discuss with Kara on this matter.

Jessica's Notes

Protocols and Procedures in Lab Notebook, Eric's Notebook
TO-DO:
[ ] Chronicle attempts at alpha-inducible promoters cloning, link related tasks
[ ] link/update pictures, graphs, data (if possible/desirable)
[ ] add gel photos

WEEK i

Tuesday May 27, 2014

Meet Kara, Derrick
Go around lab

Generally got set up for iGEM, lab work.

Wednesday May 28, 2014

Meet Eric

I. PCR 13 alpha-inducible yeast promoters

PRM2

ASG7

FUS2

PCL2

FUS3

CLG1

YDR124W

HYM1

PRM6

PRM1

ECM18

PRM3

SAG1

II. Transformation of E. coli with backbone plasmid

Mach 1 cells with pHY4 plasmid

Thursday May 29, 2014

Come in late due to dentist appointment

I. Gel Extraction of 5/28 PCR

Friday May 30, 2014

I. Mini-Prep E. coli cultures from 5/29 Transformation
- Extract plasmid backbone

II. Backbone Digestion

WEEK ii

Monday June 2, 2014

Ianto returns

I. Ligation of pHY4 Backbone + promoters

II. PCR unsuccessful/low-yield promoters from 5/28

III. Gel Extract 6/02 Primers

Promoter Concentration

FUS2 failed

PCL2 84.35

YDR124W 134.3

PRM6 84.14

ECM18 91.99

PRM1 64.64

Tuesday June 3, 2014

I. PCR Yeast Promoters
- redo of 5/28 PCR due to low yield

II. Gel Extraction of PCR

Wednesday June 4, 2014

I. Mini-prep Backbone DNA + promoter
- transformation done previously

II. Digestion of plasmids in relation to 6/03 PCR (?)

Thursday June 5, 2014

I. Mini-prep Promoters from 6/02 PCR

II. Ligation of 6/03 Promoters

III. Transformation of E. coli with 6/05 Ligation DNA

IV. Transformation of Yeast with linearized promoters
- YTS18 strain

Friday June 6, 2014

I. Colony PCR of 6/05 E. coli transformation

WEEK 1

Monday June 9, 2014

First day of bootcamp
Meet rest of iGEM: Eleanor, Sabrina, Robert, George, Jeffrey
Sometime before here, decide to give up on FUS2 and FUS3

I. Mini-prep Colonies from 6/06 Colony PCR

II. Yeast Colony PCR of 6/05 Yeast Transformation

Tuesday June 10, 2014

I. Digestion of pHY4 + alpha promoter + GFP

Wednesday June 11, 2014

I. PCR Purification of 6/10 digestion

Promoter	Concentration
PRM2	59.01
ASG7	89.23
PCL2	101.3
CLG1	93.58
YDR124W	127.5
HYM1	16.55
PRM6	400.0
PRM1	19.4
ECM18	118.7
PRM3	87.11
SAG1	179.2

II. Gibson Assembly of pHY4 + alpha promoter (I.) and rtTA inserts (made by Derrick 6/10)

III. Transformation of E. coli with Gibson Assembly (II.) {Attempt 1}
- DH5alpha E. coli strain
- 6/12 Results: failed. Use higher efficiency cells?

Thursday June 12, 2014

I. Seamless Cloning Assembly reaction of alpha promoter + rtTA

II. Transformation of E. coli with Seamless Cloning (I.) {Attempt 1.2}
- Top 10 E. coli strain

Friday June 13, 2014

did not come in - attending cousin's graduation
NASA field trip

WEEK 2

Monday June 16, 2014

Lab meeting
- presentation on ongoing work

I. Colony PCR of 6/11 E. coli transformation

II. Yeast Colony PCR of 6/13 yeast transformations (done by ?)

Tuesday June 17, 2014

I. Colony PCR of failed yeast + alpha promoter + GFP from 6/16

II. Mini-prep of pHY4 + alpha promoter + rtTA E. coli successful colonies from 6/16 Colony PCR/ 6/11 Transformation

Promoter+rtTA	Concentration
ECM18 1	308.3
ECM18 2	231.6
PCL2 1	162.7
PCL2 2	247.3
PRM6 1	248.1
PRM6 2	327.9
ASG7 1	351.7
ASG7 2	593.5
HYM1 1	221.7
HYM1 2	413.0
PRM2 1	324.3
PRM2 2	339.6
PRM3 1	351.5
PRM3 2	316.7
CLG1 1	289.0
CLG1 2	276.8
YDR124W 1	366.0
YDR124W 2	239.3

- sent to sequencing {Attempt 1}
- 6/18 Results: failed

Wednesday June 18, 2014

I. Transformation of yeast with alpha promoter + GFP (from 5/30 I.)
- yeast strains CB008 and CB008DB

II. Overnight cultures of yeast from (I.)

Thursday June 19, 2014

I. Culture colonies from 6/12 transformation (6/12 II.)

II. Glycerol stocks of successful yeast strains from 6/18 transformation

Friday June 20, 2014

I. Learned to use flow cytometer
- Characterization of alpha-inducible promoter + GFP in CB008 yeast

II. Mini-prep successful colonies from 6/19 cultures (6/19 I.)
- sent to sequencing {Attempt 2}
- 6/23 Results: failed, determined rtTA gene was incomplete

WEEK 3

Monday June 23, 2014

Lab meeting
- presentation on iGEM Parts Registry and Parts Submission

I. Digestion of some pHY4 + alpha promoters - GFP (redo of 6/10 Digestion)

II. Culture DH5alpha + pHY4 + HYM1 cells for mini-prep (runnning low)

III. Gel Extraction of Digestion (I.)

Promoter	Concentration
ASG7	23.77
CLG1	16.59
HYM1	12.96
ECM18	21.39
PRM3	15.20

Tuesday June 24, 2014

I. PCR Purification of remaining pHY4 + alpha promoters - GFP (Digestion done by Derrick)

Promoter	Concentration
PRM2	0.4510
YDR124W	15.46
SAG1	12.10
PRM6	21.74
PRM1	4.186
PCL2	6.348

II. PCR of alpha promoter primer + rtTA with new rtTA RV primer

Wednesday June 25, 2014

I. Gel Check of 6/24 PCR - failed

II. Mini-prep of rtTA, other plasmids (transformed by Eric and Derrick 6/24)

Thursday June 26, 2014

I. PCR of alpha promoter primer + rtTA (Redo of 6/24 II.)

Friday June 27, 2014

I. Gel Check and PCR Purification of 6/26 PCR (6/26 I.)

Promoter	Concentration
PRM2	107.0
ASG7	111.2
PCL2	96.49
CLG1	114.8
YDR124W	90.53
HYM1	72.29
PRM6	99.83
PRM1	75.35
ECM18	18.81
SAG1	104.1
pTEF	182.3

II. Digest Excess plasmid from (I.)

III. Gibson Assembly of primer + rtTA (I.) and pHY4 + promoter (6/23, 6/24) {Attempt 3}

IV. Transformation of E. coli with pHY4 + alpha promoter + rtTA {Attempt 3}
- use Mach 1 E. coli strain and Gibson Assembly (III.)

WEEK 4

Monday June 30, 2014

Lab meeting
- update on alpha promoters cloning
- continue to clone alpha-inducible promoters + rtTA with Sabrina

I. Gibson Assembly of rtTA + PRM2 (related to 6/27 III.)

II. Colony PCR of 6/27 E. coli transformation (6/27 IV.)

III. PCR of rtTA + ECM 18 primer (related to 6/26 I.)

Tuesday July 1, 2014

I. Gel Check and PCR Purification of 6/30 PCR of rtTA + ECM18
- rtTA+ECM18 Concentration: 173.9

II. Mini-prep of alpha promoter + rtTA from 6/30 Colony PCR (6/30 II.)
- Sent to sequencing {Attempt 3}
- 7/02 Results: all had CTATTCTCACTCTTTGGACCT interrupting stop codon or failed

Promoter	Colony	Concentration
ASG7	1	203.0
	2	282.9
	3	244.9
PCL2	1	205.5
	2	205.3
	3	305.3
CLG1	1	155.5
	2	187.0
	3	230.0
YDR124W	1	89.44
PRM6	1	246.4
	2	17.32
	3	154.0
PRM3	1	244.9
	3	180.1
SAG1	1	146.5
	2	243.8
	3	137.8

III. Culture PRM1 + rtTA due to low cell count

IV. Yeast Colony PCR of CB008 + constitutive promoters + GFP (made previously by Jeffrey, Sabrina, George, Robert, Eleanor)

V. Gel Check and PCR Purification of (IV.)

Wednesday July 2, 2014

I. Yeast Colony PCR and Gel Check of CB008 + constitutive promoters + GFP (Attempt 2, redo of 7/01 IV.)

II. Colony PCR and Gel Check of 7/01 Mini-preps (7/01 II.)

III. Cultures of remaining pHY4 + alpha promoters + rtTA E. coli colonies from 6/27 transformation (6/27 IV.)

IV. Gibson Assembly of failed alpha promoters + rtTA {Attempt 4}

V. Transformation of E. coli with (IV.) {Attempt 4}
- Result: low or no yield on plates, possibly due to low backbone concentration
- PRM2 overgrown, sequencing contained GFP

Thursday July 3, 2014

I. Mini-prep of (7/02 III.) cultures
- Sent to sequencing {Attempt 4}
- 7/07 Results: all had CTATTCTCACTCTTTGGACCT interrupting stop codon or failed

II. Digestion and Gel Extraction of pHY4 + alpha promoter + GFP (Redo of 6/23 I. and 6/24 I.)

Monday July 7, 2014

No lab meeting

I. Gel Check of alpha promoter + rtTA Colony PCR (done by Sabrina)

II. Linearization of HY86E3
- contains pTET + GFP

III. PCR Purification of (II.)

WEEK 5

Tuesday July 8, 2014

I. PCR & PCR Purification of alpha promoter primer + rtTA (redo of 6/26)

Wednesday July 9, 2014

I. Gibson Assembly of pHY4 + alpha promoter + rtTA {Attempt 5}
- use backbone from 7/03 II.
- use rtTA insert from 6/08 I.

II. Transformation of E. coli with pHY4 + alpha promoter + rtTA {Attempt 5}
- 7/10 Results: failed negative control, GFP may still be present

Thursday July 10, 2014

Attended Lim Lab meeting
Work on lab meeting presentation - Parts Registry and Human Practices

I. Digestion of pHY4 + PRM1 + GFP and pHY4 + PRM2 + GFP (redo of 7/03 II.)

II. Colony PCR of 6/09 E. coli transformation (6/09 II.)

Friday Jul 11, 2014

Work on presentation
Continual edits to HP letters

I. Gel Check and mini-prep pHY4 + alpha promoter + rtTA plasmids from 6/10 II.
- Sent to sequencing {Attempt 5}

Promoter	Concentration	7/14 Sequencing Results
PRM1	73.71	contains GFP
PRM2	143.0	contains GFP
PRM3	65.07	contains GFP
PRM6	80.45	contains GFP
ECM18	143.0	contains GFP
SAG1	335.9	contains GFP
YDR124W	50.44	contains GFP
CLG1	79.84	contains GFP
ASG7	36.22	contains GFP
HYM1	41.63	contains GFP
PCL2	162.3	contains GFP

- 7/14 Results: all contained GFP, backbone not properly digested

WEEK 6

Monday July 14, 2014

Lab meeting - meet Wendell officially for first time
- present on Parts Registry and Human Practices
PTS47 mini-prep sequencing returned - contains CTATTCTCACTCTTTGGACCT

I. Gibson Assembly using previous backbone - ABANDONED

Tuesday July 15, 2014

Meet Shuaixin

I. PCR of rtTA + alpha promoter primer homology
- use rtTA template from Jeffrey's successful transformation (7/14)

II. Set up cultures for Glycerol stocks of new yeast strains

yGEM37 CB008 pTEF1
yGEM39 CB008 pTEFm6
yGEM40 CB008 pTEFm7
yGEM41 CB008 pTEFm10
yGEM44 CB008DB pTEFm6
yGEM45 CB008DB pTEFm7

Wednesday July 16, 2014

Kara gone
PTS47 stock sequencing returned - contains CTATTCTCACTCTTTGGACCT sequence ):

I. Gel Extract of 7/15 PCR - done by Jeffrey+Sabrina - low concentrations, decide to rePCR

Promoter	Concentration
PRM1	TBA
PRM2
PRM3
PRM6
ECM18
SAG1
YDR124W
CLG1
ASG7
HYM1
PCL2
pTEFm3

II. Glycerol Stocks of yeast strains: pTET+GFP pTEF#+rtTA
- use cultures from 7/15 II.

yGEM37 CB008 pTEF1
yGEM3 9CB008 pTEFm6
yGEM40 CB008 pTEFm7
yGEM41 CB008 pTEFm10
yGEM44 CB008DB pTEFm6
yGEM45 CB008DB pTEFm7

Thursday July 17, 2014

Kara, Sabrina gone
- Email Kara about progress
Talk with Anasuya
- start this online lab journal
- Wiki pages for website - start updating/saving now, update along the way (papers, figures, schematics)
- understand biological basis of modeling goal - specific examples (specific disease - neuroinflammation)
  - 4 slides with 4 potential examples
  - analogue to alpha-inducible promoter + rtTA?
- Check if we're on track for medal requirements
- Quick-change? (methylated digest?multiple Quick-change)
PTS47 stock sequencing rerun and returned - still contains CTATTCTCACTCTTTGGACCT sequence

I. PCR Purification of rtTA PCR Results:

Promoter	Concentration
PRM1	102.2
PRM2	110.6
PRM3	135.5
PRM6	130.7
ECM18	136.8
SAG1	152.4
YDR124W	78.89
CLG1	133.7
ASG7	68.15
HYM1	91.08
PCL2	86.63
pTEFm3	47.19

II. Gibson Assembly using inserts from 1. {Attempt 6}

III. Transformation: E. coli {Attempt 6}
       - NEB5alpha E. coli
       - 7/18 Results:
             Plates with no colonies: PRM1, PRM3, ECM18, YDR124W, CLG1, ASG7, HYM1, PCL2, positive control, negative control
            Plates with colonies: PRM2 (4), PRM6 (countless), SAG1 (25)

TO-DO:

Research examples of cell-cell community communication -> 4 slides with 4 examples

Friday Jul 18, 2014

Kara & Sabrina gone
Prepare for Monday's lab meeting

I. Colony PCR and culture successful colonies from 6/17 transformation (6/17 III.)
- cultured by Eleanor Sunday 7/20
- 3 cultures from PRM2, PRM6, and SAG1

II. Replate failed transformations {Attempt 6.2}
       - set in drawer over weekend
       - 7/21 Results: almost all did not grow any colonies
             - PRM6 overgrown (similar to 6/17 transformation)

WEEK 7

Monday July 21, 2014

Lab meeting - RM S436a

I. Mini-prep 6/18 I. cultures

Promoter+rtTA	Concentration	7/22 Results
PRM2	225.0	failed sequencing
PRM6	491.5	has 21 bp mutation?!?!
SAG1	439.0	has GFP (backbone not properly digested)

II. Digestion and Gel Extraction of low-concentration backbones

pGEM	pHY4+Promoter	Concentration
3	PRM3
6	SAG1
7	YDR124W
10	HYM1
11	PCL2

III. Seamless Cloning of alpha-inducible promoters+rtTA {Attempt 7}

Promoter	Insert	Backbone
PRM1	7/17 I.	6/10 I.
PRM2	7/17 I.	6/10 I.
PRM3	7/17 I.	7/21 II.
PRM6	7/17 I.	6/24 I.
ECM18	7/17 I.	6/23 I.
SAG1	7/17 I.	7/21 II.
YDR124W	7/17 I.	7/21 II.
CLG1	7/17 I.	6/23 I.
ASG7	7/17 I.	6/23 I.
HYM1	7/17 I.	7/21 II.
PCL2	7/17 I.	7/21 II.

IV. Transformation of E. coli with III. {Attempt 7}
- NEB5alpha strain

TO-DO:

Determine Exploratorium HP topic/activity plan
Research examples of cell-cell community communication -> 4 slides with 4 examples

Tuesday July 22, 2014

finalize Exploratorium activity
explain University of Virginia collaboration

I. Colony PCR of 6/18 Transformation {Attempt 6.2}
- Abandoned due to poor Gel Photo, unlikely to contain desired gene

II. Culture pGEM colonies
- restock pGEM for future use

III. Transformation of E. coli with pGEM
- use pGEM4 (PRM6) and pGEM6 (SAG1)

Wednesday July 23, 2014

I. Mini-prep of cultures from 6/22 II.
- stored in Parts and Plasmids Box

pGEM#	Promoter	Concentration
1	PRM1	269.5
2	PRM2	294.9
3	PRM3	170.1
5	ECM18	285.4
8	CLG1	297.4
9	ASG7	259.7
10	HYM1	240.2
11	PCL2	261.0

II. Digestion of pGEM plasmids
- remove GFP
- overnight digestion at 37 C

TO-DO:

Digestion of pGEMs
- use Xho1 and Not1 to remove GFP
PCR rtTA with Xho1 and BamH1
PCR Msn2 activating domain with BamH1 and Not1

Thursday July 24, 2014

I. Mini-prep of cultures from 6/22 III. Transformation

pGEM#	Promoter	Concentration 1	Concentration 2
4	PRM6	398.3	527.8
6	SAG1	375.2	399.1

II. Gel Extraction of 7/23 II. Digestion
- done by Sabrina

pGEM#	Promoter	Concentration
1	PRM1
2	PRM2
3	PRM3
4	PRM6
5	ECM18
6	SAG1
7	YDR124W
8	CLG1
9	ASG7
10	HYM1
11	PCL2

III. PCR and PCR Purification of rtTA and Msn2 inserts
- obtain rtTA with XhoI and BamHI cut sites
- obtain Msn2 with BamHI and NotI cut sites

Insert	Concentration
rtTA	153.4
Msn2	100.9

IV. Digestion of rtTA and Msn2
       - use inserts from III.
       - rtTA: XhoI and BamHI
       - Msn2: BamHI and NotI
       - overnight digestion at 37 C

Friday July 25, 2014

I. PCR Purification of 7/24 IV. Digestion
- done by Sabrina

II. Ligation for pHY4+alpha promoter+rtTA
       - done by Sabrina
       - use inserts from 7/25 I.
       - use backbone from 7/24 II.

III. Transformation of E. coli with 7/25 II. plasmids
       - done by Sabrina
       - DH5alpha strain
       - culture on Sunday

WEEK 8

Monday July 28, 2014

I. Colony PCR of successful colonies from 7/25 III. Transformation
- Gel inconclusive, but seems as if most failed - Pick new colonies to redo

Tuesday July 29, 2014

I. Colony PCR of 7/25 III. Transformation (redo of 7/28 I.)
- 1st gel ran off, inconclusive - 2nd gel

Wednesday July 30, 2014

worked on Exploratorium Human Practices

I. Colony PCR Gel Check of 7/25 I. (redo 3 of 7/29 I.)

II. Miniprep successful colonies from I. Colony PCR
- Sequencing Results 7/31

Promoter	Colony	Concentration	Sequencing
PRM1	6	376.7	Successful
PRM2	1	356.8	Successful
PRM3	2	364.5	Successful
PRM6	4	377.5	Failed
ECM18	1	371.7	Successful
YDR124W	5	328.4	Successful
CLG1	5	543.1	Successful
ASG7	4	348.8	Successful
HYM1	3	449.6	Successful
PCL2	6	444.4	Failed

Thursday July 31, 2014

worked on Exploratorium Human Practices
work on introduction for iGEM newsletter by Paris-Bethencourt

I. Colony PCR of unsuccessful AFRP+rtTA plates
- PRM6, SAG1, and PCL2 all failed

II. Linearization of successful plasmids from 7/30 II.
- Digested with PMEI for 2 hours at 37 degrees C

III. Ligation of pHY4+AFRP, rtTA, and Msn2 (redo of 7/25 II. for promoters from I.)
- negative control used PRM6 backbone
- ligated with T4 ligase overnight at 16 degrees C

Friday August 1, 2014

Anasuya: various examples of how system will respond (up, down, stays, converge, diverge) depending on stimulus
drop intermediate values when testing? Allow for more samples, less accuracy

I. Transformation of E. coli with pHY4+AFRP+rtTA plasmid
- use 7/31 III. ligations
- plated overnight at room temperature

II. Transformation of yeast with AFRP+rtTA
- use 7/31 II. linearized plasmids
- CB008 pTET+GFP and CB008DB pTET+GFP yeast strains

WEEK 9

Monday August 4, 2014

Lim Lab meeting

I. Colony PCR of E. coli Transformation (8/01 I.)
- PRM6, SAG1, PCL2 all successful

II. Colony PCR of Yeast Transformation (8/01 II.)
       - CB008(DB) pTET+GFP AFRP+rtTA plates
       - CB008 all successful except ECM18
       - CB008DB all failed

III. Colony PCR of Yeast Transformation (redo of II.)
- CB008DB AFRP+rtTA, CB008 ECM18
- all failed

Tuesday August 5, 2014

Work on iGEM Collaborations with Paris-Bettencourt

I. Colony PCR of Yeast Transformation (redo of 8/04 III.)
- CB008DB AFRP+rtTA, CB008 ECM18
- on hold, need more primers

II. Streak successful colonies from 8/04 II.

Wednesday August 6, 2014

Exploratorium Presentation Practice
Work on iGEM Collaborations with Paris-Bettencourt

I. Transformation of Yeast with AFRP + rtTA
       - CB008 pTET+GFP, PRM6, ECM18, SAG1, PCL2 +rtTA (use Mini-prep of 8/01 I., [for ECM18, redo of 8/01 II.)
       - CB008DB pTET+GFP with all 11 AFRP+rtTA (redo of 8/01 II.)
       - 8/08 Results: all grew colonies except CB008 PRM6+rtTA

Thursday August 7, 2014

Human Practices: Exploratorium After Night Event
- Super Science: the science behind superheroes

I. Culture 8/05 II. streaks for glycerol stocks

Friday August 8, 2014

send in iGEM newsletter information

I. Yeast Colony PCR of 8/06 I. Transformation
- all failed

II. Glycerol stocks of 8/05 II. yeast strains
- CB008 pTET+GFP PRM1, PRM2, PRM3, YDR124W, CLG1, ASG7, HYM1 + rtTA

III. Transformation of Yeast with pTET+mfalpha
- use strains: CB008 pTET+GFP, PRM1, PRM2, PRM3, YDR124W, CLG1, ASG7, HYM1+ rtTA
- 8/11 Results: all grew colonies

Week 10

Monday August 11, 2014

lab meeting
- email Kara about upcoming class schedules, days you can't go in
- re-organize box
- brainstorm project titles
- Parts Registry - help Eleanor
- finish Santa Cruz poster by Wed. - help Ianto

I. Yeast Colony PCR of 8/06 I. Transformation (redo of 8/08 I.)
- all failed again

II. Yeast Colony PCR of 8/08 III. Transformation
- all successful except CLG1 and HYM1

Tuesday August 12, 2014

I. Yeast Colony PCR of 8/06 and 8/08 Transformation (redo of 8/11 I. and II.)
- CLG1+rtTA pTET+mfalpha successful; all others failed

II. Linearization of plasmids
- use PmeI

III. Start cultures for retransformation (8/13 II.)

Wednesday August 13, 2014

Poster arrived!

I. Yeast Colony PCR
- check CB008 pTET+GFP HYM1+rtTA pTET+mfalpha
- colony 10 worked; culture made for glycerol stocks and transformation

II. Yeast Tranformation
       - a. add pPCL2+RFP, pAGA+RFP, pPCL2+BFP to CB008 pTET+GFP AFRP+rtTA pTET+mfalpha
       - b. add AFRP+rtTA to CB008 pTET+GFP: PRM6, ECM18, SAG1, PCL2
       - suspend CB008DB pTET+GFP AFRP+rtTA transformations
       - Results (Checked 8/18): b. all failed. BFP suspended due to lack of supplies. a. first Colony PCR failed, HYM1 failed, rest successful

III. Glycerol Stocks of CB008 pTET+GFP AFRP+rtTA pTET+mfalpha - PRM1, PRM2, PRM3, YDR124W, CLG1, ASG7

Thursday August 14, 2014

Practice presentations 2-4PM

Friday August 15, 2014

last official day of iGEM
visit Santa Cruz for iGEM meet-up

Week 11

Monday August 18, 2014

Kilobot workshop! no group meeting
Sunday August 17: Jeffrey did Colony PCR for 8/13 II. Yeast Transformations

Successful yeast strains (Colony PCR'ed by Jeffrey)

yGEM Number	Characteristics
105	CB008 pTET-GFP::LEU2 pPRM1-rtTA::URA3 pTET-mfalpha::HIS pAGA1+mCherry::TRP
106	CB008 pTET-GFP::LEU2 pPRM2-rtTA::URA3 pTET-mfalpha::HIS pAGA1+mCherry::TRP
107	CB008 pTET-GFP::LEU2 pPRM3-rtTA::URA3 pTET-mfalpha::HIS pAGA1+mCherry::TRP
111	CB008 pTET-GFP::LEU2 pYDR124W-rtTA::URA3 pTET-mfalpha::HIS pAGA1+mCherry::TRP
112	CB008 pTET-GFP::LEU2 pCLG1-rtTA::URA3 pTET-mfalpha::HIS pAGA1+mCherry::TRP
113	CB008 pTET-GFP::LEU2 pASG7-rtTA::URA3 pTET-mfalpha::HIS pAGA1+mCherry::TRP
116	CB008 pTET-GFP::LEU2 pPRM1-rtTA::URA3 pTET-mfalpha::HIS pPCL2+mCherry::TRP
117	CB008 pTET-GFP::LEU2 pPRM2-rtTA::URA3 pTET-mfalpha::HIS pPCL2+mCherry::TRP
118	CB008 pTET-GFP::LEU2 pPRM3-rtTA::URA3 pTET-mfalpha::HIS pPCL2+mCherry::TRP
122	CB008 pTET-GFP::LEU2 pYDR124W-rtTA::URA3 pTET-mfalpha::HIS pPCL2+mCherry::TRP
123	CB008 pTET-GFP::LEU2 pCLG1-rtTA::URA3 pTET-mfalpha::HIS pPCL2+mCherry::TRP
124	CB008 pTET-GFP::LEU2 pASG7-rtTA::URA3 pTET-mfalpha::HIS pPCL2+mCherry::TRP

I. Yeast Transformation
- redo of 8/13 II.
- Results (8/20): all failed, redo?

Tuesday August 19, 2014

Kilobot workshop!

Wednesday August 20, 2014

Kilobot workshop!

I. Yeast Transformation
- CB008 AFRP+rtTA pTET+GFP pTET+mfalpha add in pPCL2+BFP
- PRM1, PRM2, PRM3, YDR124W, CLG1, ASG7, HYM1

Thursday August 21, 2014

Kilobot workshop!

I. Yeast Transformation
- CB008 pTET+GFP, add in AFRP+rtTA: SAG1 nd PCL2
- PRM6 and ECM18 suspended due to poor expression

Friday August 22, 2014

Kilobot workshop!

Week 12

Monday August 25, 2014

Results: Friday 8/22 Transformation failed

I. Make cultures for Yeast Transformation tomorrow

II. Linearize plasmids for Yeast Transformation

Culture	Added part
CB008 pTET+GFP m3+rtTA	pTET+mfalpha
CB008 pTET+GFP m6+rtTA pTET+mfalpha	pAGA1+mCherry
CB008 pTET+GFP	SAG1+rtTA
CB008 pTET+GFP	PCL2+rtTA
CB008 pTET+GFP PRM1+rtTA pTET+mfalpha	pPCL2+BFP
CB008 pTET+GFP PRM2+rtTA pTET+mfalpha	pPCL2+BFP
CB008 pTET+GFP PRM3+rtTA pTET+mfalpha	pPCL2+BFP
CB008 pTET+GFP YDR124W+rtTA pTET+mfalpha	pPCL2+BFP
CB008 pTET+GFP CLG1+rtTA pTET+mfalpha	pPCL2+BFP
CB008 pTET+GFP ASG7+rtTA pTET+mfalpha	pPCL2+BFP
CB008 pTET+GFP HYM1+rtTA pTET+mfalpha	pPCL2+BFP
CB008 pTET+GFP HYM1+rtTA pTET+mfalpha	pPCL2+mCherry
CB008 pTET+GFP HYM1+rtTA pTET+mfalpha	pAGA1+mCherry

Tuesday August 26, 2014

I. Yeast Transformation (redo of a lot of failed transformations II. E. coli Transformation (redo of 8/85, which failed due to plating on wrong antibiotic)

Thursday August 28, 2014

First day of class at UC Berkeley

Week 13+

9/08/2014 - 10/29/2014 Came in on Mondays and Wednesdays to work on Kilobots modeling, iGEM details, reduced wet lab work.

Derrick's Lab Notebook

5/28/14

PCR of Yeast Promoters

Materials:
                         1X          4.5x             

5x HF Phusion Buffer     10 µl       45 µl
10mM dNTPs               1 µl        4.5 µl
10mM FW Primer           2.5 µl      11.25 µl
10mM REV Primer          2.5 µl      11.25 µl
Phusion Polymerase       0.5 µl      2.25 µl
Template DNA             0.5 µl      2.25 µl
ddH20                    33 µl       148.5 µl

PCR Cycle:

98°C    30 sec
98°C    10 sec
55°C    20 sec
72°C    30 sec
72°C    5 min
4°C     ∞

Notes:

from yeast genomic DNA
13 different promoters:
- 1KB: YDR124W, SAG1, PCL2, HYM1, FUS3
- 700BP: CLG1, PRM2
- 500BP: PRM6, PRM3, PRM1, FUS2, ECM18, ASG7

Promoters
1) PRM2
2) ASG7
3) FUS2
4) PCL2
5) FUS3
6) CLG1
7) YDR124W
8) HYM1
9) PRM6
10) PRM1
11) ECM18
12) PRM3
13) SAG1

numbering system for promoters

5/29/14

Gel: Gel1 Alpha FactorInducible Yeast Promoters Gel2 Alpha FactorInducible Yeast Promoters

Transformation of pHY4:

used 0.2 µl of pHY4
sat on ice for 10 minutes before heat shock
incubate at 37°C for 30 minutes

Gel Extraction of Alpha Inducible Promoters:

Qiagen Gel Extraction Protocol used

Qiagen column was not used, but protocol was used. may have yielded less efficency

Promoters       ng/µl 
1) PRM2         13.49
2) ASG7         12.50
3) FUS2         n/a
4) PCL2         9.489
5) FUS3         11.77
6) CLG1         16.30
7) YDR124W      35.75
8) HYM1         23.61
9) PRM6         79.03
10) PRM1        n/a
11) ECM18       14.17
12) PRM3        n/a
13) SAG1        26.07

5/30/14

Miniprep of pHY4

centrifuge at 4000 RPM
followed Qiagen protocol
Concentrations: ng/µl
- 51.15
- 65.40
- 52.89
- 31.65

Digestion of promoters

Promoters
- 29 µl of PCR product
- 3.3 µl of 10x Cutsmart Buffer

1) Add 0.5 µl of ApaI. Mix gently, spin down, incubate at room temp. for 2 hours

2) Add 0.5 µl of XhoI. Mix gently, spin down, incubate at 37ºC for 1 hour

3) PCR Purification

Digestion of pHY4

pHY4
- 43 µl of PCR product
- 5 µl of 10x Cutsmart Buffer

1) Add 1 µl of ApaI. Mix gently, spin down, incubate at room temp. for 2 hours

2) Add 1 µl of XhoI. Mix gently, spin down, incubate at 37ºC for 1 hour

3) Gel Extraction

Concentrations from PCR Purification:
1) 14.54
2) 4.326 redo, 5.4890
4) -0.05256 redo, 1.730
5) 1.886 redo, 2.642
6) 41.05
7) 3.187
8) 19.09
9) 9.677
11) 1.868
13) 23.78

Concentrations from Gel Extraction
1) 7.749 -pHY4 1
2) 14.87 -pHY4 2

Gel: pHY4 Digest

6/2/14

ligated #1,2,5,6,7,8,9,13 with the 6kb pHY4 backbone
- only had enough backbone for 8 reactions so chose the 8 promoters with the highest concentration
used Gibson ligation calculator to calculate mLs of reagents of our reaction

Protocol: See ligation protocol

PCR of Yeast Alpha Inducible Promoters 3,4,7,10,11,12

Materials:
                         1X          4.5x             

5x HF Phusion Buffer     10 µl       45 µl
10mM dNTPs               1 µl        4.5 µl
10mM FW Primer           2.5 µl      11.25 µl
10mM REV Primer          2.5 µl      11.25 µl
Phusion Polymerase       0.5 µl      2.25 µl
Template DNA             0.5 µl      2.25 µl
ddH20                    32.5 µl     146.25 µl
DSMO                     0.5 µl      2.25 µl   

PCR Cycle:

98°C    30 sec
98°C    10 sec
55°C    20 sec
72°C    30 sec
72°C    5 min
4°C     ∞

Gel: Gel Yeast Alpha Inducible Promoters

Gel Extraction:

follow Qiagen protocol
Concentrations (ng/µl):
- 4) 84.15
- 7) 134.3
- 10) 84.14
- 11) 91.99
- 12) 64.64

6/3/14

Miniprep of pHY4

follow Qiagen protocol
low yields of plasmid previously due to PE Buffer not containing ethanol
Concentrations (ng/µl):
- 360.2
- 398.8
- 322.2
- 240.2

pHY4 + Promoters:

did not grow very well after ligation
7,9,13 grew some colonies
1,2,5,6,8,9,13 will be re-PCRed

Digestion:

Digestion of promoters

Promoters
- 50 µl of PCR product
- 5 µl of 10x Cutsmart Buffer

1) Add 1 µl of ApaI. Mix gently, spin down, incubate at room temp. for 2 hours

2) Add 1 µl of XhoI. Mix gently, spin down, incubate at 37ºC for 1 hour

3) PCR Purification

Digestion of pHY4

pHY4
- 50 µl of PCR product
- 5 µl of 10x Cutsmart Buffer

1) Add 1 µl of ApaI. Mix gently, spin down, incubate at room temp. for 2 hours

2) Add 2 µl of XhoI. Mix gently, spin down, incubate at 37ºC for 1 hour

3) Gel Extraction

Gel: Gel of digested pHY4 with ApaI & XhoI

gel extraction was not performed b/c DNA was chewed up, no clear cut

PCR Purification Concentrations (ng/µl):

follow Qiagen Protocol

4) 165.1

7) 146.8

11) 68.84

12) 76.15

6/4/13

Digestion of pHY4

pHY4 was redigested since the first two attempts were unsuccessful

Digestion of pHY4

pHY4
- 40 µl of PCR product
- 5 µl of 10x Cutsmart Buffer

1) Add 1 µl of ApaI. Mix gently, spin down, incubate at room temp. for 2 hours

2) Add 2 µl of XhoI. Mix gently, spin down, incubate at 37ºC for 1 hour

3) Gel Extraction

Miniprep of pHY4

pHY4 was cultured last night, more needed for ligation w/ promoters
follow Qiagen protocol
Concentrations (ng/ul):
- pHY4-1: 178.8
- pHY4-2: 155.6
- pHY4-4: 231.7

Gel: Gel of digested pHY4 with ApaI & XhoI

Digestion of pHY4 +positive control

positive control from Hyun's stock plasmid

Digestion of positive control

pHY4
- 5 µl of PCR product
- 2.5 µl of 10x Cutsmart Buffer
- 16.5 µl H20

1) Add 1 µl of ApaI. Mix gently, spin down, incubate at room temp. for 2 hours

2) Add 1 µl of XhoI. Mix gently, spin down, incubate at 37ºC for 1 hour

Digestion of pHY4

pHY4
- 40 µl of PCR product
- 5 µl of 10x Cutsmart Buffer

1) Add 1 µl of ApaI. Mix gently, spin down, incubate at room temp. for 2 hours

2) Add 2 µl of XhoI. Mix gently, spin down, incubate at 37ºC for 1 hour

3) Gel Extraction

6/5/14

Gel: Gel of digested pHY4 with ApaI & XhoI

Gel Extraction

follow Qiagen gel extraction protocol
concentrations (ng/µl)
- + control: 33.23
- pHY4-1: 50.33
- pHY4-3: 45.38
- pHY4-4: 56.06

Ligation of Promoters w/pHY4

0.2 µl of backbone
_ µl of insert
1 µl of T4 ligase buffer
0.5 µl
_ µl of H20
---------------
10 µl total

    - sit at room temp for 2 hours
    - 1,2,4,8,10,11,12: 8.1 µl H20 + 0.2 µl insert
    - 6: 8.0 µl H20 + 0.3 µl insert
    - negative control: 8 µl H20 + no insert
transform into 50 µl dH5

Yeast Transformation of 7,9,13

6/6/14

Digestion of pHY4 -negative control had around 29 colonies -redigesting plasmids of control, pHY4 1,3,4 -follow same digestion protocol -note: 50µl of DNA

Colony PCR of promoters: 1,2,4,6,10,11,12

Materials: 1X 8x

GoTAQ Mix                12.5 µl      
10mM FW Primer           1.25 µl      
10mM REV Primer          1.25 µl      
Template DNA             5 µl      
ddH20                    5 µl     

PCR Cycle:

98°C    30 sec
98°C    10 sec
55°C    20 sec
72°C    30 sec
72°C    5 min
4°C     ∞

Gel 1: Colony PCR of Prom 1,2,4,6,10,11,12 6-6-14 Gel 2: Miniprep of Ligation cultures -miniprep protocol -used vacuum manifold -ethanol not completely eluted, may affect sequencing

Concentrations (ng/ul):
- 1-4: 142.4
- 1-5: 203.7
- 2-4: 317.3
- 2-5: 205.9
- 4-4: 321.5
- 4-5: 284.9
- 6-4: 192.9
- 6-5: 432.9
- 10-2: 103.8
- 10-3: 203.2
- 11-4: 144.7
- 11-5: 226.8
- 12-4: 267.7
- 12-5: 267.7

6/10/14

PCR of Gibson Homology of rtTA to promoters

Materials: 1X

5x HF Phusion Buffer     10 µl      
10mM dNTPs               1 µl        
10mM FW Primer           2.5 µl     
10mM REV Primer          2.5 µl      
Phusion Polymerase       0.5 µl      
Template DNA             0.5 µl      
ddH20                    33 µl       

PCR Cycle:

98°C    30 sec
98°C    10 sec
55°C    20 sec
72°C    30 sec
72°C    5 min
4°C     ∞

PCR Purification -follow PCR purification protocol

Concentrations (ng/ul): 1.PRM2: 190.9 4.PCL2: 149.1 6.CLG1: 412.1 7.YDR124W: 90.37 8.HYM1: 248.9 9.PRM6: 145.7 10.PRM1: 71.88 11.ECM18: 199.7 13.SAG1: 65.55

Gel: AFRP Gib Homology 6-10-14

6/11/14

PCR of Gibson Homology of rtTA to promoters

Materials: 1X

5x HF Phusion Buffer     10 µl      
10mM dNTPs               1 µl        
10mM FW Primer           2.5 µl     
10mM REV Primer          2.5 µl      
Phusion Polymerase       0.5 µl      
Template DNA             0.5 µl      
ddH20                    33 µl       

PCR Cycle:

98°C    30 sec
98°C    10 sec
55°C    20 sec
72°C    30 sec
72°C    5 min
4°C     ∞

PCR Purification -follow PCR purification protocol

Concentrations (ng/ul): 2.ASG7: 179.6 12.PRM3: 236.6

Gel AFRP Gib Homology 6-11-14

6/12/14

Seamless Cloning of rtTA + promoters & pHY4 -follow seamless cloning procedure Promoters
1) PRM2
2) ASG7
4) PCL2
6) CLG1
7) YDR124W
8) HYM1
9) PRM6
10) PRM1
11) ECM18
12) PRM3
13) SAG1

6/16/14

Colony PCR of rtTA -transformations of SAG1& PRM1 didn't grow -inoculate colony in 25µl H20 Materials: 1X 4x

GoTAQ Mix                12.5 µl      
10mM FW Primer           1.25 µl      
10mM REV Primer          1.25 µl      
Template DNA             5 µl      
ddH20                    5 µl

PCR Cycle:

98°C    30 sec
98°C    10 sec
55°C    20 sec
72°C    30 sec
72°C    5 min
4°C     ∞

Gel: 9 AFRP Promoters E.coli Colony PCR

Colony PCR pf yeast transformations (promoter+GFP) Materials: 1X 70x

GoTAQ Mix                12.5 µl      
10mM FW Primer           1.25 µl      
10mM REV Primer          1.25 µl      
Template DNA             5 µl      
ddH20                    5 µl

PCR Cycle:

98°C    30 sec
98°C    10 sec
55°C    20 sec
72°C    30 sec
72°C    5 min
4°C     ∞

Gel 1: Colony PCR CB008+AFRP+GFP Gel 2: Colony PCR CB008/CB008DB +AFRP+GFP Gel 3: Colony PCR CB008DB+AFRP+GFP

6/17/14

Colony PCR of Yeast transformations (promoter +GFP) -previous colony PCR failed, need to redo Materials: 1X 80x

GoTAQ Mix                12.5 µl      
10mM FW Primer           1.25 µl      
10mM REV Primer          1.25 µl      
Template DNA             5 µl      
ddH20                    5 µl

PCR Cycle:

98°C    30 sec
98°C    10 sec
55°C    20 sec
72°C    30 sec
72°C    5 min
4°C     ∞

Miniprep of rtTA + promoter Concentrations (ng/ul): ECM18+rtTA #1 308.3 ng/ul ECM18+rtTA #2 231.6 ng/ul PCL2+rtTA #1 162.7 ng/ul PCL2+rtTA #2 247.3 ng/ul PRM6+rtTA #1 248.1 ng/ul PRM6+rtTA #2 327.9 ng/ul ASG7+rtTA #1 351.7 ng/ul ASG7+rtTA #2 593.5 ng/ul HYM1+rtTA #1 221.7 ng/ul HYM1+rtTA #2 413.0 ng/ul PRM2+rtTA #1 324.3 ng/ul PRM2+rtTA #2 339.6 ng/ul PRM3+rtTA #1 351.5 ng/ul PRM3+rtTA #2 316.7 ng/ul CLG1+rtTA #1 289.0 ng/ul CLG1+rtTA #2 276.8 ng/ul YDR124W+rtTA #1 366.0 ng/ul YDR124W+rtTA #2 239.3 ng/ul

6/18/14

Yeast Transformations -two strains (CB008) & (CB008DB) 9 rtTA Promoters: PRM2 ASG7 PCL2 CLG1 YDR124W PRM6 PRM1 ECM18 PRM3 SAG1 GFP + Promoter: HYM1 PRM3 (only DB)

6/19/14

Flow Cytometry of AFRP + GFP

Overnight cultures of CB008+AFRP+GFP diluted ~100x (to a final concentration of OD600 0.5-0.1, Saturated overnight cultures should be OD600 of ~7) in SD complete media, and grown for 3 hours, 1000rpm shaker, 30ºC. Growing in 2mL well plates
Induce with Alpha-factor. Stock is in 3mM. Final concentrations are 0, 1nM, 10nM, 100nM, 1000nM. Alpha-factor cannot be refrozen, so throw leftover away.
Induce for 90mins, but no longer than 120mins
Transfer 250u of each well into a V-bottom 96-well plate containing 10ul of the fixing chemical Cyclohexamide. (thats 4 ul for every 100ul of culture) Cyclohexamide stops protein production by inhibiting ribosomes.
Run on the flow cytometer.

Parameters of flow

FSC: 250
SSC: 280
FITC(GFP): 550
B(RFP): 650

Flow rate: 1µL/sec
Sample Volume: 200µL
Mixing Volume: 100µL
Mixing speed: 180µL/sec

Plate map

    1   2   3   4   5   6   7   8   9   10  11  12
A   [------NEG------]       [------NEG-------]
B   [------PRM2-----]       [------PRM1------]
C   [------ASG7-----]       [------EMC18-----]
D   [------PCL2-----]       [------PRM3------]
E   [------NEG------]       [------SAG1------]
F   [------CLG1-----]
G   [------YDR124W--]
H   [------PRM6-----]

Notes: -CLG1 x2 Alpha Factor -10ul culture diluted in 1ml of SD Complete

6/20/14

Minipreps of Yeast Colonies (rtTA + promoter) -send for sequencing since previous sequencing failed. colony PCR yielded false positives -follow Miniprep protocol Concentrations (ng/ul): YDR124W.3 241.7 ng/ul YDR124W.4 386.5 ng/ul YDR124W.5 439.6 ng/ul ASG7.3 207.7 ng/ul ASG7.4 319.8 ng/ul ASG7.5 287.2 ng/ul ASG7.6 300.2 ng/ul ASG7.7 338.5 ng/ul CLG1.3 408.0 ng/ul CLG1.4 306.0 ng/ul CLG1.5 277.6 ng/ul CLG1.6 249.8 ng/ul CLG1.7 277.1 ng/ul HYM1.3 440.1 ng/ul HYM1.4 342.4 ng/ul HYM1.5 388.7 ng/ul HYM1.6 226.7 ng/ul HYM1.7 351.2 ng/ul ECM18.3 377.0 ng/ul ECM18.4 426.8 ng/ul ECM18.5 368.8 ng/ul ECM18.6 459.7 ng/ul ECM18.7 372.9 ng/ul PRM3.3 430.4 ng/ul PRM3.4 441.8 ng/ul PRM3.5 361.7 ng/ul PRM3.6 375.6 ng/ul PRM3.7 333.1 ng/ul

6/23/14

Digestion of GFP from pHY4 + promoters -sequencing failed fpr nearly all promoters -GFP possibly not cut all the way -sequencing shows that GFP not fully digested

Already cut plasmid   49ul
plasmid               5ul
Cutsmart              6ul
Not1                  0.5ul
Xho1                  1ul

incubate at 37ºC for 2 hours

Gel Extraction Concentrations (ng/ul): ASG7 23.77 ng/ul CLG1 16.59 ng/ul HMY1 12.96 ng/ul ECM18 21.39 ng/ul PRM3 15.20 ng/ul -done by Ianto & Jessica

Concentrations (ng/ul): 
YDR124W   15.46 ng/ul
SAG1      12.10 ng/ul
PRM6      21.74 ng/ul
PRM1      4.186 ng/ul
PCL2      6.348 ng/ul
PRM2      0.451 ng/ul

Gel: 14-06-24 Backbone digest w. homology to AFRP

6/24/14

PCR of rtTA & promoters -previously only been amplifying half of rtTA -reorderedplasmids to include activation domain of rtTA

Materials: 1X

5x HF Phusion Buffer     10 µl      
10mM dNTPs               1 µl        
10mM FW Primer           2.5 µl     
10mM REV Primer          2.5 µl      
Phusion Polymerase       0.5 µl      
Template DNA             0.5 µl      
ddH20                    33 µl       

PCR Cycle:

98°C    30 sec
98°C    10 sec
55°C    20 sec
72°C    30 sec
72°C    5 min
4°C     ∞

6/26/14

Flow cytometry, testing (triplicate) PRM2, ASG7, PLC2, CLG1
Alpha-factor concentrations: (Induce for 90mins)
(0nm, 0.5nm, 1nm, 10nm, 100nm, 1000nm, 3000nm)

Starting concentration is 3mM or 3,000,000nM Make 100x stocks and add 10ul to the 1mL cultures: 0nM 50nM 100nM 1000nM 10,000nM 100,000nM 300,000nM

Plate 1 & 2 Alpha Factor Concentration Map:

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-------------------{0 nM}-------------------]
B   [-------------------{0.5 nM}-----------------]
C   [-------------------{1 nM}-------------------]
D   [-------------------{10 nM}------------------]
E   [-------------------{100 nM}-----------------]
F   [-------------------{1000 nM}----------------]
G   [-------------------{3000 nM}----------------]
H   

Plate 1:
    H   G   F   E   D   C   B   A   
1       [--------CB008-1--------]
2       [--------CB008-2--------]
3       [--------CB008-3--------]
4       [--------PRM2-1---------]
5       [--------PRM2-2---------]
6       [--------PRM2-3---------]
7       [--------ASG7-1---------]
8       [--------ASG7-2---------]
9       [--------ASG7-3---------]
10      [--------PCL2-1---------]
11      [--------PCL2-2---------]
12      [--------PCL2-3---------]

Plate 2: 
   H    G   F   E   D   C   B   A   
1       [--------CLG1-1---------]
2       [--------CLG1-2---------]
3       [--------CLG1-3---------]
4
5
6
7
8
9
10
11
12

6/27/14

Continuation of CB008+AFRP+GFP FACs.

PRM6+GFP did not grow up yesterday.

ROUND 3 PLATE 1 PROMOTER MAP

    H   G   F   E   D   C   B   A   
1       [--------CB008-1--------]
2       [--------CB008-2--------]
3       [--------CB008-3--------]
4       [--------YDR124W-1------]
5       [--------YDR124W-2------]
6       [--------YDR124W-3------]
7       [--------PRM3-1---------]
8       [--------PRM3-2---------]
9       [--------PRM3-3---------]
10      [--------PRM1-1---------]
11      [--------PRM1-2---------]
12      [--------PRM1-3---------]

ROUND 2 PLATE 2 PROMOTER MAP [DID NOT COMPLETE]

   H    G   F   E   D   C   B   A   
1       [--------ECM18-1--------]
2       [--------ECM18-2--------]
3       [--------ECM18-3--------]
4       [--------SAG1-1---------]
5       [--------SAG1-2---------]
6       [--------SAG1-3---------]
7
8
9
10
11
12

Instructions for starting flow:

Turn on and wait 30mins for the machine to warm up
Re-initialize the HTS, them prime it three times. You'll get a bubble in the lines if you don't
Run CST!!! Follow the sheet in front of the monitor for more instructions for that part. (CST uses beads to calibrate the laser detection.) add one drop into 250ul of sheath fluid in A1.
Bead LOT ID: use the one that is most current
Load A1-A4 with bleach and B1-B4 with water [flip for the opposite corner] -Cytometer>CST. Make sure cytometer performance results passed

Run Clean Plate: 1. Click on experiment. Experiment>Open experiment 2. Open clean plate "Daily Clean" - 96 well U-bottom" 3. Be here to see if the cleaning is going correctly, low events (less than 100events/sec for bleach and less than 10events/sec for water) 4. If over the events, run another clean plate 5. View events in aquisition dashboard in view>Acquisition dashboard 6. Can also make a clean plate using HTS>Clean

6/14/30

Continuation of CB008+AFRP+GFP FACS. Also testing Constitutive pTEF1 promoters +GFP today

ROUND 4 MAP

   H    G   F   E   D   C   B   A   
1       [--------ECM18-1--------]
2       [--------ECM18-2--------]
3       [--------ECM18-3--------]
4       [--------SAG1-1---------]
5       [--------SAG1-2---------]
6       [--------SAG1-3---------]
7       [--------CB008-1--------]
8       [--------CB008-2--------]
9       [--------CB008-3--------]
10
11
12

Constitutive Promoter MAP

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-CB008-]       
B   [-pTEF1-]       
C   [-m3----]       
D   [-m6----]       
E   [-m7----]       
F   [-m10---]
G   
H

7/2/14

Flow of AFRP +GFP CB008 -redoing since data from previous FACS run had some odd behaviors and high standard error

Plate 1: H G F E D C B A
1 [--------CB008-1--------] 2 [--------CB008-2--------] 3 [--------CB008-3--------] 4 [--------PRM2-1---------] 5 [--------PRM2-2---------] 6 [--------PRM2-3---------] 7 [--------ASG7-1---------] 8 [--------ASG7-2---------] 9 [--------ASG7-3---------] 10 [--------PCL2-1---------] 11 [--------PCL2-2---------] 12 [--------PCL2-3---------]

Plate 2: 
   H    G   F   E   D   C   B   A   
1       [--------CLG1-1---------]
2       [--------CLG1-2---------]
3       [--------CLG1-3---------]
4       [--------YDR124W-1------]
5       [--------YDR124W-2------]
6       [--------YDR124W-3------]
7       [--------PRM6-1---------]
8       [--------PRM6-2---------]
9       [--------PRM6-3---------]  
10
11
12

Alpha Factor Concentrations:

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-------------------{3000 nM}----------------]
B   [-------------------{1000 nM}----------------]
C   [-------------------{100 nM}-----------------]
D   [-------------------{10 nM}------------------]
E   [-------------------{1 nM}-------------------]
F   [-------------------{0.5 nM}-----------------]
G   [-------------------{0 nM}-------------------]
H

-CB008-1, PRM2-1-3, CLG1-1-3 didn't grow well, cultures very dilute and clear. added 20µl of cells instead of 10 -plate 1&2 follow same concentrations

7/7/14

Flow of AFRP +GFP CB008 & pTEF1 + Mutants + GFP Plate 1: H G F E D C B A
1 [--------CB008-1--------] 2 [--------CB008-2--------] 3 [--------CB008-3--------] 4 [--------PRM1-1---------] 5 [--------PRM1-2---------] 6 [--------PRM1-3---------] 7 [--------ECM18-1--------] 8 [--------ECM18-2--------] 9 [--------ECM18-3--------] 10 [--------PRM3-1---------] 11 [--------PRM3-2---------] 12 [--------PRM3-3---------]

Plate 2:
   H    G   F   E   D   C   B   A   
1       [--------SAG1-1---------]
2       [--------SAG1-2---------]
3       [--------SAG1-3---------]
4       [--------AGA1-1---------]
5       [--------AGA1-2---------]
6       [--------AGA1-3---------]
7       [--------PRM2-1---------]
8       [--------PRM2-2---------]
9       [--------PRM2-3---------]
10      [--------CLG1-1---------]
11      [--------CLG1-2---------]
12      [--------CLG1-3---------]

Alpha Factor Concentrations: 

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-------------------{3000 nM}----------------]
B   [-------------------{1000 nM}----------------]
C   [-------------------{100 nM}-----------------]
D   [-------------------{10 nM}------------------]
E   [-------------------{1 nM}-------------------]
F   [-------------------{0.5 nM}-----------------]
G   [-------------------{0 nM}-------------------]
H   

Plate 3: 
  1   2   3   4   5   6   7   8   9   10  11  12
A [-CB008-]  
B [-pTEF1-]   
C [-m3----]   
D [-m6----] 
E [-m7----]   
F [-m10---]   
G             
H

-PRM2 had an OD600 of 0.3, added 100µl to 1ml of media

7/8/14

Colony PCR of pTET + GFP in CB008 & CB008DB -leu2 integration site -primers RA151 FW & RA 145 REV -boiled colony in 5µl 20 mM NaOH for 20min @ 95°C

Materials: 1X

GoTAQ Mix                10 µl      
10mM FW Primer           1 µl      
10mM REV Primer          1 µl      
Template DNA             3 µl      
ddH20                    5 µl

PCR Cycle:

98°C    30 sec
98°C    10 sec
55°C    20 sec
72°C    30 sec
72°C    5 min
4°C     ∞

-no colonies worked for the PCR

7/9/14

-Jeffrey previously cloned all constiutive promoters & rtTA (except for m3) & digested w/ PME1 -Eric & I transformed this into yeast CB008 & CB008DB containg pTET + GFP in the leu integration site -consti. & rtTA went into the ura site -follow yeast transformation protocol

7/10/14

Flow of CB008DB+AFRP+GFP -testing in strain CB008DB -strain has no Bar1 which degrades alpha factor -CB008 has Bar1 -hope to reach plateau in flow analysis

Plate 1:

    H   G   F   E   D   C   B   A   
1       [--------CB008DB-1------]
2       [--------CB008DB-2------]
3       [--------CB008DB-3------]
4       [--------CLG1-1---------]
5       [--------CLG1-2---------]
6       [--------CLG1-3---------]
7       [--------PRM2-1---------]
8       [--------PRM2-2---------]
9       [--------PRM2-3---------]
10      [--------PCL2-1---------]
11      [--------PCL2-2---------]
12      [--------PCL2-3---------]

Plate 2:

    H   G   F   E   D   C   B   A   
1       [--------SAG1-1---------]
2       [--------SAG1-2---------]
3       [--------SAG1-3---------]
4       [--------AGA1-1---------]
5       [--------AGA1-2---------]
6       [--------AGA1-3---------]
7       
8       
9       
10      
11      
12

Alpha-Factor Concentrations

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-------------------{0 nM}-------------------]
B   [-------------------{0.5 nM}-----------------]
C   [-------------------{1 nM}-------------------]
D   [-------------------{10 nM}------------------]
E   [-------------------{100 nM}-----------------]
F   [-------------------{1000 nM}----------------]
G   [-------------------{3000 nM}----------------]
H

Miniprep of PTS47 -PTS47 pNH406 + rtTA -11E3178 pTET-MFAlpha -follow Miniprep protocol

Concentrations (ng/ul): PTS47 pNH406 + rtTA: #1 637.7 #2 387.7 11E3178 pTET-MFAlpha: 423.0

7/11/14

Flow Cytometry with CB008DB+AFRP+GFP

 H  G   F   E   D   C   B   A   
1       [-------CB008DB-1-------]
2       [-------CB008DB-2-------]
3       [-------CB008DB-3-------]
4       [---------PRM1-1--------]
5       [---------PRM1-2--------]   
6       [---------PRM1-3--------]
7       [--------ECM18-1--------]
8       [--------ECM18-2--------]
9       [--------ECM18-3--------]   
10      
11      
12

Alpha-Factor Concentrations

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-------------------{0 nM}-------------------]
B   [-------------------{0.5 nM}-----------------]
C   [-------------------{1 nM}-------------------]
D   [-------------------{10 nM}------------------]
E   [-------------------{100 nM}-----------------]
F   [-------------------{1000 nM}----------------]
G   [-------------------{3000 nM}----------------]
H

Glycerol stocks of YDR124W, PRM6, & ASG7 did not grow in SD complete media overnight

7/14/14

Flow Cytometry with CB008DB+AFRP+GFP

Plate 1:

    H   G   F   E   D   C   B   A   
1       [--------CB008DB-1------]
2       [--------CB008DB-2------]
3       [--------CB008DB-3------]
4       [--------ASG7-1---------]
5       [--------ASG7-2---------]
6       [--------ASG7-3---------]
7       [--------YDR124W-1------]
8       [--------YDR124W-2------]
9       [--------YDR124W-3------]
10      [--------PRM6-1---------]
11      [--------PRM6-2---------]
12      [--------PRM6-3---------]

Alpha-Factor Concentrations

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-------------------{0 nM}-------------------]
B   [-------------------{0.5 nM}-----------------]
C   [-------------------{1 nM}-------------------]
D   [-------------------{10 nM}------------------]
E   [-------------------{100 nM}-----------------]
F   [-------------------{1000 nM}----------------]
G   [-------------------{3000 nM}----------------]
H

E3 & F3 had some weird clumping on the bottom of the well and can't be resuspended
A2 skipped, human error.

7/16/14

[Doxycycline]: 100 mg/ml stock or 100,000 ug/ml (in 100ul Aliquots) Induction time: 6hrs Concentrations needed for 100x:

0 ug/ml
3 ug/ml
6 ug/ml
9 ug/ml
30 ug/ml
60 ug/ml
90 ug/ml
300 ug/ml
600 ug/ml
900 ug/ml
3000 ug/ml
6000 ug/ml

Dilutions by Ianto:

Stock: 100mg/mL 
**1x**           **100x**          Prep
60µg/mL       A: 6mg/mL            (6:100) 60µL of Stock in 940µL of water
30µg/mL       B: 3mg/mL            30µL of Stock in 970µL of water
9µg/mL        C: 900µg/mL          150µL of A in 850µL of water
6µg/mL        D: 600µg/mL          100µL of A in 900µL of water
3µg/mL        E: 300µg/mL          50µL of A in 950µL of water      Can also do 100ul of B in 900ul of water
0.9µg/mL      F: 90µg/mL           100µL of C in 900µL of water
0.6µg/mL      G: 60µg/mL           100µL of D in 900µL of water
0.3µg/mL      H: 30µg/mL           100µL of E in 900µL of water
0.09µg/mL     I: 9µg/mL            100µL of F in 900µL of water
0.06µg/mL     J: 6µg/mL            100µL of G in 900µL of water
0.03µg/mL     K: 3µg/mL            100µL of H in 900µL of water

Doxycycline concentrations plate map:

        H   G   F   E   D   C   B   A   
1                   [----0 µg/ml----]
2                   [---0.03 µg/ml--]
3                   [---0.06 µg/ml--]
4                   [---0.09 µg/ml--]
5                   [---0.3 µg/ml---]
6                   [---0.6 µg/ml---]
7                   [---0.9 µg/ml---]
8                   [---3.0 µg/ml---]
9                   [---6.0 µg/ml---]
10                  [---9.0 µg/ml---]
11                  [---30 µg/ml----]
12                  [---60 µg/ml----]

pTEF1 promoters

Plate 1:

  1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008 Control]--------------]  
B [---------------[CB008 pTET_GFP Control]-----]  
C [---------------[CB008 pTET_GFP pTEF1_rtTA]--]  
D [---------------[CB008 pTET_GFP pTEF1 m6]----]     
E [---------------[CB008 pTET_GFP pTEF1 m7]----]    
F [---------------[CB008 pTET_GFP pTEF1 m10]---]  
G
H

Plate 2:

  1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008DB Control]------------]  
B [---------------[CB008DB pTET_GFP Control]---]  
C [---------------[CB008DB pTET_GFP pTEF1 1of2 ] 
D [---------------[CB008DB pTET_GFP pTEF1 2of2 ]
E [---------------[CB008DB pTET_GFP pTEF1 m6]--] 
F [---------------[CB008DB pTET_GFP pTEF1 m7]--]             
G 
H

7/22/14

Plate map

Flow Cytometry with CB008DB+AFRP+GFP

Plate 1:

    H      G   F   E   D   C   B   A   
1  pTEF1-1 [--------CB008DB-1------]
2  pTEF1-2 [--------CB008DB-2------]
3  pTEF1-3 [--------CB008DB-3------]
4  M7-1    [--------ASG7-1---------]
5  M7-2    [--------ASG7-2---------]
6  M7-3    [--------ASG7-3---------]
7          [--------YDR124W-1------]
8          [--------YDR124W-2------]
9          [--------YDR124W-3------]
10         [--------PRM6-1---------]
11         [--------PRM6-2---------]
12         [--------PRM6-3---------]

Plate 2:

    H   G   F   E   D   C   B   A   
1       [--------AGA1-1---------]
2       [--------AGA1-2---------]
3       [--------AGA1-3---------]
4       [--------CLG1-1---------] did not grow as much as the others
5       [--------CLG1-2---------] 20ul instead of 10ul for CLG1
6       [--------CLG1-3---------]
7       [--------PRM2-1---------]
8       [--------PRM2-2---------]
9       [--------PRM2-3---------]
10      [--------PCL2-1---------]
11      [--------PCL2-2---------]
12      [--------PCL2-3---------]

Plate 3:

    H    G   F   E   D   C   B   A   
1        [--------ECM18-1--------]
2        [--------ECM18-2--------]
3        [--------ECM18-3--------]
4        [--------SAG1-1---------]
5        [--------SAG1-2---------]
6        [--------SAG1-3---------]
7        
8         there is no PRM3 made, in glycerol stock
9        
10       [--------PRM1-1---------]
11       [--------PRM1-2---------]
12       [--------PRM1-3---------]

Alpha-Factor Concentrations

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-------------------{0 nM}-------------------]
B   [-------------------{0.5 nM}-----------------]
C   [-------------------{1 nM}-------------------]
D   [-------------------{10 nM}------------------]
E   [-------------------{100 nM}-----------------]
F   [-------------------{1000 nM}----------------]
G   [-------------------{3000 nM}----------------]
H

7/29/14

Flow Cytometry of Consti+rtTA+pTET+GFP CB008DB Dox run

-All plates are identical

Plate 1:

  1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008DB]--------------------]  
B [---------------[CB008DB pTET_GFP]-----------]
C [---------------[CB008DB pTET_GFP pTEF1]-----]
D [---------------[CB008DB pTET_GFP pTEF1 m3]--]
E [---------------[CB008DB pTET_GFP pTEF1 m6]--] 
F [---------------[CB008DB pTET_GFP pTEF1 m7]--]             
G [---------------[CB008DB pTET_GFP pTEF1 m10]-]
H

Plate 2:

  1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008DB]--------------------]  
B [---------------[CB008DB pTET_GFP]-----------]  
C [---------------[CB008DB pTET_GFP pTEF1]-----] 
D [---------------[CB008DB pTET_GFP pTEF1 m3]--]
E [---------------[CB008DB pTET_GFP pTEF1 m6]--] 
F [---------------[CB008DB pTET_GFP pTEF1 m7]--]             
G [---------------[CB008DB pTET_GFP pTEF1 m10]-]
H

Plate 3:

  1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008DB]--------------------]  
B [---------------[CB008DB pTET_GFP]-----------]  
C [---------------[CB008DB pTET_GFP pTEF1]-----] entire lane 10 is induced
D [---------------[CB008DB pTET_GFP pTEF1 m3]--] with wrong concentration.
E [---------------[CB008DB pTET_GFP pTEF1 m6]--] 
F [---------------[CB008DB pTET_GFP pTEF1 m7]--]             
G [---------------[CB008DB pTET_GFP pTEF1 m10]-]
H

Doxycycline concentrations plate map:

        H   G   F   E   D   C   B   A   
1                   [----0 µg/ml----]
2                   [---0.03 µg/ml--]
3                   [---0.06 µg/ml--]
4                   [---0.09 µg/ml--]
5                   [---0.3 µg/ml---]
6                   [---0.6 µg/ml---]
7                   [---0.9 µg/ml---]
8                   [---3.0 µg/ml---]
9                   [---6.0 µg/ml---]
10                  [---9.0 µg/ml---]
11                  [---30 µg/ml----]
12                  [---60 µg/ml----]

-plate 1 concentrations backwards -plate 3 had 2x exposure of diff concentrations, not run on flow

7/30/14

Flow Cytometry of PTEF1 + rtTA + pTET + GFP CB008 -could not run b/c cultures did not grow -original patch plates did not have much growth at all -restreaked plates

8/1/14

Cloning AFRP + Ste2 -doing this to increase receptor levels to alpha factor

Materials: 1X

5x HF Phusion Buffer     10 µl      
10mM dNTPs               1 µl        
10mM FW Primer           2.5 µl     
10mM REV Primer          2.5 µl      
Phusion Polymerase       0.5 µl      
Template DNA             0.5 µl      
ddH20                    33 µl       

PCR Cycle:

98°C    30 sec
98°C    10 sec
55°C    20 sec
72°C    30 sec
72°C    5 min
4°C     ∞

Gel: PCR of AFRPs + Ste2

8/4/14

Flow Cytometry of Consti+rtTA+pTET+GFP CB008 Dox run

Plate 1:

  1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008]--------------------]  
B [---------------[CB008 pTET_GFP]-----------]
C [---------------[CB008 pTET_GFP pTEF1]-----]
D [---------------[CB008 pTET_GFP pTEF1 m6]--] 
E [---------------[CB008 pTET_GFP pTEF1 m7]--]  
F [---------------[CB008 pTET_GFP pTEF1 m10]-]          
G 
H

Plate 2:

   1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008]--------------------]  
B [---------------[CB008 pTET_GFP]-----------]
C [---------------[CB008 pTET_GFP pTEF1]-----]
D [---------------[CB008 pTET_GFP pTEF1 m6]--] 
E [---------------[CB008 pTET_GFP pTEF1 m7]--]  
F [---------------[CB008 pTET_GFP pTEF1 m10]-]          
G 
H

Plate 3:

  1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008]--------------------]  
B [---------------[CB008 pTET_GFP]-----------]
C [---------------[CB008 pTET_GFP pTEF1]-----]
D [---------------[CB008 pTET_GFP pTEF1 m6]--] 
E [---------------[CB008 pTET_GFP pTEF1 m7]--]  
F [---------------[CB008 pTET_GFP pTEF1 m10]-]          
G 
H

Doxycycline concentrations plate map:

        H   G   F   E   D   C   B   A   
1                   [----0 µg/ml----]
2                   [---0.03 µg/ml--]
3                   [---0.06 µg/ml--]
4                   [---0.09 µg/ml--]
5                   [---0.3 µg/ml---]
6                   [---0.6 µg/ml---]
7                   [---0.9 µg/ml---]
8                   [---3.0 µg/ml---]
9                   [---6.0 µg/ml---]
10                  [---9.0 µg/ml---]
11                  [---30 µg/ml----]
12                  [---60 µg/ml----]

8/6/14

Colony PCR of AFRP + Ste2 Materials: 1X

GoTAQ Mix                10 µl      
10mM FW Primer           1 µl      
10mM REV Primer          1 µl      
Template DNA             3 µl      
ddH20                    5 µl

PCR Cycle:

98°C    30 sec
98°C    10 sec
55°C    20 sec
72°C    30 sec
72°C    5 min
4°C     ∞

Gel: Colony PCR of AFRP + Ste2

8/8/14

CB008 pTEF1+rtTA pTET+GFP pTET+MFalpha pAGA1+mCherry

Time points with [Dox] induction: 0, 1.5hr, 3hr, 5hr

Plate map for all time points (4 plates):

  1   2   3   4   5   6   7   8   9   10  11  12
A [CB008 m6-1]----]       [CB008 m10-3]----]
B [CB008 m6-2]----]       [CB008DB m7-1]---]
C [CB008 m6-3]----]       [CB008DB m7-2]---]
D [CB008 m7-1]----]       [CB008DB m7-3]---]
E [CB008 m7-2]----] 
F [CB008 m7-3]----]           
G [CB008 m10-1]---] 
H [CB008 m10-2]---]

[Dox] Concentration Map:

        H   G   F   E   D   C   B   A   
1       [--------0 µg/ml------------]
2       [--------0.03 µg/ml---------]
3       [--------0.06 µg/ml---------]
4       [--------0.09 µg/ml---------]
5       [--------0.6 µg/ml----------]
6 
7       [--------0 µg/ml------------]
8       [--------0.03 µg/ml---------]
9       [--------0.06 µg/ml---------]
10      [--------0.09 µg/ml---------]
11      [--------0.6 µg/ml----------]
12

-diluted 1:200 to get OD of 0.1 -fix with cycloheximide at diff. time points

8/11/14

Flow Cytometry of AFRP + rtTA + pTET + GFP -flow of 4 AFRPs: pHYM1, pYDR124W, pCLG1, pASG7 -plates are the same for all 4 promoters -1:200 dilution

Plate Map:

        H   G   F   E   D   C   B   A   
1           [----0 µg/ml------------]
2           [----0.03 µg/ml---------]
3           [----0.06 µg/ml---------]
4           [----0.09 µg/ml---------]
5           [----0.3 µg/ml----------]
6           [----0.6 µg/ml----------]
7           [----0.9 µg/ml----------]
8           [----3.0 µg/ml----------]
9           [----6.0 µg/ml----------]
10          [----9.0 µg/ml----------]
11          [----30 µg/ml-----------]
12          [----60 µg/ml-----------]

Alpha Factor Concentration Map

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-------------------{0 nM}-------------------]
B   [-------------------{0.5 nM}-----------------]
C   [-------------------{1 nM}-------------------]
D   [-------------------{10 nM}------------------]
E   [-------------------{100 nM}-----------------]
F   [-------------------{1000 nM}----------------]
G   [-------------------{3000 nM}----------------]
H

8/12/14

Flow Cytometry of AFRP + rtTA + pTET + GFP -flow of 3 AFRPs: PRM1, PRM2, PRM3 -plates are the same for all 3 promoters

Plate Map:

        H   G   F   E   D   C   B   A   
1           [----0 µg/ml------------]
2           [----0.03 µg/ml---------]
3           [----0.06 µg/ml---------]
4           [----0.09 µg/ml---------]
5           [----0.3 µg/ml----------]
6           [----0.6 µg/ml----------]
7           [----0.9 µg/ml----------]
8           [----3.0 µg/ml----------]
9           [----6.0 µg/ml----------]
10          [----9.0 µg/ml----------]
11          [----30 µg/ml-----------]
12          [----60 µg/ml-----------]

Alpha Factor Concentration Map

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-------------------{0 nM}-------------------]
B   [-------------------{0.5 nM}-----------------]
C   [-------------------{1 nM}-------------------]
D   [-------------------{10 nM}------------------]
E   [-------------------{100 nM}-----------------]
F   [-------------------{1000 nM}----------------]
G   [-------------------{3000 nM}----------------]
H

8/13/14

Flow Cytometry of pTEF1 + rtTA pTET + GFP pTET + MFalpha pAGA1_mCherry CB008DB -1:200 dilution -Time points for Dox induction: 0, 1.5hr, 3hr, 5hr -plate map same for all 4 plates

Plate Map: 1 2 3 4 5 6 7 8 9 10 11 12 A [CB008 pTEF1-1]-] [CB008DB m3-3]--] B [CB008 pTEF1-2]-] [CB008DB m6-1]---] C [CB008 pTEF1-3]-] [CB008DB m6-2]---] D [CB008DB pTEF1-1] [CB008DB m6-3]---] E [CB008DB pTEF1-2]
F [CB008DB pTEF1-3]
G [CB008DB m3-1]--] H [CB008DB m3-2]--]

Dox Concentrations:

        H   G   F   E   D   C   B   A   
1       [--------0 µg/ml------------]
2       [--------0.03 µg/ml---------]
3       [--------0.06 µg/ml---------]
4       [--------0.09 µg/ml---------]
5       [--------0.6 µg/ml----------]
6 
7       [--------0 µg/ml------------]
8       [--------0.03 µg/ml---------]
9       [--------0.06 µg/ml---------]
10      [--------0.09 µg/ml---------]
11      [--------0.6 µg/ml----------]
12

-0 time point plate was not fully run. Due to mistakes, only 10µl run on flow. plates saved to run flow on 0 time point plate tomorrow

8/14/14

Flow Cytometry of pTEF1 + rtTA pTET + GFP pTET + MFalpha pAGA1_mCherry CB008 -1:200 dilution -Time points for Dox induction: 0, 1.5hr, 3hr, 5hr -plate map same for all 4 plates -in 2ml culture plate there was a lot of debris/contamination in rows A,B,C -tried to avoid it by pipeting one at a time

Plate Map 1 2 3 4 5 6 7 8 9 10 11 12 A [CB008 pTEF1-1]-] [CB008 m7-3]-----] B [CB008 pTEF1-2]-] [CB008 m10-1]----] C [CB008 pTEF1-3]-] [CB008 m10-2]----] D [CB008 m6-1]----] [CB008 m10-3]----] E [CB008 m6-2]----] F [CB008 m6-3]----]
G [CB008 m7-1]----] H [CB008 m7-2]----]

Dox Concentrations:

        H   G   F   E   D   C   B   A   
1       [--------0 µg/ml------------]
2       [--------0.03 µg/ml---------]
3       [--------0.06 µg/ml---------]
4       [--------0.09 µg/ml---------]
5       [--------0.6 µg/ml----------]
6 
7       [--------0 µg/ml------------]
8       [--------0.03 µg/ml---------]
9       [--------0.06 µg/ml---------]
10      [--------0.09 µg/ml---------]
11      [--------0.6 µg/ml----------]
12

-flow experiment completely failed due to high bacterial contamination

8/15/14

Official Last Day of iGEM

Jeffrey's Lab Notebook

6/9/14

PCR for Constitutive Promoters (pTEF1)

Materials	1x reaction	4.5x Master Mix
x Phusion HF Buffer	10 µl	45 µl
dNTP's (10 mM)	1 µl	4.5 µl
Forward Primer (10µm)	2.5 µl	11.25 µl
Reverse Primer (10µm)	2.5 µl	11.25 µl
*Template DNA	0.3 µl	1.35 µl
Phusion Polymerase	0.5 µl	2.25 µl
Water	33.2 µl	149.4 µl

Total	50 µl	225 µl

1. Mix materials in a 4.5x Master Mix on ice. Mix well.
2. Pipetter 50 µl from the Master Mix into 4 labeled PCR tubes
3. Thermocycler for : 

    Initial Duration   | 98° C | 30s 
      35 Cycles of: 
          Denaturation | 98° C | 10s
          Annealing    | 55° C | 20s
          Extension    | 72° C | 30s
    Final Extension    | 72° C | 5m
    Hold               | 4°  C | Forever

POSSIBLE ERRORS: Incomplete thawing of dNTPs

Constitutive Promoters Gel

Working Stock of Reverse and Forward Primers for pTEF1 kept in my freezer box. 6/9/14

6/10/14

Gel Extraction

Cut DNA band from PCR of constitutive promoter gel
Weigh gel: .720 g
QG Buffer: 2160 ul

1. Mix gel slice with QG Buffer in 50C heat bath for 10 min.
2. Add 1 ml isopropanol. Mix.
3. Add 750 ul of mixture into purple Qiagen spin column. Spin for 30 sec. Discard liquid.  Repeat.
4. Add 750 ul of Buffer PE and spin for 1 min. Discard waste.
5. Dry spin the column for 1 min. Replace the spin column in a new microcentrifuge tube
6. Elute in 40 ul of ddH2O. Wait 1 min and then spin for 1 min.

Restriction Digest with ApaI

40 ul of DNA (pTEF1 gel extraction)
5 ul of 10x CutSmart Buffer
.5 ul of ApaI Enzyme

*digest overnight at room temperature*

6/11/14

Restriction Digest with XhoI

Add .5 ul of XhoI enzyme to ApaI digestion from 6/10/14
Incubate in the 37°C shaker.

PCR Purification

1. Add 250 ul of Buffer PB to digestion.
2. Place sample in a purple QIAquick spin column. Spin for 1 min. Discard waste.
3. Wash with 750 ul of Buffer PE. Spin for 1 min. Discard waste.
4. Dry spin for 1 min. Replace spin column in a new microcentrifuge tube.
5. 6. Elute in 50 ul of ddH2O. Wait 1 min and then spin for 1 min.

Total concentration: 141.4 ng/ul

DNA Ligation

Materials	Volume
10x Ligase Buffer	1 ul
DNA Backbone PSV606	.2 ul
DNA Insert (PCR Purication)	.2 ul
T4 DNA Ligase	.5 ul
H2O	8.1 ul

Total                       | 10 ul
----------------------------------------------------
Mix reagents and incubate at room temperature for 2 hrs

Ligation of pTEF1 into PSV606 kept in my freezer box. 6/11/14

Transformation

10 ul of ligation
50 ul of E. Coli competent cells

30 min    | ice
45 sec    | 42°C heat shock
2 min     | ice

Add 250 ul of SOC media. Incubate at 37°C for 1 hr.
Plate on LB+Carb. 

NO COLONIES

6/12/14

Redo Transformation

Follow procedure from 6/11/14 with minor alterations.
1. Use .4 ul of ligation instead of .2 ul.
2. Use more expensive competent cells.

6/13/14

Transforming α-inducible promoters

Transforming 11 different inducible promoters into CB008 and CB008DB strains of yeast.

1. Boil salmon sperm DNA (ssDNA) for 10 min.-->10 ul of 10 mg/ml stock per transformation
2. Cool on ice for 10 min. 
3. Pellet yeast cultures in centrifuge. (3000 rpm for 2-5 min.)
4. Resuspend with with .1M LiOAc in TE.
5. Pellet cells (3000 rpm for 2-5 min.)
6. Resuspend in 100 ul .1M LiOAc in TE per 2.5 ml culture. 
7. Aliquot 100 ul into each microcentrifuge per transformation. (22 tubes)
Per Tube:
8. Add 100 ug ssDNA, 1 ug of target DNA (1~5 ul)

ADD IN ORDER
9. 480 ul 50% PEG 3350
10. 60 ul 10x TE
11. 60 ul 1 M LiOAc
12. 75 ul DMSO

13. Vortex
14. Incubate at 42°C for 30 min. 
15. Pellet cells (6000 rpm for 2 min)
16. Resuspend with 500 ul YPD.
17. Pellet cells.
18. Resuspend with 50 ul  YPD
19. Plate on SDS-Ura. 

Incubate 2 days at 30°C.

6/16/14

Colony PCR for Screening Yeast

1. Pick a single colony using a sterile wooden stick and patch on a dropout plate. 
   Take stick and rub into a dry PCR tube.
2. Add 10 ul of 20mM NaOH to each of the PCR tubes.
   Boil in pCR machine at 95°C for 20 min.

3. Set up PCR reaction as below:
                                        1x Reaction      7x Master Mix
                                        ---------------------------------
    2X Go Taq Green PCR Master Mix              10ul               70ul
    10 uM FW primer                              1ul                7ul
    10uM RV primer                               1ul                7ul
    Water                                        5ul               35ul 
    ----------------------------------------------------------------------
    Boiled Yeast cells (template)                3ul          

4. Set up Thermocycler for:
    95°C       | 5 min
    30x |95°C   | 45 sec
        |50°C   | 30 sec
        |72°C   | 1 min per kb
    72°C       | 10 min
    4°C            | hold
5. Run on 1% Agarose Gel

We ran 66 lanes for colony PCR
RESULTS: only 4 lanes were positive
POSSIBLE ERRORS: not enough DNA in tubes

PCR PCR PCR

Colony PCR on E.Coli for Constitutive Promoters

1. Pick a single colony using a sterile wooden stick and mix in 25ul of water in a PCR tube. Do this for about 4-6 colonies. Use 5ul for the PCR reaction below, adn save the rest for later.

2. Set up PCR reaction as below:
                                            1x Reaction      6x master mix
                                        ----------------------------------
2X Go Taq Green PCR Master Mix                  10ul               60ul
10 uM FW primer                                  1ul                6ul
10uM RV primer                                   1ul                6ul
Water                                            3ul               18ul 
Bacterial cells (template)                       5ul                --      


Cycles:
            95°C               | 5 min
            30X:    95°C       | 45 s
                    55°C       | 30 s
                    72°C       | 1 min per kb 
            72°C               | 10 min

3. Analyze products on a 1% agarose gel. 

RESULTS: All lanes worked

4. Inoculate the colonies in 5 ml LB+Carb and incubate 37°C shaker overnight.

PCR

6/17/14

Re-inoculate the E.Coli with Constitutive Promoters

6/18/14

Dilution of Yeast Strains

We diluted CB008 and CB008DB strains 1:20 times in YPD media.

Miniprep Constitutive Promoters from E.Coli

1. Pellet bacterial cells
2. Resuspend in 250 ul in Buffer P1. Transfer to a microcentrifuge tube.
3. Add 250 ul Buffer P1. Invert to mix.
4. Add 350 ul Buffer P2 and invert immediately but gently.
5. Centrifuge for 10 min at 130000 rpm. Apply supernatants to QIAprep spin columns.
6. Centrifuge for 30-60 sec. Discard flow through.
7. Wash with 750 ul Buffer PE and centrifuge for 60 sec.
8. Discard flow through and dry spin for 1 min.
9. Place spin column in microcentrifuge tube and elute in 25 ul ddH20. Spin for 1 min.

6/20/14-6/21/14

Out of the lab. Other lab members ran the flow cytometer on AFRPs and transformed yeast with constitutive promoters.

6/23/14

Yeast Colony PCR on Transformed Yeast

used wrong primers so we need to redo on Tuesday

6/24/14

Re-do Yeast Colony PCR on Transformed Yeast

Innoculated Yeast colonies in 5ml of YPD

Flow Cytometer Notes

Overnight cultures of CB008+AFRP+GFP diluted ~100x (to a final concentration of OD600 0.5-0.1, Saturated overnight cultures should be OD600 of ~7) in SD complete media, and grown for 3 hours, 1000rpm shaker, 30ºC. Growing in 2mL well plates
Induce with Alpha-factor. Stock is in 3mM. Final concentrations are 0, 1nM, 10nM, 100nM, 1000nM. Alpha-factor cannot be refrozen, so throw leftover away.
Induce for 90mins, but no longer than 120mins
Transfer 250u of each well into a V-bottom 96-well plate containing 10ul of the fixing chemical Cyclohexamide. (thats 4 ul for every 100ul of culture) Cyclohexamide stops protein production by inhibiting ribosomes.
Run on the flow cytometer.

Flow Cytometer things to remember:

check the sheath fluid box to see if its empty
check the waster container. If full, dispose and add new bleach
take care not to leave the machine on run. Save sheath fluid by keeping on standby when not in use
find parameters using negative controls. (FSC, SSC, Fluorescense marker)
DO NOT RUN PLATE. RUN WELLS instead. (Run the first well by itself first b/c it needs time to create file folders.) this causes problems.
- Run plate only saves data of the first well.
- Can rerun through the first well again which would suck up air. Air no good for the machine.
highlight wells and change settings on the right in the aquisition dashboard screen
mixing speed 180ul/sec
mix 3 times rather than 2
run at 1ul/sec for samples and 0.5ul/sec for negative controls when finding parameters.
make sre uL doesn't exceed samle to prevent sucking up air. (Rule of thumb is to run 50ul less than allotted sample sizes for wells.)

Voltage settings were gotten by running negative controls and adjusting to readouts seen in histogram form of FSC, SSC, FITC

Parameters of This Flow Experiment

FSC: 250
SSC: 280
FITC(GFP): 550
B(RFP): 650

Flow rate: 1µL/sec
Sample Volume: 200µL
Mixing Volume: 100µL
Mixing speed: 180µL/sec

Flowjo Notes

Export data from USB and transfer to iGEM2014 folder
Open FlowJo and drag data over to box
Set an appropriate gate
Go to data, select all data and press E. Select mean, geometric mean, and count.
Hit refresh. Addiction numerical data should be present.
Use mean of FITC(GFP).

MatLab Notes

Open up new script and comment the title of the experiment
Enter the alpha factor concentrations info. (X axis). Put in log form.
Enter the yGEM data. This will serve as y axis. (FITC means)
Define variables
Tyope figure info and run to show plot.

6/25/14

Transformations of DH5a

HY86E3
HY67E1
HYGE1
PTS98
PTS108
PTS133
PTS97

plasmids for backbones in different integration sites and fluorescent tags

Glycerol stocks of Yeast Transformations (yGEM23-32)

420 ul 50% glycerol
350 ul cells in YPD
vortex, store in -80C freezer

PCR for Parts Registry Promoters

ASG7, CLG1, ECM18, HYM1, PCL2, PRM1, PRM2, PRM3, PRM6, SAG1, YDR124W

Materials	1x reaction
x Phusion HF Buffer	10 µl
dNTP's (10 mM)	1 µl
Forward Primer (10µm)	2.5 µl
Reverse Primer (10µm)	2.5 µl
*Template DNA	0.3 µl
Phusion Polymerase	0.5 µl
Water	33.2 µl
Total	50 µl
-----	------

3. Thermocycler for : 

    Initial Duration   | 98° C | 30s 
      35 Cycles of: 
          Denaturation | 98° C | 10s
          Annealing    | 55° C | 20s
          Extension    | 72° C | 30s
    Final Extension    | 72° C | 5m
    Hold               | 4°  C | Forever

Ran gel on PCR products. 1% Agarose, 125 volts for 15 min, 5 ul SybrSafe

PCR

6/26/14

Only pGEM2 and pGEM3 worked. RETRY with DMSO (1.5 ul per reaction).

PCR

Master Mix:
170 ul HF Buffer
17 ul dNTPs
8.5 ul Phusion Polymerase
25.5 DMSO
539 ul Water
-------------
44.7 per tube


Also add 2.5 ul FW primers
         2.5 ul RV primers
         .3 ul template DNA

PCR

Made liquid cultures of transformed DH5a E. Coli cells with HY+PTS plasmid

6/27/14

Double Digestion of Constitutive Promoters-GFP

6.5 ul water
15 ul DNA template (pTEF1 plasmids)
.5 ul Xho1 enzyme
.5 ul Not1 enzyme   
2.5 ul CutSmart Buffer

Incubate at 37C for 2hrs
Load into agarose gel. *pTEF1 appers to be smaller than the others.

PCR

Gel Extraction

Exise the DNA bands from the gel. Weigh using a scale.
pGEM12- 120 mg      -360 ul         -120 ul
pGEM13- 110 mg      -360 ul         -110 ul
pGEM14- 110 mg      -330 ul         -110 ul
pGEM15- 100 mg      -300 ul         -100 ul
pGEM16- 170 mg      -510 ul         -170 ul
        Weights     QG Buffer       Isopropanol
1. Melt gels in 50C for 10 min in QG Buffer
2. Add isopropanol.
3. Place in a spin column and spin for 1 min 13000rpm
4. Add 500 ul QG Buffer
5. Spin for 1 min. Dump liquid.
6. Add 750 ul PE Buffer
7. Spin for 1 min. Dump Liquid.
8. Dry spin for 1 min.
9. Elute in 25 ul ddH20.


Concentrations (ng/ul) through NanoDrop: 
1. pGEM12-25.77 
2. pGEM13-47.93 
3. pGEM14-18.31
4. pGEM15-10.6
5. pGEM16-32.45

Gibson Assembly

50 ng of DNA Backbone
2 ul of rtTA insert
5 ul Gibson Assembly Master Mix

pGEM12-2 ul         1 ul
pGEM13-1 ul         2 ul
pGEM14-3 ul         -
pGEM15-4 ul         -
pGEM16-1.5 ul       1.5 ul  
    DNA backbone    water
All have 2 ul rtTA insert and 5 ul GAMM
Incubate in thermocycler 50C for 15 min.

Transforming E. Coli with Gibson Assembly

10 ul Gibson mix
25 ul Mach1 cells
-----------
250 ul SOC media

30 min ice
45 sec heatshock at 42C
2 min ice
Incubate at 37C for 1 hr.
Plated 250 ul on LB-Cam (WRONG SELECTION MARKER- LB-Carb)
Incubate in a drawer overnight

6/29/14

pTEF1+rtTA transformations failed! 
Dilute CB008 constututive promoters (pTEF1)1:20 times
Incubate overnight 30C shaker/

6/30/14

Repeat pGEM12,pGEM15, rtTA insert digestions with Minipreps from freezer box
Same procedure as from 6/27/14

pGEM12-21.05 ng/ul
pGEM15-23.03 ng/ul
rtTA-182.3 ng/ul

REDO Gibson Assembly (procedure from 6/27/14).
Plate all Gibson mix and incubate 37C overnight on LB-CAM.

PCR

7/1/14

Seamless Cloning

pGEM12- 2 ul            3 ul
pGEM13- 1 ul            2 ul
pGEM14- 3 ul            4 ul
pGEM15- 2 ul            3 ul
pGEM16- 1.5 ul          2.5 ul
Positive- 1 ul PUC      3 ul        2 ul control insert
Negative- 2 ul          2 ul
        DNA backbone    Enzyme Mix

All with 1 ul of rtTA insert except for positive and negative control.

Transform into C2987 competent cells

25 ul competent cells
3 ul Seamless Assembly Mix

30 min ice
45 sec heatshock 42C
2 min ice
Add 250 ul SOC media
1 hr incubation 37C

Plate all on LB+Cam

Miniprep HY/PTS cultures

Follow same miniprep procedure as previous experiments.
Concentrations (in ng/ul)
1. PTS98    66.8
2. PTS97    88.2
3. HY67E1   63.43
4. HY6E1    22.05
5. PTS108   120.8
6. HY86E3   118.6
7. PTS133   701.3

Transforming pTEF1+GFP into DH5a

.5 ul plasmid DNA (pGEM12 to pGEM16)

7/2/14

Plated Seamless Cloning Transformation on LB+Carb, not LB+Cam.

7/3/14

Colonies found on LB+Carb plates.
Negative control has 5 colonies(?)
Positive control has too numerous to count.
All other colonies had ~100 colonies.

GFP

Innoculated GFP+pGEM12 to pGEM16 colonies. Stored in -80C freezer.
Move plates from 4C to 37C incubator on Sunday.

rtTA

We ran a colony PCR on pGEM12-16 + rtTA.
Follow the same procedure as before, using forward/reverse primers for rtTA.
Used a 50C annealing temperature instead of 55C due to melting point of rtTA.
Colonies all worked! Innoculated all colonies and placed in 4C freezer.

PCR

7/6/14

Moved all tubes from 4C freezer to 37C incubator shaker.

7/7/14

Miniprepped all tubes

Concentrations (in ng/ul)of rtTA plasmids
1. pGEM12-1     540.2
2. pGEM12-2     560.4
3. pGEM12-3     375.6
4. pGEM13-1     360.3
5. pGEM13-2     488.9
6. pGEM13-3     ------
7. pGEM14-1     302.3
8. pGEM14-2     425.5
9. pGEM14-3     513.5
10. pGEM15-1    595.8
11. pGEM15-2    554.4
12. pGEM15-2    510.6
13. pGEM16-1    592.3
14. pGEM16-2    545.8
15. pGEM16-3    302.3

Concentrations (in ng/ul) of GFP plasmids
1. pGEM12- 425.5
2. pGEM13- 620.3
3. pGEM14- 521.9
4. pGEM15- 567.7    
5. pGEM16- 534.3

*discovered that rtTA inserts are wrong because activation domains may not have been copied with PCR

7/8/14

Transformed 11E-3128 into DH5a (pTET-mfa)

50 ul DH5a
.5 ul plasmid DNA
Heatshock transformation
Plate 100 ul on LB+Carb

pGEM13+rtTA sequencing did not work (weird insertion in rtTA before terminator sequence)
Innoculate pGEM16+GFP again.

7/9/14

Miniprepped pGEM16+GFP

Re-PCR of rtTA insert

Materials	1x reaction
5x Phusion HF Buffer	10 µl
dNTP's (10 mM)	1 µl
Forward Primer (#70)	2.5 µl
Reverse Primer (#39)	2.5 µl
*Template DNA	1 µl
Phusion Polymerase	0.5 µl
Water	31 µl
DMSO	1.5 ul

Total	50 µl

Thermocycler Cycles:
    Initial Duration   | 95° C | 5 min 
      30 Cycles of: 
          Denaturation | 95° C | 30s
          Annealing    | 50° C | 30s
          Extension    | 72° C | 2 min
    Final Extension    | 72° C | 5m
    Hold               | 4°  C | Forever

*used 10 ul of dNTPs instead of 1 ul

Pme1 Digest of pGEM12-16 (without pGEM13) +rtTA

Digest 2000ng of template DNA
Pme1 enzyme-        .5 ul
Cutsmart Buffer-    2.5 ul
DNA plasmid-        4 ul

Incubate 1 hr 37C.

Ran a gel for rtTA PCR

PCR

PCR Purification of rtTA

Eluted in 50 ul

Gibson Assembly

pGEM12-         1 ul
rtTA insert-    3 ul
GA MM-          4 ul

Incubate 15 min at 50C.

Transform

25 ul Mach1 cells
.5 ul pGEM13+rtTA plasmid

Plate all on LB+Carb

7/10/14

Colony PCR of pGEM13+rtTA

-same procedure as 7/9/14
-successful

PCR

Miniprep 11E 3128 (pTET+mfalpha)

-followed standard miniprep procedure.
Concentration: 430 ng/ul
SEQUENCING CORRECT! (7/14/14)

7/11/14

Miniprep of pGEM13+rtTA

Sequencing correct

 pGEM16 (m10+GFP mislabeled m3+GFP)
and pTET+mfalpha

7/15/14

PCR rtTA out of correct pGEM20

*threw away all incorrect rtTA inserts
5x HF Buffer                        10 ul
dNTPS                               1 ul
Phusion Polymerase                  .5 ul
pGEM20- rtTA template               1 ul
H2O                                 21 ul
FW Primer (different for pTEFs)     2.5 ul
RV Primer (rtTA reverse primer)     2.5 ul
DMSO                                1.5 ul

Thermocycler:
    95  5 min
    30x cycle:
        95  45 sec
        50  30 sec
        72  2 min
    72  5 min
    4   hold

7/16/14

Load pGEM1-13+rtTA on gel

Gels were leaky and had spillage on contents

PCR

Gel extractions

1. PRM1     .54g
2. PRM2     .56g
3. PRM3     1.15g
4. PRM6     1.21g
5. ECM18    .61g
6. SAG1     .68g
7. YDR124W  .45g
8. CLG1     .40g
9. ASG7     .31g
10. HYM1    .50g
11. PCL2    .42g
12. M3      .69g
Followed same gel extraction procedure

PCR PCR

Gibson Assembly for m3

3 ul insert
1 ul backbone
5 ul GA Master Mix
1 ul H2O

PCR of rtTAs (again)

same procedure as before, except:
use 20 ul gel extraction as template

Transform m3+rtTA cells from Seamless Cloning

25 ul cells
1 ul Gibson DNA

7/17/14

Colony PCR on m3+rtTA

all had the rtTA insert!
made liquid cultures and incubated overnight

PCR

7/18/14

Miniprep pGEM13+rtTA

eluted in 50 ul
1. 500.2 ng/ul
2. 386.9 ng/ul
3. 433.4 ng/ul
4. 400.5 ng/ul

7/20/14

Sequencing came back conclusive! Silent mutation at 417 bp.

7/21/14

Innoculated pTET+GFP yeast strains in 5ml YPD for transformation

7/22/14

Prepare cultures for transformation

Diluted pTET+GFP yeast strains 1:20. Incubated for 3 hrs.

Pme1 Digest

Pme1 digest to linearize the pTEF1 m3+rtTA circular plasmid for yeast transformation.

Digest 2000 ng DNA.
4 ul DNA
.5 ul Pme1 Enzyme
2.5 ul Cutsmart Buffer
18 ul H2O

Incubate at 37C for 1 hr.

Transform Yeast

Transformed pTEF1-mr+rtTA into CB008/CB008DB pTET+GFP.
Follow standard procedure for transforming yeast found in our protocols page. 
-maybe not enough salmon sperm
Plated on SD URA in the 30C incubator for 2 days.

7/23/14

Transforming E.coli with Fluorescent Proteins

25 ul DH5a cells
.5 ul DNA

7/24/14

Yeast Colony PCR

Followed colony PCR procedure from before
Used primers for PSV606
Used 1.5 ul DMSO per reaction
3 min annealing step

FAILED

7/25/14

Diluted CB008/DB pTET+GFP strains for transformations

Transformations of m3+rtTA

used 4 ul DNA
Plate on SD URA

7/28/14

Yeast Colony PCRS

1 ul of FW primer
1 ul of RV primer
10 ul Green MM
10 ul Yeast cells
1.5 ul DMSO

Ura: 606/606
His: RA145/RA146
Trp: 604v2/604v2

-FAILED-

Yeast Transformations

Transformed pAGA+mCherry into yeast strains.
(All with pTET+GFP, and pTET+mfalpha)
CB008DB m6+rtTA
        m7+rtTA
CB008   m10+rtTA
        m6+rtTA
        m7+rtTA
        pTEF1+rtTA

Transformed pTET mfalfpha into CB008DB pTET+GFP
        pTEF1+rtTA

Transformed m3+rtTA into pTET+GFP CB008/DB

Miniprep

PTS94- 150 ng/ul
PSW696- 60 ng/ul
PS2607- 125 ng/ul

Colony PCR

Colony PCR on URA, HIS, and TRP sites.
Repeat Colony PCR done earlier today.

PCR

7/29/14

Colony PCR

Repeat Colony PCR from yesterday.
FAILED.
Possibly errors in the primers for TRP. should show 300 bp.
Use a 100 bo ladder?

PCR

More Colony PCR

Repeat URA and TRP colony PCRs
Made own Green MM from (per reaction)
    .125 ul Gotaq enzyme
    5 ul 5x Buffer
    .5 ul DNTPs
Still FAILED.

7/29/14

More failed colony PCRs

7/31/14

PCR Purification

BFP-118.4 ng/ul
    digest with Xho1/Not1
Aga-144.2 ng/ul
    digest with Apa1/Xho1

Double Digestion of BFP

Digest 2000ng
17 ul   BFP PCR Purification
.5 ul   Xho1 Enzyme
.5 ul   Not1 Enzyme
2.5 ul  Cutsmart Buffer
4.5 ul  Water

Incubate 37C for 3 hrs

Digestion of RFP

Digest 2000ng
15 ul   pAGA1 PCR Purification
.5 ul   Apa1 Enzyme
2.5 ul  Cutsmart Buffer
7 ul    Water

Incubate Room Temperature for 2 hrs

Add .5 ul Xho1 Enzyme   

Incubate 37C for 1 hr

Digest mCherry+pAGA1 with Pme1 for Transformation

6 ul    pGEM22
.5 ul   Pme1 Enzyme
2.5 ul  Cutsmart Buffer
16 ul   Water

Incubate 37C for 1 hr

Transformations (Yeast)

Transformed pAGA1+mCherry into
(CB008):    pTEF1
            m6  
            m7
(CB008DB)   m6
            m7

All contain the other motifs in the circuit.

PCR Purify Digestions

Followed procedure for PCR Purifications in protocols.
Final Concentrations:
BFP: 17.71 ng/ul
RFP: 21.75 ng/ul

Ligations

1. HY130E Backbone with pAGA1+BFP (TRP)
2. HY130E Backbone with pPCL2+BFP (TRP)

1)  3 ul    Backbone
    1 ul    BFP
    1 ul    pAGA1
    1 ul    T4 Ligase
    1 ul    10X Buffer
    3 ul    Water

2)  3 ul    Backbone
    1 ul    BFP
    .5 ul   pPCL2
    1 ul    T4 Ligase
    1 ul    10X Buffer
    3.5 ul  Water

Incubate room temperature
Kept in Ianto's freezer box

8/1/14

Pme1 Digest of pTET+mfalpha

Same protocol as before

Transformations (Yeast)

CB008 m3 transform- m3+rtTA
CB008DB m10 transform- pTET+mfalpha

8/4/14

Remade 20mM NaOH

Colony PCR

CB008 pAGA+mCherry:
    m6, m7
CB008DB pAGA+mCherry:
    m6, m7

Made Liquid Cultures

CB008:
    pTET+mfalpha
        pTEF1, m3, m6, m7
    m10+rtTA
CB008DB 
    pTET+mfalpha
        pTEF1, m6, m7
    pTET+GFP (for m3+rtTA transformations)
    pAGA1+mCherry m10

8/5/14

Colony PCR

CB008/DB pAGA1+mCherry
    m6, m7
Most of the colonies worked

Gel

Ran a gel of:
Pme1 Digest of pAGA1+mCherry
               pTET+mfalpha

PCR

8/7/14

Liquid Cultures

5 ml YPD cultures of the 8 mfalpha strains from 8/4/14 to transform pPCL2+mCherry

Exploratorium Presentation

8/8/14

Dilutions

Made 1:20 dilutions of pTET+mFalpha strains:
CB008: pTEF1, m6, m7, m10
CB008DB: pTEF1, m3, m6, m10
*for pPCL2+RFP transformations

Colony PCR

CB008:
    m3+rtTA 
    pTEF1, pAGA1+mCherry
CB008DB:
    m3, pAGA1+mCherry
    pTEF1, pAGA1+mCherry
    m6, pAGA1+mCherry
    m10, pTET+mfalpha

Boiled 100C for 20 min
Primers-    URA: 606
            HIS: RA 145/146
            TRP: RA 145/148

PCR

Pme1 Digests

(Same for all digests)
.5 ul   Pme1 Enzyme
2.5 ul  Cutsmart Buffer

RFP:    9 ul of pPCL2+mCherry 
        13 ul of water
BFP:    4 ul of pPCL2+BFP
        18 ul of water

Did twice for more transformations

Transformations

Tranformed pPCL2+BFP and pPCL2+mCherry into mfalpha strains

8/11/14

Colony PCR

BFP and RFP transformations from 8/8/14
Used RA145/148 for TRP
1.5 ul DMSO per reaction

Transformations (Yeast)

pTET+mfalpha into CB008 m3
pAGA1+mCherry into CB008DB m10
pPCL2+RFP into CB008DB m10
pPCL2+BFP into CB008DB m10

Streaked Plates

CB008
    pTEF1, pAGA1+mCherry
    m3+rtTA
CB008DB
    pAGA1+mCherry
        pTEF1, m3, m6
    m10, pTET+mfalpha

8/12/14

Glycerol stocks

CB008
    pTEF1, pAGA1+mCherry
    m3+rtTA
CB008DB
    pAGA1+mCherry
        pTEF1, m3, m6
    m10, pTET+mfalpha

(yGEM69-74)

Pme1 Digestions

pPCL2+BFP
pPCL2+mCherry
pAGA1+mCherry
pTET+mfalpha

Colony PCR

pPCL2+BFP
pPCL2+mCherry

PCR

Transformations (DH5a cells for Miniprepping)

pTET+mfalpha
pPCL2+BFP
pPCL2+mCherry
pAGA1+mCherry

Transformations (Yeast)

CB008 m3, pTET+mfalpha
CB008DB m10
    pPCL2+mCherry, pAGA1+mCherry, pPCL2+BFP

Pme1 Digest

pTET+mfalpha

Streaked Plates

Streaked mCherry and BFP successful colonies from Colony PCR

Liquid Cultures of DH5a transformations

8/13/14

Dilutions

Made 1:20 dilutions of BFP/RFP cultures
CB008 BFP
    pTEF1, m6, m7, m10
CB008 RFP
    m6
CB008DB RFP
    m7, m10
CB008DB BFP
    m10

Colony PCR

Colony PCR of BFP/RFP transformations
-FAILED-

Miniprepped DH5a transformations for plasmids

pTET+mfalpha
RFP
BFP

Streak/Glycerol Stocks

CB008 
    pTEF1- RFP/BFP
    m6- RFP/BFP
    m7- RFP/BFP
    m10- BFP
CB008DB
    pTEF1- RFP/BFP
    m3- RFP/BFP
    m6- RFP/BFP
    m7- RFP/BFP

Transformations

CB008
    m6, RFP
    m10, BFP

8/14/14

Colony PCR

CB008 m3, pTET+mfalpha
CB008DB m10, pPCL2+RFP
             pAGA1+RFP
             pPCL2+BFP
*used .5 ul Zymolyase per reaction
Thermocycle:
    37C         5 min
    95C         5 min
    30x 95C     45 sec
        50C     30 sec
        72C     1 min
    72C         10 min
    4C          hold

PCR

8/17/14

Colony PCR

RFP/BFP strains
56 colonies
used RA145/148 and zymolyase

8/18/14

Colony PCR Check

pAGA1s successful
pPCL2 failed

Colony PCR

pPCL2+mCherry
pPCL2+BFP
pSAG1+Ste2 (use 87/91 primers. around 600bp)

PCR

Transformations (Yeast)

AFRPS:
7 pPCL2+mCherry 
1 pAGA1+mCherry
4 rtTAs

m3 CB008
pTET+mfalpha

8/19/14

Streaked Plates

pPCL2+mCherry AFRPS
m10, pPCL2+BFP

Liquid Cultures

23 things for glycerol stocks and transformations

PCR

8/20/14

Pme1 Digests

Digest 4000 ng
pPCL2+BFP
pAGA1+RFP
pTET+mfalpha

Incubate 2 hrs 37C

Colony PCR

*extended extension time to 2 min* ~940bp
Ste2 in NAT integration site
87/91 primers

Transformations (Yeast)

pPCL2+BFP:
PRM1, PRM2, PRM3, YDR124W, CLG1, ASG7, HYM1

Glycerol Stocks of yGEM101-126

8/21/14

Restreak ALL Plates

Yeast plates die after 2 weeks
Restreak on new YPD

Colony PCR

CB008/DB m6 for:
    pTET+mfalpha, pAGA1+RFP
*flow data suggests false positives of RFP

Transformations (Yeast)

pSAG1+rtTA
pPCL2+rtTA
pPRM6+rtTA, suspended
pECM18+rtTA, suspended
m3, pTET+mfalpha

Made new LiOAC, 10x TE Buffer, PEG 3350

ShuaiXin's Lab Notebook is unfortunately not available in digital form.

Thurs 14/05/29

1-13 Promoter Number Key:
1) PRM2
2) ASG7
3) FUS2
4) PCL2
5) FUS3
6) CLG1
7) YDR124W
8) HYM1
9) PRM6
10) PRM1
11) ECM18
12) PRM3
13) SAG1

PCR of 13 Alpha-factor inducible promoters

Reagents	1x reaction	4.5x MM
1) 5x HF Phusion Buffer	10ul	45ul
2) 10mM dNTPs	1ul	4.5ul
3) 10mM FW primers	2.5ul	11.25ul
4) 10mM Rev primers	2.5ul	11.25ul
5) Phusion Polymerase	0.5ul	2.25ul
6) Template DNA	0.5ul	2.25ul
7) ddH2O	33ul	148.5ul

~1kb: YDR124W, SAG1, PCL2, HYM1, FUS3

~700bp: CLG1, PRM2

~500bp: PRM6, PRM3, PRM1, FUS2, ECM18, ASG7

PCR Cycle (30)
98ºC    30secs
98ºC    10secs
55ºC    20secs
72ºC    30secs
72ºC    5mins
4ºC     hold

PCR products of #3,10,12 did not work. We Purified and nanodropped for concentrations:
                ng/ul
1) PRM2         13.49
2) ASG7         12.50
3) FUS2
4) PCL2         9.489
5) FUS3         11.77
6) CLG1         16.30
7) YDR124W      35.75
8) HYM1         23.61
9) PRM6         79.03
10) PRM1
11) ECM18       14.17
12) PRM3
13) SAG1        26.07

Gel1

Gel2

Gel3

Fri 14/05/30

Miniprepped overnight cultures of phy4 (4)

Conentrations:

55.15 ng/ul
65.40 ng/ul <-- pipette error, less than 43ul so we added 5ul H2O
52.89 ng/ul
31.65 ng/ul

Used #1,2 for digest with ApaI and XhoI

Digestion (Yesterdays Promoter PCR products, 10)

29ul of product
33ul of 10x Cutsmart buffer

1) Add 0.5ul of ApaI. Mix gently, spin down, incubate at room temp. for 2 hours
2) Add 0.5ul of XhoI. Mix gently, spin down, incubate at 37ºC for 1 hour
3) PCR cleanup (purple tubes) for PCR reactions (Promoters)

Concentrations after PCR cleanup:
1) 14.54
2) 4.326 redo, 5.489
4) -0.05256 redo, 1.730
5) 1.886 redo, 2.642
6) 41.05
7) 3.187
8) 19.09
9) 9.677
11) 1.868
13) 23.78

Digestion (Backbone pHY4) Cutting out present promoter to replate with ours

43ul of DNA
5ul of Cutsmart

1) Add 1ul ApaI. Mix gently, spin down, incubate at room temp for 2 hours
2) Add 1ul of XhoI, Mix gently, spin down, incubate at 37ºC for 1 hour
3) Gel extract backbone, don't want the promoter cutout

Mon 14/06/02

Ligated #1,2,5,6,7,8,9,13 with the 6kb pHY4 backbone

We only had enough backbone for 8 reactions so we chose the 8 promoters with the highest concentration.

Used Gibson ligation calculator to calculate mLs of reagents of our reaction.

Genes	Concentrations	Backbone(ul)	Insert(ul)	Water(ul)
PRM2	14.54	3	1.1	12.9
ASG7	5.489	3	2	12
FUS3	1.73	2.3	10	4.7
CLG1	41.05	3	0.4	13.6
YDR124W	3.187	3	7.1	6.9
HYM1	19.09	3	1.2	12.8
PRM6	9.677	3	1.2	12.8
SAG1	23.78	3	0.9	13.1

Transformed α-inducible Promoters in pHY4 into DH5α competent cells. 50uls for each transformation instead of 25uls.

9 Plates for 8 promoters and 1 negative control.

Redo-PCR of AFRPs that didn't work or had low yield. Redoing: 3,4,7,10,11,12

After PCR with the same primers, we ran it through a 1% gel

Tues 14/06/03

Transformation of pHY4 + AFRP

#7  ⎫
#9  | Grew at least a few colonies so they did okay
#13 ⎭

The rest, 1,2,5,6,8 didn't grow likely because of our low yield template promoter DNA. We need to restart and PCR promoters again for higher yield DNA. Then ligate and transform

Yesterdays AFRP PCR yields:
#4   84.35 ng/ul
#7   134.3 ng/ul
#10  84.14 ng/ul
#11  91.99 ng/ul
#12  64.64 ng/ul

Miniprepped cultures of Mach1 with pHY4 to get more pHY4 template.

*The PE buffer we used previously did not contain ethanol which was why we were having low yields for minipreps and other purifications.

Concentraions of pHY4
1) 360.2 ng/ul
2) 398.8 ng/ul
3) 322.2 ng/ul
4) 240.2 ng/ul

Digestion of AFRP PCR products (4,7,10,11,12)

50ul PCR product
5ul of 10x Cutsmart buffer

1) add 1ul of ApaI, incubate at room temp for 2 hours

2) add 1ul of Xho1, incubate at 37ºC for 1 hour

Digestion of pHY4 backbone (2 tubes)

43ul of DNA
5ul Cutsmart buffer

* 1 unit of enzyme = 1ug of DNA = 1000ng
    * 300ng/ul *43ul = 12,900 = Need 13units
    * Unit count depends on the RE. Need to check the product.
    * Always want excess RE

1) add 1ul ApaI, incubate at room temp for 2 hours
2) add 1ul of Xho1, incubate at 37ºC for 1 hour

Ran the backbone digest through a gel.

Gel of digested pHY4 with ApaI & XhoI

The streaks of pHY4 suggests that its been cut up by other nucleases so we can't purify this as our backbone. So we created overnight cultures of Mach1+pHY4 and are sequencing leftover digested phy4 to see if we have the backbone we want.

Created overnight cultures of the transformations that seemed to work: 7,9,13

Tomorrow we will miniprep and purify the construct for promoter testing.

Weds 14/06/04

Miniprepped yesterdays cultures of YDR124W, SAG1, and PRM6, pHY4

Concentrations of minipreps
YDR124W.1     539.4 ng/ul
YDR124W.2     555.4 ng/ul
YDR124W.3   594.3 ng/ul
YDR124W.4   652.5 ng/ul
YDR124W.5   481.5 ng/ul
YDR124W.6   377.7 ng/ul

PRM6.1      545.3 ng/ul
PRM6.2      569.1 ng/ul
PRM6.3        656.8 ng/ul
PRM6.4      570.8 ng/ul
PRM6.5      558.6 ng/ul

SAG1.1      538.1 ng/ul
SAG1.2      532.1 ng/ul
SAG1.3      505.8 ng/ul

pHY4.1      179.8 ng/ul
pHY4.2      155.6 ng/ul
pHY4.3      231.7 ng/ul

Ianto and Jessica digested and PCR purified 1,2,6,8,9,10,13

AFRP PCR Concentrations:
1. PRM2   58.91 ng/ul
2. ASG7   68.53 ng/ul
6. CLG1   15.13 ng/ul
8. HYM1   78.56 ng/ul
9. PRM6   132.6 ng/ul
10. PRM1  41.72 ng/ul
13. SAG1  91.24 ng/ul

Made a positive control digest of Hyun's pHY4 backbone.

Tomorrow we will run it through a gel and gel extracted it.

Thurs 14/06/05

Yesterday we made solutions for the yeast transformations we will do today.

Check chemical container information to confirm molar mass, sometimes they may be different.

50mL of LiOAc: Molar mass = 60.99g/mol / 20 = 3.3 grams in 50mL of H2O ~pH8

50mL Trizma: Molar mass = 157.60g/mol / 10 / 20 = 0.788 grams

50mL EDTA Molar mass = 292.24g/mol.  Used 0.146 grams in 50mL of H2O ~pH7.5

50% PEG.  Used 25grams of PEG + H2O until 50mL.  Heat in 50ºC water bath to melt all PEG.  Store tube in foil to protect from light at 4ºC

Fri 14/06/06

Out for the day. What I missed:

1-13 Promoter Number Key: 1) PRM2 2) ASG7 3) FUS2 4) PCL2 5) FUS3 6) CLG1 7) YDR124W 8) HYM1 9) PRM6 10) PRM1 11) ECM18 12) PRM3 13) SAG1

Transformed 1,2,4,6,7,10,11,12, and negative control. The negative control grew colonies so the backbone may have liated back by itself so we are using phosphitase to remove phosphates so that it cannot ligate together.

They then colony PCRed and sequenced.

AFRP	1	2	3	4	5
1	✓	X	X	✓	✓
2	✓	✓	X	✓	✓
4	✓	✓	✓	✓	✓
6	✓	✓	✓	✓	✓
10	X	✓	✓	X	X
11	X	✓	X	✓	✓
12	✓	✓	✓	✓	✓

Mon 14/06/09

Today we are miniprepping 2 of each successful colonies from the colony PCR

YDR124W ⎫ PRM6 | All grew 100+ colonies SAG1 ⎭

We are doing colony PCR on 5 colonies of each transformaiton. All 5 colonies are also patched as a stock and are circled on the plate when colony PCR confirms that they have the gene knock in.

Anneling temp at 50ºC for 30secs
Polymerase extension at 72ºC for 1min
Length of PCR product should be 940bp

Tues 14/06/10

Ianto and Jessica are digesting pHY4 + AFRP, all 11, and are PCRing out the bakbone w/o the GFP. Derrick has PCRed the rtTA with ends that have homolog to the digest ends NotI and XhoI of the plasmid being digested. 9 of 11 PCRs have worked for Derrick. Digest overnight at 37ºC

Finished product should be pHY4+AFRP+rtTA. Then they will be digested with PmeI ad transformed into yeast.

Weds 14/06/11

Redoing PCR of 2 and 12 of rtTA with homology ends to the 2, 12 promoters and the backbone.

PCR of gibson homology of rtTA to ASG7 & PRM3

5x HF buffer            10ul
dnTPs                   1ul
FW primer               2.5ul
Rev primer          2.5ul
Phusion Polymerase  0.5ul
Template                0.5ul
ddH2O                   33ul

PCR cycle (30)
98ºC   30secs
98ºC   10secs
55ºC   20secs
72ºC   30secs
72ºC   5mins
4ºC        hold

Concentrations of the 9 successful so far of PCR of gibson homology

1.PRM2       190.9 ng/ul
4.PCL2   149.1 ng/ul
6.CLG1       412.1 ng/ul
7.YDR124W  90.37 ng/ul
8.HYM1       248.9 ng/ul
9.PRM6      145.7 ng/ul
10.PRM1    71.88 ng/ul
11.ECM18   199.7 ng/ul
13.SAG1    65.55 ng/ul

We gibsoned inserts of rtTA with homology to the PCR backbone w/o GFP. The gibson reaction was in 10ul with 2 controls (backbone w/o insert)-1)CLG1, 2)PCL2

Incubated samples at 50ºC for 1hour

Thurs 14/06/12

The gibson reaction with backbone w/o GFP and insert of rtTA did not work

Today we will do a seamless reaction which is similar to gibson but is better with inserts that have shorter homology sequences.

Mon 14/06/16

Transformations of rtTA+AFRP in E.coli are going to be colony PCRed. Of the 11, SAG1 & PRM1 did not grow. We are PCRing rtTA, seeing if it has successfully transformed.

Protocol: Inoculate colony in 25ul of H2O, use 5ul for PCR template and the rest can be use for making 5mL cultures

Insert E.coli colony PCR

PCR mastermix

Reagents	1x	4x
Template DNA	5ul	n/a
Gotaq mix (2x)	12.5ul	50ul
FW primer	1.25ul	5ul
Rev Primer	1.25ul	5ul
H2O	5ul	20ul

PCR cycle (30x)
98ºC   2min
98ºC   30secs
55ºC   30secs
72ºC   1.5mins
72ºC   5mins
4ºC        hold

9 AFRP Promoters E.coli Colony PCR

Colony PCR of the 22 transformations.

Insert yeast colony PCR

PCR mastermix	1x	70x
2x GoTaq	10ul	700ul
10uM FW	1ul	70ul
10uM Rev	1ul	70ul
H2O	5ul	350ul
boiled yeast template	3ul	n/a

PCR cycle (30x)
95ºC   5mins
95ºC   45secs
50ºC   30secs
72ºC   1min/kb
72ºC   10min
4ºC        hold

Every PCR is being run on 1% agarose gel

Number of colony PCRs: 66 colonies from yeast, 27 from 9 rtTA+AFRP, 25 from constitutive promoters

Tues 14/06/17

Since colony PCR of the 22 transformations didn't all work, we are redoing it. Only 5 strains of the 22 strains were successful (11 CB008, 11 CB008DB). Checking URA site integration, expecting 940bp bands.

Colony PCRs to redo:

CB008DB	CB008
PRM1	PRM1
YDR124W	YDR124W
PRM3	PRM3
PRM6	PRM6
PCL2	ECM18
SAG1	PRM2
HYM1	CLG1
ASG7

Mastermix	1x	80x
2x GoTaq	10ul	800ul
10uM FW	1ul	80ul
10uM Rev	1ul	80ul
H2O	5ul	400ul
Boiled Yeast template	3ul	n/a

FW/REV primer: "606V2"

Colony PCR CB008+AFRP+GFP

Colony PCR CB008/CB008DB +AFRP+GFP

Colony PCR CB008DB+AFRP+GFP

Yesterday we made culturesof the AFRP+rtTA (all successful), 2 of each. Today we miniprepped them to prepare to transform into yeast. Transform into yeast after linearization/digest with Pme1.

Concentrations of AFRP+rtTA constructs:

ECM18+rtTA #1    308.3 ng/ul
ECM18+rtTA #2    231.6 ng/ul
PCL2+rtTA #1     162.7 ng/ul
PCL2+rtTA #2     247.3 ng/ul
PRM6+rtTA #1     248.1 ng/ul
PRM6+rtTA #2     327.9 ng/ul
ASG7+rtTA #1     351.7 ng/ul
ASG7+rtTA #2     593.5 ng/ul
HYM1+rtTA #1     221.7 ng/ul
HYM1+rtTA #2     413.0 ng/ul
PRM2+rtTA #1     324.3 ng/ul
PRM2+rtTA #2     339.6 ng/ul
PRM3+rtTA #1     351.5 ng/ul
PRM3+rtTA #2     316.7 ng/ul
CLG1+rtTA #1     289.0 ng/ul
CLG1+rtTA #2     276.8 ng/ul
YDR124W+rtTA #1  366.0 ng/ul
YDR124W+rtTA #2  239.3 ng/ul

Weds 14/06/18

Transforming 9 AFRP+rtTA plasmids into yeast. Ianto linearized the plasmids #1 and some of #2 depending on the sequences that came back (most won't work)

Preparing for the first flow experiment tomorrow. Everyone gets a promoter.

AFRP+rtTA owners
PRM2 - George
ASG7 - Sabrina
PCL2 - Eric
CLG1 - Derrick
YDR124W - Ianto
PRM6 - Ianto
PRM1 - Robert
ECM18 - Robert
PRM3 - Eleanor
SAG1 -Jessica

Also transformed the 2 AFRP+GFP that didnt work last time HYM1 (08/DB) & PRM3 (DB)

Made overnight cultures of the strain CB008+AFRP to test in on the flow after induction with 5 alpha-factor concentrations (0nM, 10nM, 1000nM, 10,000nM, 100,000nM)

Thurs 14/06/19

Overnight cultures of CB008+AFRP+GFP diluted ~100x (to a final concentration of OD600 0.5-0.1, Saturated overnight cultures should be OD600 of ~7) in SD complete media, and grown for 3 hours, 1000rpm shaker, 30ºC. Growing in 2mL well plates
Induce with Alpha-factor. Stock is in 3mM. Final concentrations are 0, 1nM, 10nM, 100nM, 1000nM. Alpha-factor cannot be refrozen, so throw leftover away.
Induce for 90mins, but no longer than 120mins
Transfer 250u of each well into a V-bottom 96-well plate containing 10ul of the fixing chemical Cyclohexamide. (thats 4 ul for every 100ul of culture) Cyclohexamide stops protein production by inhibiting ribosomes.
Run on the flow cytometer.

Flow Cytometer things to remember:

check the sheath fluid box to see if its empty
check the waster container. If full, dispose and add new bleach
take care not to leave the machine on run. Save sheath fluid by keeping on standby when not in use
find parameters using negative controls. (FSC, SSC, Fluorescense marker)
DO NOT RUN PLATE. RUN WELLS instead. (Run the first well by itself first b/c it needs time to create file folders.) this causes problems.
- Run plate only saves data of the first well.
- Can rerun through the first well again which would suck up air. Air no good for the machine.
highlight wells and change settings on the right in the aquisition dashboard screen
mixing speed 180ul/sec
mix 3 times rather than 2
run at 1ul/sec for samples and 0.5ul/sec for negative controls when finding parameters.
make sre uL doesn't exceed samle to prevent sucking up air. (Rule of thumb is to run 50ul less than allotted sample sizes for wells.)

Voltage settings were gotten by running negative controls and adjusting to readouts seen in histogram form of FSC, SSC, FITC

Parameters of todays flow

FSC: 250
SSC: 280
FITC(GFP): 550
B(RFP): 650

Flow rate: 1µL/sec
Sample Volume: 200µL
Mixing Volume: 100µL
Mixing speed: 180µL/sec

Plate map

    1   2   3   4   5   6   7   8   9   10  11  12
A   [------NEG------]       [------NEG-------]
B   [------PRM2-----]       [------PRM1------]
C   [------ASG7-----]       [------EMC18-----]
D   [------PCL2-----]       [------PRM3------]
E   [------NEG------]       [------SAG1------]
F   [------CLG1-----]
G   [------YDR124W--]
H   [------PRM6-----]

Analyze data.

Fri 14/06/20

Continuation of Weds 14/06/18:

6 of the 9 transformations in yeast failed for the AFRP+rtTA

Those that failed are:
ASG7
CLG1
YDR124W
HYM1
ECM18
PRM3

This means we need to go back to our E.Coli plates and miniprep colonies for sequencing again, then linearize and transform into yeast. Yesterday cultures were made of these 6, 5 colonies each except YDR124W which only had 3. Today we are miniprepping them and sending them for sequencing.

Nanodrop Concentrations:
YDR124W.3   241.7 ng/ul
YDR124W.4   386.5 ng/ul
YDR124W.5   439.6 ng/ul
ASG7.3      207.7 ng/ul
ASG7.4      319.8 ng/ul
ASG7.5      287.2 ng/ul
ASG7.6      300.2 ng/ul
ASG7.7      338.5 ng/ul
CLG1.3      408.0 ng/ul
CLG1.4      306.0 ng/ul
CLG1.5      277.6 ng/ul
CLG1.6      249.8 ng/ul
CLG1.7      277.1 ng/ul
HYM1.3      440.1 ng/ul
HYM1.4      342.4 ng/ul
HYM1.5      388.7 ng/ul
HYM1.6      226.7 ng/ul
HYM1.7      351.2 ng/ul
ECM18.3     377.0 ng/ul
ECM18.4     426.8 ng/ul
ECM18.5     368.8 ng/ul
ECM18.6     459.7 ng/ul
ECM18.7     372.9 ng/ul
PRM3.3      430.4 ng/ul
PRM3.4      441.8 ng/ul
PRM3.5      361.7 ng/ul
PRM3.6      375.6 ng/ul
PRM3.7      333.1 ng/ul

Mon 14/06/23

Found out that we were missing the activation domain of rtTA, the rtTA we've been cloning for the past 2-3 weeks has been wrong.

New primers for the full rtTA has been made

Digested more backbone with AFRP+GFP to prepare for correct rtTA insert.

Tues 14/06/24

Today we did Flowjo data analysis with Hyun and Kara with data from our last flow experiment, Thur 14/06/19

Data from usb transfer to save file folder in nanodrop room computer.
Drag all well data into flojo
Set up a gate for all data to select for appropriate size cells. Excludes large cells which are clumped together and small debree or bacteria, which are small.
Find the mean fluorescense and use that data to make a graph in matlab.

Prelim Flow of CB008 +AFRP+GFP

Code for my PCL2 graph:

alpha = [0.01 1 10 100 1000]
CB008 = [446 438 532 592 590]
yGEM5 = [2568 2759 3487 5829 7935]

figure(1)
semilogx(alpha,CB008,'--bo')
hold all
semilogx(alpha,yGEM5,'--rs')
xlabel('[Alpha-Factor][nM]')
ylabel('MeanGFP[Au]')
title('yGEM5 GFP vs [Alpha-Factor]')
legend('CB008','yGEM5')

Primers for the correct rtTA with the activation domain came. Jessica and Sabrina are doing the PCR for rtTA.

Gel photo of backbone digest +promoter+GFP Backbone digest with homology to AFRP

Already cut plasmid   49ul
Fresh plasmid         5ul
Cutsmart              6ul
Not1                  0.5ul
Xho1                  1ul

incubate at 37ºC for 2 hours

After digestion, Ianto & Jessica cut out and gel extracted the ~8kb backbone

Concentrations: (Ianto & Jessica)
pHY4+ASG7+GFP   23.77 ng/ul
pHY4+CLG1+GFP   16.59 ng/ul
pHY4+HMY1+GFP   12.96 ng/ul
pHY4+ECM18+GFP  21.39 ng/ul
pHY4+PRM3+GFP   15.20 ng/ul

Concentrations: (Derrick)
pHY4+YDR124W+GFP   15.46 ng/ul
pHY4+SAG1+GFP      12.10 ng/ul
pHY4+PRM6+GFP      21.74 ng/ul
pHY4+PRM1+GFP      4.186 ng/ul
pHY4+PCL2+GFP      6.348 ng/ul
pHY4+PRM2+GFP      0.451 ng/ul

I was asked to transform 6 things in DH5α: 1. HY3E (has rtTA) 2. pHY4 (for stock) 3. HY130E (TRP) 4. HY121E1 (URA3) 5. HYS4E2 (HIS3) 6. HY111E2 (LEU2)

Weds 14/06/25

11:30am, made cultures my transformations done yesterday for minipreps.

DH5α Transformations	Colony Count
1. HY3E (has rtTA)	8
2. pHY4 (for stock)	100+
3. HY130E (TRP)	100+
4. HY121E1 (URA3)	100+
5. HYS4E2 (HIS3)	100+
6. HY111E2 (LEU2)	100+

Derrick and Ianto made yeast cultures to test promoters in flow tomorrow.

The yeast was taken from patch plates.

They created streak plates to get individual colonies as well. We need individual colonies for biological replicates.

Thurs 14/06/26

Yesterday I made cultures of 6 transformations for minipreps. 1. HY3E (has rtTA) 2. pHY4 (for stock) 3. HY130E (TRP) 4. HY121E1 (URA3) 5. HYS4E2 (HIS3) 6. HY111E2 (LEU2) They grew for 22 hours so their concentrations are very high.

Miniprep concentrations (minipreps done by Jessica):

HY3E #1      628.1 ng/ul
HY3E #2      875.2 ng/ul
HY130E #1    549.3 ng/ul
HY130E #2    696.8 ng/ul
HY121E1 #1   152.9 ng/ul
HY121E1 #2   539.7 ng/ul
HYS4E2 #1    424.4 ng/ul
HYS4E2 #2    672.7 ng/ul
HY111E2 #1   555.3 ng/ul
HY111E2 #2   679.0 ng/ul
pHY4 #1      487.0 ng/ul
pHY4 #2      554.2 ng/ul

Flow cytometry, testing (triplicate) PRM2, ASG7, PLC2, CLG1
Alpha-factor concentrations: (Induce for 90mins)
(0nm, 0.5nm, 1nm, 10nm, 100nm, 1000nm, 3000nm)

Starting concentration is 3mM or 3,000,000nM Make 100x stocks and add 10ul to the 1mL cultures: 0nM 50nM 100nM 1000nM 10,000nM 100,000nM 300,000nM

Plate 1 & 2 Alpha Factor Concentration Map:

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-------------------{0 nM}-------------------]
B   [-------------------{0.5 nM}-----------------]
C   [-------------------{1 nM}-------------------]
D   [-------------------{10 nM}------------------]
E   [-------------------{100 nM}-----------------]
F   [-------------------{1000 nM}----------------]
G   [-------------------{3000 nM}----------------]
H   

Plate 1:
    H   G   F   E   D   C   B   A   
1       [--------CB008-1--------]
2       [--------CB008-2--------]
3       [--------CB008-3--------]
4       [--------PRM2-1---------]
5       [--------PRM2-2---------]
6       [--------PRM2-3---------]
7       [--------ASG7-1---------]
8       [--------ASG7-2---------]
9       [--------ASG7-3---------]
10      [--------PCL2-1---------]
11      [--------PCL2-2---------]
12      [--------PCL2-3---------]

Plate 2: 
   H    G   F   E   D   C   B   A   
1       [--------CLG1-1---------]
2       [--------CLG1-2---------]
3       [--------CLG1-3---------]
4
5
6
7
8
9
10
11
12

Fri 14/06/27

Continuation of CB008+AFRP+GFP FACs.

PRM6+GFP did not grow up yesterday.

ROUND 3 PLATE 1 PROMOTER MAP

    H   G   F   E   D   C   B   A   
1       [--------CB008-1--------]
2       [--------CB008-2--------]
3       [--------CB008-3--------]
4       [--------YDR124W-1------]
5       [--------YDR124W-2------]
6       [--------YDR124W-3------]
7       [--------PRM3-1---------]
8       [--------PRM3-2---------]
9       [--------PRM3-3---------]
10      [--------PRM1-1---------]
11      [--------PRM1-2---------]
12      [--------PRM1-3---------]

ROUND 2 PLATE 2 PROMOTER MAP [DID NOT COMPLETE]

   H    G   F   E   D   C   B   A   
1       [--------ECM18-1--------]
2       [--------ECM18-2--------]
3       [--------ECM18-3--------]
4       [--------SAG1-1---------]
5       [--------SAG1-2---------]
6       [--------SAG1-3---------]
7
8
9
10
11
12

Instructions for starting flow:

Turn on and wait 30mins for the machine to warm up
Re-initialize the HTS, them prime it three times. You'll get a bubble in the lines if you don't
Run CST!!! Follow the sheet in front of the monitor for more instructions for that part. (CST uses beads to calibrate the laser detection.) add one drop into 250ul of sheath fluid in A1.
Bead LOT ID: use the one that is most current
Load A1-A4 with bleach and B1-B4 with water [flip for the opposite corner] -Cytometer>CST. Make sure cytometer performance results passed

Run Clean Plate: 1. Click on experiment. Experiment>Open experiment 2. Open clean plate "Daily Clean" - 96 well U-bottom" 3. Be here to see if the cleaning is going correctly, low events (less than 100events/sec for bleach and less than 10events/sec for water) 4. If over the events, run another clean plate 5. View events in aquisition dashboard in view>Acquisition dashboard 6. Can also make a clean plate using HTS>Clean

Mon 14/06/30

Continuation of CB008+AFRP+GFP FACS. Also testing Constitutive pTEF1 promoters +GFP today

ROUND 4 MAP

   H    G   F   E   D   C   B   A   
1       [--------ECM18-1--------]
2       [--------ECM18-2--------]
3       [--------ECM18-3--------]
4       [--------SAG1-1---------]
5       [--------SAG1-2---------]
6       [--------SAG1-3---------]
7       [--------CB008-1--------]
8       [--------CB008-2--------]
9       [--------CB008-3--------]
10
11
12

Constitutive Promoter MAP

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-CB008-]       
B   [-pTEF1-]       
C   [-m3----]       
D   [-m6----]       
E   [-m7----]       
F   [-m10---]
G   
H

Tues 14/07/08

Meeting with Anusuya:

Site directed mutagenesis of ribosome binding sites to fine tune expression of proteins. Tune down the effect of the promoters
Two promoters back to back to increase expression?
Find out how to differentiate yeast strains when they are co-cultured.
Maybe work more with constitutive rather than the inducible because there might be variable behaviors and its hard to model.
Email ben and ask for code from last year.
Start modeling progress, promoters and outputs. Co-opt code that was written last year
Flow with Bar1 deleted yeast.
Find examples of Tcells that start out with slightly different inputs that strongly converge over time. Chaotic phenomenon.
look up Chaotic phenomenon in immune cells.

Weds 14/07/09

1) Transforming pTEF1 + rtTA (and mutants m6, m7, m10) into CB008+pTET+GFP and CB008DB+pTET+GFP. 8 Transformations. 2) Creating cultures of 5 CB008DB+AFRP+GFP strains for flow analysis on Thursday.

[Flow with CB008DB AFRP+GFP] https://www.dropbox.com/s/ymmlrcgm3zkoxr0/Flow%20with%20CB008DB%20AFRP%2BGFP.xlsx [pTEF+rtTA progress] https://www.dropbox.com/s/wilm904hbvosox6/pTEF%2BrtTA%20progress.xlsx

Thurs 14/07/10

Flow of CB008DB strains +AFRP+GFP

plate 1

    H   G   F   E   D   C   B   A   
1       [--------CB008DB-1------]
2       [--------CB008DB-2------]
3       [--------CB008DB-3------]
4       [--------CLG1-1---------]
5       [--------CLG1-2---------]
6       [--------CLG1-3---------]
7       [--------PRM2-1---------]
8       [--------PRM2-2---------]
9       [--------PRM2-3---------]
10      [--------PCL2-1---------]
11      [--------PCL2-2---------]
12      [--------PCL2-3---------]

Plate 2

    H   G   F   E   D   C   B   A   
1       [--------SAG1-1---------]
2       [--------SAG1-2---------]
3       [--------SAG1-3---------]
4       [--------AGA1-1---------]
5       [--------AGA1-2---------]
6       [--------AGA1-3---------]
7       
8       
9       
10      
11      
12

Dilutions: 3 hour incubation with 100x dilutions in 2mL well plates. 9:35am -> 12:35pm

Added Alpha-factor. There are several possible mistakes when inducing. On 2-3 of the wells of the 100nm and 1000nm concentration, alpha factor was on the walls of the plate and may not have been added to the culture fully. Also, when using the multi-dispenser, the initial 10ul doesnt all fall off the tip, leaving residual liquid hanging. 12:50 -> 2:20pm

Alpha-Factor Concentrations

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-------------------{0 nM}-------------------]
B   [-------------------{0.5 nM}-----------------]
C   [-------------------{1 nM}-------------------]
D   [-------------------{10 nM}------------------]
E   [-------------------{100 nM}-----------------]
F   [-------------------{1000 nM}----------------]
G   [-------------------{3000 nM}----------------]
H

Fri 14/07/11

CB008DB AFRP+GFP Round 2 Plate 1of1

Glycerol stocks of YDR124W, PRM6, & ASG7 did not grow in SD complete media overnight. The cells may have settled before freezing.

3 Hour incubation plate

    H   G   F   E   D   C   B   A   
1       [--------CB008DB-1------]
2       [--------CB008DB-2------]
3       [--------CB008DB-3------]
4       
5       [--------PRM1-1---------]
6       [--------PRM1-2---------]
7       [--------PRM1-3---------]
8       [--------ECM18-1--------]
9       [--------ECM18-2--------]
10      [--------ECM18-3--------]
11      
12

Incubated for an extra 25mins by accident. 9:30am -> 12:55pm

Added alpha-factor 1:05 -> 2:35PM

Flow Plate

    H   G   F   E   D   C   B   A   
1       [-------CB008DB-1-------]
2       [-------CB008DB-2-------]
3       [-------CB008DB-3-------]
4       [---------PRM1-1--------]
5       [---------PRM1-2--------]   
6       [---------PRM1-3--------]
7       [--------ECM18-1--------]
8       [--------ECM18-2--------]
9       [--------ECM18-3--------]   
10      
11      
12

Concentrations of Alpha-Factor are the same.

Mon 14/07/14

Group Meeting at 1pm Until then, everyone was working on their powerpoints for the presentation.

~3:00pm Colony PCR of CB008/CB008DB (+Constitutive Promoters +rtTA) (+pTET +GFP) 3 colonies of each were patched and PCRed onto URA knockout plates.

PCR Reaction:
10ul 2x GoTaq Mix
3ul ddH2O
1ul FW primer 606V2 (primers check for chromosomal integration at the URA2 site)
1ul RV primer 606V2
5ul boiled Template in 20mM NaOH

PCR Protocol:
95ºC 5mins
95ºC 30secs  |
50ºC 30secs  | x30
72ºC 1min    |
4ºC  hold

Running colony PCR on a gel tomorrow.

Tues 14/07/15

1). Running 24 colony PCRs. Expected band size is 940bp.

Gel Photo: Colony PCR of pTEF1_rtTA URA integration + pTET_GFP both strains

2). 6 Strains worked, the two that didn't are CB008DB+pTEF1+rtTA and CB008DB+m10+rtTA

3). We are redoing colony PCR of those 2 strains that failed, each with 5 colonies each this time. Update: Second colony PCR did not work so we will be doing a third colony PCR

Gel Photo: Colony PCR of m10_rtTA URA integration +pTET_GFP CB008DB

4). Redoing Colony PCR for a third time, 5 colonies each again. This time we included 2 positive controls to check if the PCRs are at fault. If this doesn't work we will have to redo transformations for these two and we will most likely not run the DB strains on the flow tomorrow. Update: Colony PCR did not work. Gel Photo: Colony PCR of m10_rtTA URA integration +pTET_GFP CB008DB Try2

Flow Cytometry with CB008DB +AFRP+GFP 100x dilutions, 3 hour growth: 9:40am -> 12:40pm, alpha-factor induction 12:50 -> 2:20pm

plate 1

    H   G   F   E   D   C   B   A   
1       [--------CB008DB-1------]
2       [--------CB008DB-2------]
3       [--------CB008DB-3------]
4       [--------ASG7-1---------]
5       [--------ASG7-2---------]
6       [--------ASG7-3---------]
7       [--------YDR124W-1------]
8       [--------YDR124W-2------]
9       [--------YDR124W-3------]
10      [--------PRM6-1---------]
11      [--------PRM6-2---------]
12      [--------PRM6-3---------]

NOTE E3 & F3 had some weird clumping on the bottom of the well and somehow can't be resuspended, even with pipetting. A2 skipped, human error.

Wed 14/07/16

1). None of 13 Colonies chosen from m10 worked so today George did another 10 colony PCRs. Again, did not work so we need to retransform m10+rtTA into CB008DB+pTET+GFP. Gel Photo: Colony PCR of m10_rtTA URA integration +pTET_GFP CB008DB Try3

2). Flow plate maps today: Attenuating GFP with 12 concentrations of doxycycline Both strains with Constitutive Promoter+rtTA +pTET+GFP

Ianto made 100x diluted cultures in the morning Incubation 7:25am -> 10:25am Induction 11:17am -> 5:17pm

[Doxycycline]: 100 mg/ml stock or 100,000 ug/ml (in 100ul Aliquots) Induction time: 6hrs Concentrations needed for 100x:

0 ug/ml
3 ug/ml
6 ug/ml
9 ug/ml
30 ug/ml
60 ug/ml
90 ug/ml
300 ug/ml
600 ug/ml
900 ug/ml
3000 ug/ml
6000 ug/ml

Dox Dilutions:

Stock: 100mg/mL 
**1x**           **100x**          Prep
60µg/mL       A: 6mg/mL            (6:100) 60µL of Stock in 940µL of water
30µg/mL       B: 3mg/mL            30µL of Stock in 970µL of water
9µg/mL        C: 900µg/mL          150µL of A in 850µL of water
6µg/mL        D: 600µg/mL          100µL of A in 900µL of water
3µg/mL        E: 300µg/mL          50µL of A in 950µL of water      Can also do 100ul of B in 900ul of water
0.9µg/mL      F: 90µg/mL           100µL of C in 900µL of water
0.6µg/mL      G: 60µg/mL           100µL of D in 900µL of water
0.3µg/mL      H: 30µg/mL           100µL of E in 900µL of water
0.09µg/mL     I: 9µg/mL            100µL of F in 900µL of water
0.06µg/mL     J: 6µg/mL            100µL of G in 900µL of water
0.03µg/mL     K: 3µg/mL            100µL of H in 900µL of water

Doxycycline concentrations plate map:

        H   G   F   E   D   C   B   A   
1                   [----0 µg/ml----]
2                   [---0.03 µg/ml--]
3                   [---0.06 µg/ml--]
4                   [---0.09 µg/ml--]
5                   [---0.3 µg/ml---]
6                   [---0.6 µg/ml---]
7                   [---0.9 µg/ml---]
8                   [---3.0 µg/ml---]
9                   [---6.0 µg/ml---]
10                  [---9.0 µg/ml---]
11                  [---30 µg/ml----]
12                  [---60 µg/ml----]

pTEF1 promoters

  1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008 Control]--------------]  
B [---------------[CB008 pTET_GFP Control]-----]  
C [---------------[CB008 pTET_GFP pTEF1_rtTA]--]  
D [---------------[CB008 pTET_GFP pTEF1 m6]----]     
E [---------------[CB008 pTET_GFP pTEF1 m7]----]    
F [---------------[CB008 pTET_GFP pTEF1 m10]---]  
G
H

  1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008DB Control]------------]  
B [---------------[CB008DB pTET_GFP Control]---]  
C [---------------[CB008DB pTET_GFP pTEF1 1of2 ] 
D [---------------[CB008DB pTET_GFP pTEF1 2of2 ]
E [---------------[CB008DB pTET_GFP pTEF1 m6]--] 
F [---------------[CB008DB pTET_GFP pTEF1 m7]--]             
G 
H

All wells ran its 10k events threshhold within seconds due to the amount of time they've been allowed to grow, 9 hrs.

3). Making cultures of CB008DB+pTET+GFP for tranformations of m10+rtTA tomorrow.

4). Yesterday's flow plate was contaminated and our data is very weird. (refer to Ianto's lab notebook on the same date) We will be redoing that experiment so today we should make more cultures for flow tomorrow.

Thu 14/07/17

Anusuya meeting: We should have everyone create a labnotebook/blog of what they do everyday so that we can keep track of everything. Background of T-cell signalling. Need good examples of what naturally happens. We need a specific thing we want to focus on and model for our project.

Read: 1). interaction between T-reg cells and T-helper cells. How T-reg with macrophages, their interaction represent some negative feedback. Macrophage somehow suppresses T-regs. 2). T-reg, dentridic cells. relates to neural. Stanford 2010, interaction btwn T-reg, T-helper, Th1-th2. 3). Topic of Neural information? microglia interaction? Might play a role in recruiting and regulating T-cells when there is injury to the brain.

1). Read some wiki and review papers, dont need data papers be able to understand whats going on with these interactions so that we have many examples where interactions play important roles.

2). Look from a non-immune viewpoint. There are interactions beyond the immune system so look into those and come up with examples. Perhaps we can build on the work from UCSF iGEM 2010.

3). COME UP WITH EXAMPLES, need an elavator pitch. Whats still unknown about these cell types? and how does this model we are making with yeast help us to understand whats going on. Specific termonology. Have some slides with these examples set up for the next meeting. Layout a rational.

4). Look up alpha factor diffusion rates. Delegate tasks for all of these points.

5). Have a point person for the medal requirements. Need someone to keep track of everything.

6). Maybe dedicate a 10min session to brief everyone about what has been done for the day and the end of every day. Have it written day and keep it in a text file for people to access.

7). Folders for all our files should be put into folders for the wiki. Update them! Intellecutal material, protocols, etc.

8). Create a library of motifs we've constructed and explain how its valuable. Find examples of them where they exist in the immune system.

Type 2 restriction sites. AAR1 BSA1

Modeling: Write code for both strains and their find out their output of alpha-factor. Then have both sets of code and add them together to see RFP output when those two cells are together.

factors to account for the model: diffusion constants, degredation rate, cell density (later)

Overnight cultures of CB008DB+pTET+GFP grew well. Continuing to tranform m10+rtTA. Diluted 20x at 9:45am -> 11:45am

Fri 14/07/18

Transferred labnotebook to this textfile.
Looked up examples related to our project
Prepared for monday's group meeting
Helped Robert with what he should be doing in the lab

Mon 14/07/21

100+ Colonies grew for our m10+rtTA transformations in CB008DB+pTET+GFP. We are now colony PCRing 10 colonies.

2-4pm group meeting

4 out of the 10 colony PCRs worked! m10+rtTA is now available for flow testing. Colony PCR m10+rtTA WORKED. URA integration

Everyone is assigned an article to read for an example related to our iGEM project. They were told to make slides of the signalling pathway if they could.

Tues 14/07/22

Made a streak plate of CB008DB+m10+rtTA+pTET+GFP from the patch plate.

100x dilutions done at 9:20am 9:20am -> 12:30pm Alpha-factor induction 12:47pm -> 2:17pm

Plate 1:

    H      G   F   E   D   C   B   A   
1  pTEF1-1 [--------CB008DB-1------]
2  pTEF1-2 [--------CB008DB-2------]
3  pTEF1-3 [--------CB008DB-3------]
4  M7-1    [--------ASG7-1---------]
5  M7-2    [--------ASG7-2---------]
6  M7-3    [--------ASG7-3---------]
7          [--------YDR124W-1------]
8          [--------YDR124W-2------]
9          [--------YDR124W-3------]
10         [--------PRM6-1---------]
11         [--------PRM6-2---------]
12         [--------PRM6-3---------]

Plate 2:

    H   G   F   E   D   C   B   A   
1       [--------AGA1-1---------]
2       [--------AGA1-2---------]
3       [--------AGA1-3---------]
4       [--------CLG1-1---------] did not grow as much as the others
5       [--------CLG1-2---------] 20ul instead of 10ul for CLG1
6       [--------CLG1-3---------]
7       [--------PRM2-1---------]
8       [--------PRM2-2---------]
9       [--------PRM2-3---------]
10      [--------PCL2-1---------]
11      [--------PCL2-2---------]
12      [--------PCL2-3---------]

Plate 3:

    H    G   F   E   D   C   B   A   
1        [--------ECM18-1--------]
2        [--------ECM18-2--------]
3        [--------ECM18-3--------]
4        [--------SAG1-1---------]
5        [--------SAG1-2---------]
6        [--------SAG1-3---------]
7        
8         there is no PRM3 made. They're in glycerol stock.
9        
10       [--------PRM1-1---------]
11       [--------PRM1-2---------]
12       [--------PRM1-3---------]

Weds 14/07/23

Came up with more cards for Cards against humanity_UCSF iGEM

Working on the CRISPR paper, discussion. Research for what has been done with CRISPR delivery and how our work is valuable.

Thurs 14/07/24

Working on the CRISPR paper and the Explo Powerpoint.

Made cultures for glycerol stocks of 8 things:

1. CB008 +pTEF1+rtTA +pTET+GFP +pTET+mfalpha
2. CB008 +m6+rtTA +pTET+GFP +pTET+mfalpha
3. CB008 +m7+rtTA +pTET+GFP +pTET+mfalpha
4. CB008 +m10+rtTA +pTET+GFP +pTET+mfalpha
5. CB008DB +m6+rtTA +pTET+GFP +pTET+mfalpha
6. CB008DB +m7+rtTA +pTET+GFP +pTET+mfalpha
7. CB008DB +pTEF1+rtTA +pTET+GFP
8. CB008DB +m10+rtTA +pTET+GFP

7 & 8 need +pTET+mfalpha

In the coming days we will also transfrom everything with pAGA+mCherry.

Fri 14/07/25

Stuff to do other than lab:

CRISPR paper. Read, Write
Powerpoint for Explo due today
Research for examples relating to the project
Cards Against Humanity: UCSF_UCB iGEM 2014 (illustrator/InDesign)

Make glycerol stocks of:

1:50 dilutions of each and grow for 3 hours in 5ml cultures to .4 ~ .5 OD600. Then follow glycerol stock protocol.

9am -> 12pm growth to log phase

1. CB008 +pTEF1+rtTA +pTET+GFP +pTET+mfalpha
2. CB008 +m6+rtTA +pTET+GFP +pTET+mfalpha
3. CB008 +m7+rtTA +pTET+GFP +pTET+mfalpha
4. CB008 +m10+rtTA +pTET+GFP +pTET+mfalpha
5. CB008DB +m6+rtTA +pTET+GFP +pTET+mfalpha
6. CB008DB +m7+rtTA +pTET+GFP +pTET+mfalpha
7. CB008DB +pTEF1+rtTA +pTET+GFP
8. CB008DB +m10+rtTA +pTET+GFP

1:20 dilutions for transformations after 3 hours growth in 5ml cultures. Transforming pTET+mfalpha into #7,8 and pAGA+mCherry into #1-6.

9am -> 12pm growth to log phase

1. CB008 +pTEF1+rtTA +pTET+GFP +pTET+mfalpha
2. CB008 +m6+rtTA +pTET+GFP +pTET+mfalpha
3. CB008 +m7+rtTA +pTET+GFP +pTET+mfalpha
4. CB008 +m10+rtTA +pTET+GFP +pTET+mfalpha
5. CB008DB +m6+rtTA +pTET+GFP +pTET+mfalpha
6. CB008DB +m7+rtTA +pTET+GFP +pTET+mfalpha
7. CB008DB +pTEF1+rtTA +pTET+GFP
8. CB008DB +m10+rtTA +pTET+GFP

~23 primers are coming in to clone AFRP upstream of BAR1 and Ste2 separately.

Note: 1. PCL2+mCherry in HY130 backbone is being constructed by Robert. We will probably make additional strains with this in place of pAGA+mCherry. 2. Jeffrey is working on getting m3+rtTA into CB008DB +pTET+GFP.

Mon 14/07/28

Last friday, Eleanor transformed mCherry into 6 strains with Constitutive Promoter, GFP, Alpha factor. Today I am colony PCRing them along with 3 other strains that have other things being integrated: 1) +rtTA for the m3s 2) +mfalpha for DB pTEF1 & m10. 14-07-28 Yeast Colony PCR1

Next steps: 1. Need to retransform DB m10 and CB008 m7 because they have no colonies. 2. Need to make glycerol stocks of the ones that worked for Colony PCR 3. For tomorrow, make cultures for tomorrow's flow (9 strains + control)

Auxotrophic marker Colony PCR primer names: His: FW RA145(#87) & REV RA146(#89) Trp: FW RA145(#87) & REV

Today I also worked on the Cards Against iGEM inDesign layout.

Tues 14/07/29

Flow scheduled for 5-8pm. Doing Consti+rtTA+pTET+GFP Dox run. No alpha, no RFP. Runnin all 5 DB strains today (and 4-5 CB008 strains tomorrow pending successful colony PCR of CB008 m3.)

Dilutions start 7:16am -> 10:16am Induction 10:45 -> 4:45pm

Dox concentrations are the same as last time.

All plates identical assortment:

Plate 1:

  1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008DB]--------------------]  
B [---------------[CB008DB pTET_GFP]-----------]
C [---------------[CB008DB pTET_GFP pTEF1]-----]
D [---------------[CB008DB pTET_GFP pTEF1 m3]--]
E [---------------[CB008DB pTET_GFP pTEF1 m6]--] 
F [---------------[CB008DB pTET_GFP pTEF1 m7]--]             
G [---------------[CB008DB pTET_GFP pTEF1 m10]-]
H

Plate 2:

  1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008DB]--------------------]  
B [---------------[CB008DB pTET_GFP]-----------]  
C [---------------[CB008DB pTET_GFP pTEF1]-----] 
D [---------------[CB008DB pTET_GFP pTEF1 m3]--]
E [---------------[CB008DB pTET_GFP pTEF1 m6]--] 
F [---------------[CB008DB pTET_GFP pTEF1 m7]--]             
G [---------------[CB008DB pTET_GFP pTEF1 m10]-]
H

Plate 3:

  1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008DB]--------------------]  
B [---------------[CB008DB pTET_GFP]-----------]  
C [---------------[CB008DB pTET_GFP pTEF1]-----] entire lane 10 is induced
D [---------------[CB008DB pTET_GFP pTEF1 m3]--] with wrong concentration.
E [---------------[CB008DB pTET_GFP pTEF1 m6]--] 
F [---------------[CB008DB pTET_GFP pTEF1 m7]--]             
G [---------------[CB008DB pTET_GFP pTEF1 m10]-]
H

time course flow allows us to create a stocastic model of our products: rtTA, GFP, alpha-factor, RFP.

Colony PCR2 redo from yesterday because only 1 worked 14-07-29 Yeast Colony PCR2

Constitutive Promoter Constructs progress: 14-07-29_Consti construct progress Today George and I are retransforming:

CB008DB+pTET+GFP+m3+rtTA[+pTET+mfalpha]
CB008+pTET+GFP+m7+rtTA+pTET+mfalpha[+pAGA+mCherry]
CB008+pTET+GFP+m10+rtTA+pTET+mfalpha[+pAGA+mCherry]

The salmon sperm boiled down to about 5ul for all 3 transformations. It also seemed a little viscous.

CB008+pTET+GFP+m10+rtTA+pTET+mfalpha[+pAGA+mCherry] already exists so our transformation of this (#3) was pointless. What we meant to do was CB008DB+m10+rtTA+pTET+GFP[+pTET+mfalpha]

After all our colony PCRs for the day, this is the update of the excell progress sheet: 14-07-29.2_Consti construct progress

Made cultures of all 10 things on the Consti list. 9 for transformations and 1 for glycerol stock.

Made cultures for tomorrows flow.

Weds 14/07/30

None of the cultures for today's flow grew. Only the controls grew. Looking back at the URA knock out patch plates that we inoculated from, they didn't grow very well. I think they moreso had a hard time growing than it not being correctly transformed because they came back positive in the colony PCRs (14/7/15). I transferred them onto a YPD patch plate to see if they would grow.

Derrick and I plated on YPD CB008/DB strains with pTET+GFP+consti+rtTA because the current patch plate on URA of CB008s does not have good growth. Cultures made from this patch plate did not grow either so holding out flow back.

Jeffrey and George are retransforming the ones that failed.

Thurs 14/07/31

Our steak plates of CB008/DB +pTET+GFP+Consti+rtTA over grew only on CB008DB. All the CB008s did not grow and have no sign of growth. This may mean that we will have to retransform consti+rtTA into our CB008 strains. So far, our glycerol stocks have not been working well for us; we don't know what the problem is.

Worked on the Explo powerpoint today.

Fri 14/08/01

Made streak plates with Derrick of everything we have so that we have fresh/organized cultures.

Worked on Cards Against iGEM InDesign. Printed and cut out our first deck for testing.

Mon - Weds 14/08/04-06

Out on vacation.

Thurs 14/08/07

Tomorrow we are running flow. Testing the final circuit with 5 strains. triplicate, 5 Dox concentrations (Shaved off 7 of the top concentrations of Dox), 4 time points.

Concentrations: 
0 ug/ml
0.03 ug/ml
0.06 ug/ml
0.09 ug/ml
0.6 ug/ml

Exploratorium After Dark event 6pm-10pm

Fri 14/08/08

OD600 of .1

Flow today with CB008 pTEF1+rtTA pTET+GFP pTET+MFalpha pAGA1+mCherry. Signed up from 4:30pm -> 9pm

Diluted 1:200 at 7:45am and grown for 2 hours

Time points with [Dox] induction: 0, 1.5hr, 3hr, 5hr

Plate map for all time points (4 plates):

  1   2   3   4   5   6   7   8   9   10  11  12
A [CB008 m6-1]----]       [CB008 m10-3]----]
B [CB008 m6-2]----]       [CB008DB m7-1]---]
C [CB008 m6-3]----]       [CB008DB m7-2]---]
D [CB008 m7-1]----]       [CB008DB m7-3]---]
E [CB008 m7-2]----] 
F [CB008 m7-3]----]           
G [CB008 m10-1]---] 
H [CB008 m10-2]---]

[Dox] Concentration Map:

        H   G   F   E   D   C   B   A   
1       [--------0 µg/ml------------]
2       [--------0.03 µg/ml---------]
3       [--------0.06 µg/ml---------]
4       [--------0.09 µg/ml---------]
5       [--------0.6 µg/ml----------]
6 
7       [--------0 µg/ml------------]
8       [--------0.03 µg/ml---------]
9       [--------0.06 µg/ml---------]
10      [--------0.09 µg/ml---------]
11      [--------0.6 µg/ml----------]
12

Flow notes: The first plate for time 0 contains the concentrations of doxycycline so we saw a bimodal RFP response. An explanation for this can be that the addition of doxycline had driven expression of mfalpha -> pAGA+mcherry before the cyclohexamide fixed the cells.

Finished flow at 9:40pm

Mon 14/08/11

Group Meeting at 10am -> 12pm

Flow with AFRP+rtTA +pTET+GFP 7 strains (Mon-Tues Flow), 7 alpha concentrations. 7 AFRP promoters+rtTA sucessfully transformed into CB008.

The AFRP strains that have successfully been transformed (7):

CB008 +CLG1+rtTA +pTET+GFP
CB008 +YDR124W+rtTA +pTET+GFP
CB008 +ASG7+rtTA +pTET+GFP
CB008 +HYM1+rtTA +pTET+GFP
CB008 +PRM1+rtTA +pTET+GFP
CB008 +PRM2+rtTA +pTET+GFP
CB008 +PRM3+rtTA +pTET+GFP

HYM1 plate, 0.6ug/ml & 0.06ug/ml concentrations were switched.

1:200 dilution grown for 2hrs 8:00am -> 10:00am induced at 10:30am Fix at 3:30pm Flow signed up from 4:30pm -> 9:00pm Finished flow at 8:40pm

Doxycycline concentrations plate map (12):

        H   G   F   E   D   C   B   A   
1          [--------0 µg/ml----------]
2          [--------0.03 µg/ml-------]
3          [--------0.06 µg/ml-------]
4          [--------0.09 µg/ml-------]
5          [--------0.3 µg/ml--------]
6          [--------0.6 µg/ml--------]
7          [--------0.9 µg/ml--------]
8          [--------3.0 µg/ml--------]
9          [--------6.0 µg/ml--------]
10         [--------9.0 µg/ml--------]
11         [--------30 µg/ml---------]
12         [--------60 µg/ml---------]

Alpha-Factor Concentrations (7):

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-------------------{0 nM}------------]
B   [-------------------{0.5 nM-----------]
C   [-------------------{1 nM}------------]
D   [-------------------{10 nM}-----------]
E   [-------------------{100 nM}----------]
F   [-------------------{1000 nM}---------]
G   [-------------------{3000 nM}---------]
H

Plates:

Plate #1 (ASG7)
Plate #2 (CLG1)
Plate #3 (HYM1)
Plate #4 (YDR124W)

Play tested the printed Cards Against iGEM. Eliminated about 21 black cards. We have 24 good black cards, Goal 40-50.µ

Tues 14/08/12

Flow with the other 3 CB008 +AFRP+rtTA +pTET+GFP (PRM1, PRM2, PRM3) constructs. Signed up from 4pm -> 8pm.

1:200 dilution at 8:11am -> 10:11am

Same Dox and alpha-factor concentrations as yesterday.

Plate#1 (PRM1)
Plate#2 (PRM2)
Plate#3 (PRM3)

Helped Jessica with her progress with AFRP+rtTA constructs. Streaked out the 5 successful transformations of pTET_mfalpha for the CB008 (12-Aug) and made cultures of those for tranformations (+pAGA+mcherry/+pPCL2+mcherry/+pPCL2+BFP).

AFRP+rtTA progress chart: 14-08-12 AFRP+rtTA progress

Weds 14/08/13

1:200 dilutions, 2hr growth 7:50am -> 9:50am

Time points with [Dox] induction: 0, 1.5hr, 3hr, 5hr

Making Dox dilutions, follow this:

Stock: 100mg/mL 
**1x**           **100x**          Prep
60µg/mL       A: 6mg/mL            (6:100) 60µL of Stock in 940µL of water
30µg/mL       B: 3mg/mL            30µL of Stock in 970µL of water
9µg/mL        C: 900µg/mL          150µL of A in 850µL of water
6µg/mL        D: 600µg/mL          100µL of A in 900µL of water
3µg/mL        E: 300µg/mL          50µL of A in 950µL of water      Can also do 100ul of B in 900ul of water
0.9µg/mL      F: 90µg/mL           100µL of C in 900µL of water
0.6µg/mL      G: 60µg/mL           100µL of D in 900µL of water
0.3µg/mL      H: 30µg/mL           100µL of E in 900µL of water
0.09µg/mL     I: 9µg/mL            100µL of F in 900µL of water
0.06µg/mL     J: 6µg/mL            100µL of G in 900µL of water
0.03µg/mL     K: 3µg/mL            100µL of H in 900µL of water

Plate map for all time points (4 plates):

  1   2   3   4   5   6   7   8   9   10  11  12
A [CB008 pTEF1-1]-]       [CB008DB m3-3]---] 
B [CB008 pTEF1-2]-]       [CB008DB m6-1]---]
C [CB008 pTEF1-3]-]       [CB008DB m6-2]---]
D [CB008DB pTEF1-1]       [CB008DB m6-3]---]
E [CB008DB pTEF1-2]  
F [CB008DB pTEF1-3]           
G [CB008DB m3-1]--] 
H [CB008DB m3-2]--]

[Dox] Concentration Map:

        H   G   F   E   D   C   B   A   
1       [--------0 µg/ml------------]
2       [--------0.03 µg/ml---------]
3       [--------0.06 µg/ml---------]
4       [--------0.09 µg/ml---------]
5       [--------0.6 µg/ml----------]
6 
7       [--------0 µg/ml------------]
8       [--------0.03 µg/ml---------]
9       [--------0.06 µg/ml---------]
10      [--------0.09 µg/ml---------]
11      [--------0.6 µg/ml----------]
12

Deleted and exported files on the flow to prevent data crowding. (All files exported onto iGEM2 usb) Note: 140627 Alpha Factor Responsive Promoter 2 of 2 gives an error when exporting. "There are no tubes with data to export". Data may have been deleted? idk

Thurs 14/08/14

1:200 dilutions at 7:50 -> 9:50am

Time points with [Dox] induction: 0, 1.5hr, 3hr, 5hr, 8hr

Plate map for all time points (5 plates):

  1   2   3   4   5   6   7   8   9   10  11  12
A [CB008 pTEF1-1]-]       [CB008 m7-3]-----]
B [CB008 pTEF1-2]-]       [CB008 m10-1]----]
C [CB008 pTEF1-3]-]       [CB008 m10-2]----]
D [CB008 m6-1]----]       [CB008 m10-3]----]
E [CB008 m6-2]----] 
F [CB008 m6-3]----]           
G [CB008 m7-1]----] 
H [CB008 m7-2]----]

[Dox] Concentration Map:

        H   G   F   E   D   C   B   A   
1       [--------0 µg/ml------------]
2       [--------0.03 µg/ml---------]
3       [--------0.06 µg/ml---------]
4       [--------0.09 µg/ml---------]
5       [--------0.6 µg/ml----------]
6 
7                       [--0 µg/ml--]
8                       [-0.03 µg/ml]
9                       [-0.06 µg/ml]
10                      [-0.09 µg/ml]
11                      [-0.6 µg/ml-]
12

In the 2ml culture plate, we noticed what seems to look like debri or contamination on the bottom of the wells from rows A,B,C. We tried to make the time point plates by pipetting everything singly.

After taking a look at the 0 time point plate through the flow, we can see that the size of molecules running through are not yeast but bacterial contamination. We need to totally redo this experiment again because this contamination gives us inaccurate data.

Yesterday, the 0 time point plate was not run all the way (only 10ul was run and there were not enough events). Derrick saved the plate and I will run 100uls of each of those wells. The wells are G,H (1-5), and A,B,C,D (7-11).

2pm -> 4pm Practiced presenting poster with the group and Anusuya.

Fri 14/08/15

Last official day of iGEM

All day event. Driving down to Santa Cruz for the Symposium held by UC Santa Cruz.

Sun 14/08/24

Made cultures of Contsti+full contruct + pPCL2+mCherry for Monday's flow (4).

pTEF1, m6, m7, m10

Robert's Lab Notebook

WELCOME TO THIS AWESOME MESSY NOTEBOOK

6/9/14 (BootCamp)

PCR for Constitutive Promoters

PCR Reaction:

1 Reaction                        4.5X Master Mix  

10 ul   5X Phusion Buffer         45 ul 
1 ul    dNTP's (10uM)             4.5 ul
2.5 ul  Foward Primer (10uM)      11.25 ul
2.5 ul  Reverse Primer (10uM)     11.25 ul
.3 ul   Template DNA              1.35 ul
.5 ul   Phusion DNA Polymerase    2.25 ul
332 ul  Water                     150 ul

Steps

1) Mix Reagents in a 4.5X Master Mix on ice

2) Pipette 50ul of Master Mix into 4 labeled PCR tubes

3) Put into thermocycler for following cycle:

Initial Denaturation       98ºC          30s
    35 cycles of

        Denaturation       98ºC          10s
        Annealing          55ºC          20s
        Extension          72ºC          30s
Final Extension            72ºC          5 min
Hold                       4ºC           FOREVERRRRRR

4) Keep samples for gel extraction

*Forgot to keep 4.5X Master Mix tube on ice *I also made a 1/10ul dilution of each primer when I was supposed to make a 10/100ul dilution

6/10/14

Loading PCR'ed Constitutive Promoters on Gel

50 ul          PCR Tube
5 ul           10X Blue Juice Dye

Steps

1) Make a Gel with Cybr Safe

2) Add Blue Juice into PCR tube

3) Load and run gel at 100 volts for 30 min

Gel Photo PCR'ed Constitutive Promoters

Constitutive Promoters pTEF1, m3, m6, m7, m10

6/10/14

Gel Extraction Kit

Steps

1) Cut out DNA from Gel

2) Weigh the slice of gel and and 3X volume of QG Buffer to 1X volume gel. For >2% gels add 6X Buffer.

3) Incubate at 50ºC or 10 mins. Vortex every 2-3 mins.

4) Solution should be yellow. If it is orange or violet add 10ul 3M sodium accetate pH 5 and mix

5) Add 1X gel volume of isoproponal and mix

6) Get a QIAquick spin column (Purple column with cap)

7) Put sample into column and centrifuge for 1 min. Discard flow-through and place column back into tube. for samples >800ul, re-spin the liquid.

8) Add 500ul QG Buffer and spin for 1 min. Discard flow-through and put column back into tube.

9) Add 750ul PE Buffer and spin for 1 min. Discard flow-through and put column back into tube.

10) Do a dry spin for 1 min.

11) Place column into a new 1.5ml microcentrifuge tube.

12) Elute DNA in 50ul (or whatever).

6/11/14

Restricton Enzyme Digest with ApaI

Steps

1) Put all the following into a tube:

40ul       DNA
5ul        Cutsmart Buffer
0.5ul      ApaI

2) Let it digest overnight at room temperature

6/12/14

Restriction Digest with XhoI

Steps

1) Add 0.5ul XhoI

2) Incubate in 37ºC in shaker

3) Run a PCR purification

*DNA concentration: 153ng/ul

DNA Ligation

1 ul 10X Ligase Buffer 0.2 ul DNA backbone 0.2 ul Insert 0.5 ul T4 DNA Ligase 8.1 ul Water

10ul total

-Incubate at room temperature for 2 hours

Transformation

10 ul Ligation 50 ul E.Coli compitant cells

Steps

1) 30 mins on ice

2) 42ºC Heat shock

3) Ice for 2 mins

4) Add 250 ul SOC media and shake/sit at 37ºC for an hour

5) Plate

Re-do Ligation (This time use 0.4ul backbone)

-Also use better competant cells

Re-do Transformation (above)

6/13/14

Yeast Transformation

Steps

Refer to protocal in my binder

6/16/14

Colony PCR for E.Coli

Steps

1) Pick a single colony using a pipette tip and mix in 25ul water in a PCR tube. Do ths for 4-6 colonies on each plate. Save rest of the tube just incase.

2) Set up PCR reaction as below:

                                     **1X Reaction**      **6X Reaction**
2X GoTaq Green PCR Master Mix             10ul                 60ul
10uM FW Primer                             1ul                  6ul
10uM RV Primer                             1ul                  6ul
Water                                      3ul                 18ul  
Bacterial cells (Template)                 5ul                 ___ul

*Add 15ul of the 6X Reaction to each tube

Cycles

95           5min
30X: 95      45s
     55      30s
     72      1min per kb
72           10min

3) Anaylze products on a gel. GoTaq has loading gel in it already. Load 5ul of PCR reaction.

4) For all positive bands, take the rest o the bacterial cells from step 1 and grow them in LB overnight (+antibiotic) for miniprep next day.

6/16/14

Send DNA to be sequenced

-They came back good :)

Colony PCR for Yeast & Patching (Refer to binder for protocol)

Steps

1) Pick 3 colonies and number them

2) Patch colonies onto a plate

3) Mix Yeast cells in 10ul NaOH in PCR tube

4) Boil for 10 min at 95ºC

5) PCR:

95ºC         5min

30X:
    95ºC     45s
    55ºC     30s
    72ºC     1min
72ºC         10min
4ºC          FOREVERRRRRRR

Gels

        SAG1     ECM18    PRM3   HYM1     ASG7      CLO7    PRM1

1KB	1 2 3	1 2 3	1 2 3	1 2 3	1 2 3	1 2 3	1

----	---------	----------	---------	---------	--------	---------	---
	1KB	2 3	1 2 3	1 2 3	1 2 3	1 2 3
----	-----	------	---------	---------	---------	---------

6/18/14

MiniPrep Constitutive Promoters (Refer to binder for protocol)

Made CBOO8 & CBOO8DB stock dilutions

Glycerol Stocks of CBOO8 & CBOO8DB (Refer to binder for protocol)

6/19/14

Flow Cytometry

Night Before:

1) Start overnight cultures using SD complete media

Day of:

1) Dilute cultures to final ~OD (Optimal Density) in the 96 well shaker plate (overnight cultures should be around ~OD7, so about a 1:100 dilution). Use SD media to make each well a total volume of 1mL

CBOO8

    1   2   3   4   5   6   7   8   9   10  11  12
A   [------NEG------]       [------NEG-------]
B   [------PRM2-----]       [------PRM1------]
C   [------ASG7-----]       [------EMC18-----]
D   [------PCL2-----]       [------PRM3------]
E   [------NEG------]       [------SAG1------]
F   [------CLG1-----]
G   [------YDR124W--]
H   [------PRM6-----]

in DB008

    1   2   3   4   5   6   7   8   9   10  11  12
A   [------NEG------]       [------NEG-------]
B   [------yGEM10---]       [------yGEM14----]
C   [------yGEM4----]       [------yGEM15----]
D   [------yGEM5----]       [------yGEM16----]
E   [------NEG------]       [------yGEM6-----]
F   [------yGEM11---]
G   [------yGEM12---]
H   [------yGEM13---]

2) Allow cells to grow on plate shaker for 3 hours at 1000 rpm

3) Induce with Alpha Factor. The Alpha Factor in the freezer is at 3mM and we're using concentrations at 0.1nm, 1nm, 10nm, 100nm, and 1uM

-Concentrations

3mM --> 30ul + 870ul water

⍒

100uM --> 50ul + 450ul water

⍒

10um --> 50ul + 450ul water

⍒

1000nm 50ul + 450ul water

⍒

100nm

*Alpha Factor cannot be refrozen so dump after use

4) Allow induction to proceed on plate shacker for 1.5 - 2 hours

5) Transfer 250 ul of each culture into a 96 V-Well

6) RUn on flow cytometer

-Checklist ✓:

Check status of machine (should be on standyby)
Check fluid boxes and stroage tanks
Do not run plate. Run well.
Have a positive & negative control
Open iGEM account (pw: biobricks)
Make new FACS experiment

-Voltage:

CHeck inspector to see if everything is on 
FCS: 250
SSC: 280
FITC: 550

Sample Flow Rate: 1
Sample Volume: 200
Mixing Volume: 100
Mixing Speed: 180
Number of Mixes: 3
Wash Volume: 400

-Wells

Select wells to run (make sure volume is 50ul below actual amount) and there will be a side bar of options on how to adjust your gels (mixing, flow speed)
Run well & save data onto USB
*Don't turn on wifi

7) Analyze Data

6/23/14

Colony PCR (refer to 6/16/14)

Gel result of Yeast Colony PCR:

MON 19 MAY 2014

Cleaned up lab. Read lots of literature.

TUE 20 MAY 2014

Looking for alpha-factor responsive promoters. Results can be found in "iGEM 2014/Parts and Plasmids/Mating Responsive Promoters/"

WED 21 MAY 2014

Continuing search for more alpha-factor responsive promoters to add to the 16 that we have found so far.

Also, designing primers for the promoters that we have found so far. For primer design, see "iGEM 2014/Protocols/cloning_DH5aT.docx"

MON 02 JUN 2014

I. Calculated Ligation concentrations found in 140602 Ligation Calculation.xlsx and performed ligation reactions.

II. Also re-PCR'd promoters that did not work before. Please see paper notebook page 3 for gel map. Gel image: PCR Promoters in order: 3(6 lanes),4(6 lanes),7 (6 lanes),10 (4 lanes),11 (4 lanes),12 (4 lanes)

TUE 03 JUN 2014

I. Re-PCR'd promoters that we did not do yesterday. See gel photos:

PCR Promoters in order: 1(6 lanes), 2(6 lanes), 5(6 lanes), 6 (4 lanes), 8 (4 lanes), 9(5 lanes)

PCR Promoters in order: 13(7 lanes)

Also gel extracted.

II. Selected colonies and inoculated cultures.

WED 04 JUN 2014

I. Digest PCR reactions and PCR cleanup. Completed. Concentration of Promoter 6 is pretty bad compared to others.

II. Inoculated single colony plates.

THURS 05 JUN 2014

I. Eric and Derrick are retrying digestion of backbone for the third time after two failed attempts. Will try ligation and transformation into e. coli today.

II. Need to miniprep plates with single colonies.

III. Linearize DNA for Yeast Transformation Linearized PRM1, SAG1, YDR124W. See concentrations here: in order as written above

FRI 06 JUN 2014

I. Designed Gibson Primers and produced Promoter + rtTA ApE files.

II. Performed gel extraction of re-digested backbone. See gel photo below: in order: pHy4-1, pHy4-3, pHy4-4, positive control (2 lanes each) .

See how the band is at the right place now at around 8kb, but that there isn't really a smaller band. Possible that the smaller band ran off the gel.

Overall: Found that most of the promoters worked out in the end with cloning. Ready for yeast transformation and integration into yeast genome. Now trying to figure out next steps.

MON 09 JUN 2014

I. iGEM Bootcamp started.

II. Minipreps of Transformations from attempt 2. Vacuum manifold does not clear PE Buffer as well as centrifuges. May have ended with more than 50microliters of product. Nanodrop showed that our concentrations are okay still. We are now sending out these samples for sequencing.

TUE 10 JUN 2014

I. iGEM Bootcamp.

II. Dual Digest of miniprepped backbones to remove GFP from built vectors → will digest overnight.

III. Worked on iGEM website.

IV. Sequencing came back and found that all miniprepped vectors turned out well → moving forward with yeast transformation and Dual digest for rtTA incorporation as seen in II.

Lecture on E. Coli and Yeast by Zairan Liu from UCSF.

WED 11 JUN 2014

I. CIP treatment of backbone Lecture on Flow Cytometry by

Project introduction lecture - Kara.

Cell-cell communication lecture - Leo

Planned: II. Gibson reaction III. Transformation into Bacteria

Brainstorm: Possible human practices: bands! Playing music without a conductor! Collective structures. The role of more effective communication, or communication training in establishing structures.

Possibility of not just excreting more Alpha factor, but increasing number of receptors.

THURS 13 JUN 2014

I. No colonies on plate. Have to re-gibson and re-transform. Lots of lectures

FRI 13 JUN 2014

I. Linearization of Promoter + GFP plasmids for yeast transformation II. Yeast transformation today, transformed 11 promoters + GFP into two different yeast strains. III. Field trip to NASA today. Meet up with Brown/Stanford/Spielgal iGEM team!

Questions: What is the difference between the two yeast strains that we transformed?

MON 16 JUN 2014

I. Colony PCR of E. Coli Transformations of Promoter + rtTA (9) II. Colony PCR of Yeast Transformations of Promoter + GFP (11) III. Over 100 lanes of gels to run today! Woooooooo!

IV. Inoculated Successful Colony PCRs.

Results of E Coli Colony PCR of rtTA + promoter Colony PCR Results

TUE 17 JUN 2014

I. Redo Yeast Colony PCRs that failed yesterday. II. Miniprep of E. Coli rtTA + promoters inoculated yesterday.

CB008 genotype: W303 MATa far1Δ his3 trp1 leu2 ura3

CB008DB genotype: W303 MATa far1Δ his3 trp1 leu2 ura3 bar1

Results of Yeast Colony PCR of GFP + Promoter in CB008: Colony PCR Results

Colony PCR Results

WED 18 JUN 2014

I. Linearize promoter + rtTA and transform into Yeast II. Inoculate and incubate promoter + GFP transformed yeast. Prepare patch plate with promoters that worked. III. Lincoln: miniprep constitutive + GFP vectors and send for sequencing. IV. Overnight cultures of alpha promoters CB008

THUR 19 JUN 2014

I. Dilute inoculated cultures. (2 hours)

Flow Cytometer Preparation

Day Before: start overnight cultures of your strains to be tested in SD complete media (NOT YPD, since it has fluorescence background and is problematic for FACS testing)

Day Of: 1. Dilute overnight cultures to final ~OD 0.05-0.1 in the 96 well shaker plate (the saturated overnight cultures should be ~OD 7, so this is approximately a 1:100 dilution. Also, where are the plates? If you don't know, ask and make a note.). Again, use SD complete media and the total volume of each well should be 1 mL. Make a plate map!

Allow cells to enter growth stage by putting on plate shaker for 3 hours at 1000 rpm, 30 degrees C.

Induce with alpha factor. The stock alpha factor in the freezer is 3 mM, and we used it at final concentrations of 0, 1 nM, 10 nM, 100 nM, and 1 uM. **Please include your concentrations for making the dilutions we used to pipette so that you can quickly and easily refer to this for next time!** Alpha factor cannot be refrozen, so throw away stocks after use.

Allow induction to proceed on plate shaker for 90 min to 2 hours, no longer.

Transfer 250 uL of each culture to the 96 well flow cytometry V-bottom plate using the multichannel pipette. Add 4µl of cyclohexamide for every 100µl of cells (10µl total) to kill cells and stop protein production.

Run on flow cytometer. Things you should note:

Check waste, turn machine on, check sheathing fluid.
Open FACS diva. Use iGEM account.

Make new plate or new experiment.

Make sure settings for each well is accurate. Ensure that pick up volume is not more than volume in each well, that the mixing volume is not more than volume in each well.

Make sure laser settings, voltage settings are correct. (View>inspector)

FSC: 250 SSD: 280 FITC: 550 B: 650

Click blue button to tag selected wells as wells with samples to test.

Flow rate: 1µL/sec Sample Volume: 200µL Mixing Volume: 100µL Mixing speed: 180µL/sec

Always run wells, not run plate.

FIRST what things you need to check on the machine before running!, how to open the iGEM account and create a new FACS experiment, voltage settings (and tips on how to set an appropriate voltage setting), how to select wells and alter the volume of sample, flow speed, mixing volume, etc, how to run the plate/wells, how to export data, and anything else you might need)

Analyze data. Notes on that from what you learned in FlowJo and MatLab today.

II. Expose to alpha factor (~90 minutes) (0, 10nM, 1µM, 10µM, 100µM)

Correction 24 JUNE 2014: (0, 1nM, 10nM, 100nM, 1µM)

Flow Cytometer 1-4pm.

How to use flow cytometer: 1. Check the sheathing fluid levels! 2. Press run 3. On computer, use flowjo. 4. Check voltages! (in notebook) 5. Select wells 6. run! 7. Make sure you see a good number of events.

PRELIM Plate map:

    1   2   3   4   5   6   7   8   9   10  11  12
A   [------NEG------]       [------NEG-------]
B   [------PRM2-----]       [------PRM1------]
C   [------ASG7-----]       [------EMC18-----]
D   [------PCL2-----]       [------PRM3------]
E   [------NEG------]       [------SAG1------]
F   [------CLG1-----]
G   [------YDR124W--]
H   [------PRM6-----]

in DB008

    1   2   3   4   5   6   7   8   9   10  11  12
A   [------NEG------]       [------NEG-------]
B   [------yGEM10---]       [------yGEM14----]
C   [------yGEM4----]       [------yGEM15----]
D   [------yGEM5----]       [------yGEM16----]
E   [------NEG------]       [------yGEM6-----]
F   [------yGEM11---]
G   [------yGEM12---]
H   [------yGEM13---]

I will be working with YDR124W and PRM6.

III. Prepare glycerol stocks of DB promoter + GFP yeast strains. IV. Pick and inoculate cultures with promoter + rtTA again since most of the sequencing failed. Will need to re-linearize most of the yeast.

FRI 20 JUN 2014

I. Leaving early today for Doctor's appointment. II. Minipreps for rtTA+promoter.

MON 23 JUN 2014

I. Found that the rtTA that we cloned were incorrect. Did not including activating domain. II. Inoculating HYM1 DH5alpha + GFP again for more plasmid.

Now working on Flow Cytometry data analysis of alpha responsive promoters. Now working on pTET/GFP/mFalpha. p2A?

Vector Backbone for Gibson Digest Results

TUE 24 JUN 2014

I. Literature search on feasibility of P2A incorportation of alpha factor and other sequences. II. FlowJo notes:

Import data. Save in save folder on desktop. 
Double click to open a sample. 
Gate the sample population. 
Activate gate: gives a percentage of samples in gate. 

Click on sample list and click on gate name for analysis on just gated region. 

Save workspaces so that you can continue analysis later on.

Displaying mean: click on statistics and click ∑ for which stats that you want. 

Look through individual samples for obscurities. 

Matlab: comment with what workspace your data comes from. 

Enter in data by hand.

Analysis of Promoters+GFP in different alpha factor concentrations: GFP levels v. Promoter

Translation: Name Promoter PREs yGEM4: ASG7 2 yGEM5: PCL2 5 yGEM6: SAG1 4 yGEM10: PRM2 2 yGEM11: CLG1 2 yGEM12: YDR124W 2 yGEM13: PRM6 2 yGEM14: PRM1 2 yGEM15: ECM18 1 yGEM16: PRM3 3

Continue to learn canvas! Game brainstorming: recording how many rounds someone plays a game depending on how much on succeeds. Simulates positive feedback in gameplay. Building of circuits of games.

WED 25 JUN 2014

I. Dilution of CB008 and CB008DB for yeast transformation of pTETGFP today @ ~1pm. Need to linearize pTETGFP for transformation later today.

Given two vectors: hy86E3(pTETGFP LEU2) pTS97(pAGA1GFP URA3)

linearization @ 37°C started at 11:57am → 12:57pm
No need to PCR cleanup
Straight to transformation.

Yeast Transformation Protocol

T-(1 day) Grow yeast strains in 5-10ml YPD overnight at 30°C

T-(2–4hours) Dilute cultures ~1:20 in YPD. Grow for 2-4 hours @ 30°C to OD_600 = 0.4-0.6. Make sure to inoculate 2.5ml per transformation reaction.

T-(20 minutes) Boil salmon sperm DNA for 10 minutes and cool on ice for 10 minutes. (This can be done in the thermocycler with the ssDNA Heat-Freeze protocol) Thaw DMSO! Pellet cells (3000rpm 2-5min). Discard supernatant. Wash with 1:1 culture volume of LOATE(0.1M LiOAc in TE) or water. Pellet cells (3000rpm 2-5min). Discard supernatant. Resuspend pellet in 100µl per reaction (aka per 2.5mL of culture volume) Aliquot 100µl into each transformation reaction tube. To each tube of 100µL yeast, add:

10µL of ssDNA

8µL of target DNA(Hyun's standard amount after linearization)

480µL of 50% PEG 3350

60µL TE(10XTE)

60µL of LOA(1M LiOAc)

75µL of DMSO

Vortex! Incubate at 42°C for 30 minutes.

T+(30 minutes) Pellet (6000rpm for 2 minutes). Use pipette to remove media! Resuspend in 500µL YPD (or selective media) Pellet (6000rpm for 2 minutes). Discard media. Resuspend in residual ~50µL of YPD. Plate on selective media. Incubate for 1-3 days at 30°C.

T+(1-3 days) Pick colonies, colony PCR, or continue with experiment in some other way.

Incubation at 42°C started at 1:56pm → 2:26pm.

II. Until then, still learning more javascript and canvas.

III. Inoculate yeast strains for flow cytometry tomorrow. Do in triplicates tomorrow! Measuring the following promoters+GFPs in triplicate tomorrow (start @ 8am):

PRM2
ASG7
PCL2
CLG1

IV. Design gibson primers for constitutive promoters + rtTA

THURS 26 JUN 2014

Alpha factor: 3mM starting concentration. 30µL in them. 0, 0.5nM, 1nM, 10nM, 100nM, 1000nM, 3000nM

Make 100X stocks of each concentration and aliquot 10µL into each well.

ROUND 2 Promoter Map:

Plate 1:
    H   G   F   E   D   C   B   A   
1       [--------CB008-1--------]
2       [--------CB008-2--------]
3       [--------CB008-3--------]
4       [--------PRM2-1---------]
5       [--------PRM2-2---------]
6       [--------PRM2-3---------]
7       [--------ASG7-1---------]
8       [--------ASG7-2---------]
9       [--------ASG7-3---------]
10      [--------PCL2-1---------]
11      [--------PCL2-2---------]
12      [--------PCL2-3---------]
Plate 2: 
   H    G   F   E   D   C   B   A   
1       [--------CLG1-1---------]
2       [--------CLG1-2---------]
3       [--------CLG1-3---------]
4
5
6
7
8
9
10
11
12

AFRP GFP ROUND 2

Input into 30°C + 1000rpm shaker @ 8:14am -> 11:14am

Plate 1 & 2 Alpha Factor Concentration Map:

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-------------------{0 nM}-------------------]
B   [-------------------{0.5 nM}-----------------]
C   [-------------------{1 nM}-------------------]
D   [-------------------{10 nM}------------------]
E   [-------------------{100 nM}-----------------]
F   [-------------------{1000 nM}----------------]
G   [-------------------{3000 nM}----------------]
H

Induce with alpha factor for 90 minutes.

Make 100X stocks: 0nM 50nM 100nM 1000nM 10000nM 100000nM 300000nM

3000000nM -> 30000nM

Added alpha factor 11:45am -> 1:15pm

II. Second round of alpha factor promoter + GFP characterization. Now characterizing:

YDR124W
PRM6
PRM1
ECM18
PRM3
SAG1

[Plate maps updated in FRI Jun 27 below]~~PLATE 1 PROMOTER MAP

    H   G   F   E   D   C   B   A   
1       [--------CB008-1--------]
2       [--------CB008-2--------]
3       [--------CB008-3--------]
4       [--------YDR124W-1------]
5       [--------YDR124W-2------]
6       [--------YDR124W-3------]
7       [--------PRM6-1---------]
8       [--------PRM6-2---------]
9       [--------PRM6-3---------]
10      [--------PRM1-1---------]
11      [--------PRM1-2---------]
12      [--------PRM1-3---------]

PLATE 2 PROMOTER MAP

   H    G   F   E   D   C   B   A   
1       [--------ECM18-1--------]
2       [--------ECM18-2--------]
3       [--------ECM18-3--------]
4       [--------PRM3-1---------]
5       [--------PRM3-2---------]
6       [--------PRM3-3---------]
7       [--------SAG1-1---------]
8       [--------SAG1-2---------]
9       [--------SAG1-3---------]
10
11
12~~

PLATE 1 & 2 ALPHA FACTOR CONCENTRATION MAP: same as before

III. Dilution of FW pTEF1 + rtTA primers 1. Resuspend in 10µL * amount ng of DNA. 2. 1/10 dilution of stock made in (1)

FRI 27 JUN 2014

7:55AM: 1/100 dilutions of alpha responsive promoters + GFP for flow cytometry later today.

PRM6+GFP did not grow up yesterday. Updated Plate maps below:

ROUND 3 PLATE 1 PROMOTER MAP

    H   G   F   E   D   C   B   A   
1       [--------CB008-1--------]
2       [--------CB008-2--------]
3       [--------CB008-3--------]
4       [--------YDR124W-1------]
5       [--------YDR124W-2------]
6       [--------YDR124W-3------]
7       [--------PRM3-1---------]
8       [--------PRM3-2---------]
9       [--------PRM3-3---------]
10      [--------PRM1-1---------]
11      [--------PRM1-2---------]
12      [--------PRM1-3---------]

~~ROUND 2 PLATE 2 PROMOTER MAP [DID NOT COMPLETE]

   H    G   F   E   D   C   B   A   
1       [--------ECM18-1--------]
2       [--------ECM18-2--------]
3       [--------ECM18-3--------]
4       [--------SAG1-1---------]
5       [--------SAG1-2---------]
6       [--------SAG1-3---------]
7
8
9
10
11
12~~

8:10AM: 1/100 dilutions set in 30°C room, shaking at 1000RPM. Incubate until 11:10AM.

8:45AM: Set up and started PCR for rtTA + Constitutive Promoter_SV606 homology. End time: 9:40AM.

Need to continue on with Gel verification and PCR purification. (Jessica will include this in her gel samples.)

9:47AM

Flow Cytometer Start Up Procedure

30 minutes prior, push big green start button on right side of machine. Make sure machine is on "Stand-by."

Turn machine to "Run."

Re-initialize HTS

Prime three times

Run CST Beads

250µL sheath fluid into A1 of a 96 well plate.

Load A'1 - A'4 with Bleach and B'1-B'4 with Water. (Opposite corner: H12 = A'1).

Cytometer > CST

Make sure Cytometer Performance Results: Passed

Beads

Kept in fridge in flow cytometry room.

Make sure lot number in CST program matches lot number on box.

Shake bottle

One drop of bead bottle into A1 with sheath fluid

Load into machine and press run

Run clean plate

Click on experiment. Experiment > Open experiment.

Open clean plate "Daily Clean - 96 well U-bottom."

Be here to see how clean the machine is. Under 100 events/sec max!

If over 100 events/sec, run another clean plate!

View events on acquisition dashboard in View > Acquisition Dashboard.

Can also make a clean plate using HTS > Clean…>

11:18AM: Gel Photo of rtTA + TEF1 Homology PCR rtTA + TEF1 PCR Gel photo including other inducible promoters

11:37AM: Second round of Alpha Response Promoter + GFP characterization induced with alpha factor -> 1:07pm

1:07PM: Treated each sample with cyclohexamide. Running through FACS right now.

1:20PM: Streaked out pAGA_GFP for single colonies. Not sure why plate overgrew so much.

1:30PM: Worked on FlowJo to extract data from fcs files.

4:56PM: Finished with analysis. Created program to easily import data from FACS.

p(Alpha Responsive)+GFP under different amounts of alpha factor

MON 30 JUN 2014

Redoing FACS plate two from Friday since it was left for over two days.

ROUND 4 PROMOTER MAP

   H    G   F   E   D   C   B   A   
1       [--------ECM18-1--------]
2       [--------ECM18-2--------]
3       [--------ECM18-3--------]
4       [--------SAG1-1---------]
5       [--------SAG1-2---------]
6       [--------SAG1-3---------]
7       [--------CB008-1--------]
8       [--------CB008-2--------]
9       [--------CB008-3--------]
10
11
12

Constitutive Promoter PLATE MAP

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-CB008-]       
B   [-pTEF1-]       
C   [-m3----]       
D   [-m6----]       
E   [-m7----]       
F   [-m10---]
G   
H

Will be able to run Flow on Wednesday.

II. Streaked out for biological replicate inoculation on wednesday.

III. Analysis of Today's AFRP Plate AFRP GFP

TUE 01 JUN 2014

Meeting with Anusuya

Verse yourself in Alpha Factor Pathway. Make barebones alpha factor slide.
Make content folders for website. Collect pieces of information right now.
Characterize promoters by time exposure.
Use Hill curves to fit. Take parameters from curves for models.
What in nature uses positive feedback loops. Comparison to natural systems.

anusuyar@berkeley.edu

Analyzed data from Constitutive Promoters + GFP:

WED 02 JUN 2014

ROUND 5 PROMOTER MAP

Plate 1: 
   H    G   F   E   D   C   B   A   
1       [--------CB008-1--------]
2       [--------CB008-2--------]
3       [--------CB008-3--------]
4       [--------PRM2-1---------]
5       [--------PRM2-2---------]
6       [--------PRM2-3---------]
7       [--------ASG7-1---------]
8       [--------ASG7-2---------]
9       [--------ASG7-3---------]
10      [--------PCL2-1---------]
11      [--------PCL2-2---------]
12      [--------PCL2-3---------]

Plate 2: 
   H    G   F   E   D   C   B   A   
1
2
3
4       [--------YDR124W-1------]
5       [--------YDR124W-2------]
6       [--------YDR124W-3------]
7       [--------PRM6-1---------]
8       [--------PRM6-2---------]
9       [--------PRM6-3---------]  
10
11
12

Alpha Concentrations Flipped Today

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-------------------{3000 nM}----------------]
B   [-------------------{1000 nM}----------------]
C   [-------------------{100 nM}-----------------]
D   [-------------------{10 nM}------------------]
E   [-------------------{1 nM}-------------------]
F   [-------------------{0.5 nM}-----------------]
G   [-------------------{0 nM}-------------------]
H

For CB008-1, PRM2-1:3, CLG1-1:3, added 20µL instead of 10µL to 1mL due to low density of cultures. Possibly due to selection of very small colonies.

9:07AM - Started inoculation of 1/100 dilutions.

9:37AM - Plates shaking at 1000RPM in 30°C room.

12:37PM - Alpha Factor Exposures Start 12:57PM - Finished Alpha Factor Exposures

2:37PM - Cyclohexamide treatment

3:00PM - Flow Cytometry Plate Reading

6:00PM - Finish Plate Reading

Alpha Factor Concentration Map, same as before.

THURS 03 JUN 2014

Sick today :/ Tummy hurts

See below for repeat of AFRP GFP measurements in biological replicates.

AFRP GFP Set 1

Some questions that we still need to answer:

Why yeast instead of bacteria? Other studies have made similar circuits in bacteria before (see "Building Biological Memory by Linking Positive Feedback Loops" by Dong-Eun Chang et al.) The argument that yeast are slightly more representative of eukaryotic cells here seems far-fetched as we are not really looking at anything endogenous to yeast. Not that I think we should drop everything and start working in bacteria. We should have a solid response to this though.

SAT 05 JUL 2014

Consolidation of Flow Experiments

Prelim ASG7 PCL2 SAG1 PRM2 CLG1 YDR124W PRM6 PRM1 ECM18 PRM3

ROUND 2 PRM2 CLG1 ASG7 PCL2

ROUND 3 PRM1 PRM3 YDR124W PRM6 did not complete

ROUND 4 SAG1 ECM18

ROUND 5 PRM2 ASG7 PCL2 YDR124W PRM6

ROUND 6 PRM1 ECM18 PRM3 SAG1 AGA1 PRM2 CLG1

MON 07 JUN 2014

Alpha Concentration Map: same as before

Updated ROUND 6 Plate 2mL Growth Plate Map:

Plate 1: 
   H    G   F   E   D   C   B   A  
1       [--------CB008-1--------]
2       [--------CB008-2--------]
3       [--------CB008-3--------]
4
5
6
7
8       [--------ECM18-1--------]
9       [--------ECM18-2--------]
10      [--------ECM18-3--------]
11      
12   

Plate 2: 
   H    G   F   E   D   C   B   A   
1       [--------SAG1-1---------]
2       [--------SAG1-2---------]
3       [--------SAG1-3---------]
4       [--------AGA1-1---------]
5       [--------AGA1-2---------]
6       [--------AGA1-3---------]
7       [--------PRM2-1---------]
8       [--------PRM2-2---------]
9       [--------PRM2-3---------]
10      [--------CLG1-1---------]
11      [--------CLG1-2---------]
12      [--------CLG1-3---------]

Plate 3
  1   2   3   4   5   6   7   8   9   10  11  12
A [-CB008-]   ⨅   ⨅   ⨅   ⨅   ⨅   ⨅
B [-pTEF1-]   |  PRM1 |   |  PRM3 | 
C [-m3----]   |   |   |   |   |   |
D [-m6----]   1   2   3   1   2   3  
E [-m7----]   |   |   |   |   |   |
F [-m10---]   |   |   |   |   |   |
G             ⨆   ⨆   ⨆   ⨆   ⨆   ⨆
H

For PRM2, we added 100µL of overnight yeast due to OD600 of 0.3. All others added 10µL to 1mL of SD complete

Incubation at 30°C 1000RPM at 9:45am -> 12:45PM

Exposure to Alpha factor at 1:05PM -> 2:35PM.

ROUND 6 96 Well Reading Map

Plate 1: 
   H    G   F   E   D   C   B   A  
1       [--------CB008-1--------]
2       [--------CB008-2--------]
3       [--------CB008-3--------]
4       [--------PRM1-1---------]
5       [--------PRM1-2---------]
6       [--------PRM1-3---------]
7       [--------ECM18-1--------]
8       [--------ECM18-2--------]
9       [--------ECM18-3--------]
10      [--------PRM3-1---------]
11      [--------PRM3-2---------]
12      [--------PRM3-3---------]   

Plate 2:
   H    G   F   E   D   C   B   A   
1       [--------SAG1-1---------]
2       [--------SAG1-2---------]
3       [--------SAG1-3---------]
4       [--------AGA1-1---------]
5       [--------AGA1-2---------]
6       [--------AGA1-3---------]
7       [--------PRM2-1---------]
8       [--------PRM2-2---------]
9       [--------PRM2-3---------]
10      [--------CLG1-1---------]
11      [--------CLG1-2---------]
12      [--------CLG1-3---------]

Plate 3: 
  1   2   3   4   5   6   7   8   9   10  11  12
A [-CB008-]  
B [-pTEF1-]   
C [-m3----]   
D [-m6----] 
E [-m7----]   
F [-m10---]   
G             
H

Combined analysis of most* promoters: Combined with all Promoters *Does not include PRM6 or AGA1!

TUE 08 JUL 2014

Out sick :(

WED 09 JUL 2014

Out sick :( To do:

-Website stuff -Modeling stuff -> make graphs out of data from found functions.

THURS 10 JUL 2014

Results of Constitutive Promoters Consitutive Promoters pTEF1 ROUND 2

Results of Inducible Promoters Second set 2 of try 2

Today: Recharacterizing inducible promoters in CB008DB strains

GFP = before signal processing RFP = after signal processing

Flow with AFRP in CB008DB cells

plate 1

    H   G   F   E   D   C   B   A   
1       [--------CB008DB-1------]
2       [--------CB008DB-2------]
3       [--------CB008DB-3------]
4       [--------CLG1-1---------]
5       [--------CLG1-2---------]
6       [--------CLG1-3---------]
7       [--------PRM2-1---------]
8       [--------PRM2-2---------]
9       [--------PRM2-3---------]
10      [--------PCL2-1---------]
11      [--------PCL2-2---------]
12      [--------PCL2-3---------]

Plate 2

        H   G   F   E   D   C   B   A   
1       [--------SAG1-1------------]
2       [--------SAG1-2------------]
3       [--------SAG1-3------------]
4       [--------AGA1-1------------]
5       [--------AGA1-2------------]
6       [--------AGA1-3------------]
7       
8       
9       
10      
11      
12

Results of Inducible Promoters in DB:

FRI 11 JUL 2014

AFRP GFP DB ROUND 2

    H   G   F   E   D   C   B   A   
1       [--------CB008DB-1------]
2       [--------CB008DB-2------]
3       [--------CB008DB-3------]
4       
5       [--------PRM1-1---------]
6       [--------PRM1-2---------]
7       [--------PRM1-3---------]
8       [--------ECM18-1--------]
9       [--------ECM18-2--------]
10      [--------ECM18-3--------]
11      
12

Today:

Presentation for Wendell on Monday
Analyze Flow Data from today
Start modeling previous data

MON 14 JUL 2014

Group Meeting today.

Prep for flow cytometry tomorrow. Waiting on Colony PCR of transformants to ensure correct insertions. Will be characterizing yeast strains with pTETGFP and pTEF1rtTA under 12 different concentrations of Doxycycline.

TUE 14 JUL 2014

Flow with AFRP in CB008DB cells

    H   G   F   E   D   C   B   A   
1       [--------CB008DB-1------]
2       [--------CB008DB-2------]
3       [--------CB008DB-3------]
4       [--------ASG7-1---------]
5       [--------ASG7-2---------]
6       [--------ASG7-3---------]
7       [--------YDR124W-1------]
8       [--------YDR124W-2------]
9       [--------YDR124W-3------]
10      [--------PRM6-1---------]
11      [--------PRM6-2---------]
12      [--------PRM6-3---------]

Alpha factor concentrations same as before 9:40AM Dilution -> 12:40PM Induction with Alpha Factor

Analysis of FSC-SSC plots from 140715 show significant oddities.

Representative picture of "contamination"

Representation picture of "S-curve"

Wells with "S Curve" in SSC by FSC plot

  1   2   3   4   5   6   7   8   9   10  11  12
A X
B X
C X
D X
E X
F X            
G X
H

Wells with "Contamination" in SSC by FSC plot

  1   2   3   4   5   6   7   8   9   10  11  12
A          
B 
C 
D         X   X   X       X   X
E         X       X   X       X
F         X       X   X   X   X
G                     X   X   X   X 
H

Conclusion: will redo this set of promoters tomorrow.

WED 15 JUL 2014

[CB008 CB008DB] + pTEF1rtTA + pTETGFP

Flow plate maps today: Doxycycline concentrations:

        H   G   F   E   D   C   B   A   
1               [0 µg/ml------------]
2               [0.03 µg/ml---------]
3               [0.06 µg/ml---------]
4               [0.09 µg/ml---------]
5               [0.3 µg/ml----------]
6               [0.6 µg/ml----------]
7               [0.9 µg/ml----------]
8               [3.0 µg/ml----------]
9               [6.0 µg/ml----------]
10              [9.0 µg/ml----------]
11              [30 µg/ml-----------]
12              [60 µg/ml-----------]

pTEF1 promoters

  1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008]----------------------]  
B [---------------[CB008 pTET_GFP]-------------]
C [---------------[CB008 pTET_GFP pTEF1_rtTA]--]  
D [---------------[CB008 pTET_GFP pTEF1 m6]----]     
E [---------------[CB008 pTET_GFP pTEF1 m7]----]    
F [---------------[CB008 pTET_GFP pTEF1 m10]---]  
G
H

  1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008DB]--------------------]  
B [---------------[CB008DB pTET_GFP]-----------]  
C [---------------[CB008DB pTET_GFP pTEF1 1of2 ] 
D [---------------[CB008DB pTET_GFP pTEF1 2of2 ]
E [---------------[CB008DB pTET_GFP pTEF1 m6]--] 
F [---------------[CB008DB pTET_GFP pTEF1 m7]--]             
G 
H

1/100 dilution of cultures started at 7:25AM -> 10:25AM

Dilutions

Stock: 100mg/mL 
**1x**           **100x**         **Ratios**      **Prep**
60µg/mL       A: 6mg/mL           06% S       60µL of Stock in 940µL of water
30µg/mL       B: 3mg/mL           03% S       30µL of Stock in 970µL of water  
9µg/mL        C: 900µg/mL         15% A       150µL of A in 850µL of water  
6µg/mL        D: 600µg/mL         10% A       100µL of A in 900µL of water
3µg/mL        E: 300µg/mL         10% B       100µL of B in 900µL of water
0.9µg/mL      F: 90µg/mL          10% C       100µL of C in 900µL of water
0.6µg/mL      G: 60µg/mL          10% D       100µL of D in 900µL of water
0.3µg/mL      H: 30µg/mL          10% E       100µL of E in 900µL of water
0.09µg/mL     I: 9µg/mL           10% F       100µL of F in 900µL of water
0.06µg/mL     J: 6µg/mL           10% G       100µL of G in 900µL of water
0.03µg/mL     K: 3µg/mL           10% H       100µL of H in 900µL of water
0             N/A                 N/A         N/A

Induction with Doxy at 11:16AM -> 5:16PM

THURS 17 JUL 2014

TODO:

[X] Working on generating noise graphs for Hyun
- [X] Need to ensure that all the data is correct and current. Will need to redownload all files. Ugh.
- [X] Need to decide if I should first divide SD by Mean GFP then average triplicates or first average SD and Mean GFP triplicates and then divide.
- [X] Need to also understand if we are using Geometric or Arithmetic Means
[X] Generate pTEFrtTA + pTETGFP v. Doxy graphs.
- [X] Confirm which plate is which strain

Meeting with Anasuya

[ ] Understanding background
- [ ] Focus on how T-reg cells interact with macrophages. Macrophages can play a suppressive role on T-regs.
  - [ ] Dendritic cells and T-reg cells as an example of a divergent system.
  - [ ] Stanford iGEM 2010: interaction between t-reg and t-helper cells.
  - [ ] How microglia interact with different cell types: might play a role in regulating T-helper cells.
- [ ] Non-immune standpoint
  - [ ] Examples of how cells respond and coordinate using secondary post-cellular signaling.
  - [ ] OVERALL GOAL: Understand how your work can help elucidate and understand other cell/organism interactions through community signaling
[ ] Model
[ ] Website
- [ ] Generate content for website.

FRI 18 JUL 2014

[ ] Model for pTEFrtTA pTETGFP pTETmFα ARFPmFα circuit
- [ ] Functions
  - [ ] Develop function to model pTEFrtTA -> pTETGFP/pTET_mFα.
    - [ ] Need to understand how [Doxycycline] alters [α]. Does [GFP] correlate directly with [α]?
  - [X] Develop function to model AFRP_RFP
  - [ ] Develop function for Diffusion of Alpha factor as as F(Initial Alpha Factor Concentration, Time, Distance)
- [X] Data for Model
  - [X] Export all sigmoid fits

Conclusions from today: To understand Alpha Factor Secretion, need to understand how [Doxy] -> pTEF1rtTA -> pTETGFP results translate to [Doxy] -> pTEF1rtTA -> pTETmFα -> [α]. Need this circuit: ([Doxy] -> pTEF1rtTA -> pTETmFα -> [α]) + (pAGA1RFP -> [RFP]) and then use ([α] -> pAGA1GFP -> [GFP]) measurements to understand the local concentrations of Alpha Factor from each cell.

Need to construct: ([Doxy] -> pTEF1rtTA -> pTETGFP + pTETMFα -> pAGA1RFP -> [RFP])

Questions for Hyun:

How does one find the phenomological alpha factor secretion from the data that we currently have: [Doxy] -> (pTEF1rtTA + pTETGFP) -> [GFP] and [α] -> (AFRP_GFP) -> [GFP].
- Even though there seems to be a one-to-one correlation between [GFP] and [α], leading us to an understanding of local [α], what does that say about [rtTA-Dox] -> pTET_GFP production of GFP, and eventually [α]?

SAT 19 JUL 2014

See checklist in ##FRI 18 JUL 2014.

MON 21 JUL 2014

Working on Group Presentation. Made graphics for yeast modeling.

Working on two cell models.

TUES 22 JUL 2014

100x dilutions done at 9:20am 9:20am -> 12:20pm

Plate 1:

    H           G   F   E   D   C   B   A   
1   [pTEF1-1]   [--------CB008DB-1------]
2   [pTEF1-2]   [--------CB008DB-2------]
3   [pTEF1-3]   [--------CB008DB-3------]
4   [M7-1]      [--------ASG7-1---------]
5   [M7-2]      [--------ASG7-2---------]
6   [M7-3]      [--------ASG7-3---------]
7               [--------YDR124W-1------]
8               [--------YDR124W-2------]
9               [--------YDR124W-3------]
10              [--------PRM6-1---------]
11              [--------PRM6-2---------]
12              [--------PRM6-3---------]

Plate 2:

    H   G   F   E   D   C   B   A   
1       [--------AGA1-1---------]
2       [--------AGA1-2---------]
3       [--------AGA1-3---------]
4       [--------CLG1-1---------] did not grow as much as the others
5       [--------CLG1-2---------] 20ul instead of 10ul for CLG1
6       [--------CLG1-3---------]
7       [--------PRM2-1---------]
8       [--------PRM2-2---------]
9       [--------PRM2-3---------]
10  [--------PCL2-1---------]
11      [--------PCL2-2---------]
12      [--------PCL2-3---------]

Plate 3:

    H    G   F   E   D   C   B   A   
1        [--------ECM18-1--------]
2        [--------ECM18-2--------]
3        [--------ECM18-3--------]
4        [--------SAG1-1---------]
5        [--------SAG1-2---------]
6        [--------SAG1-3---------]
7        
8        PRM3 MIA
9        
10       [--------PRM1-1---------]
11       [--------PRM1-2---------]
12       [--------PRM1-3---------]

WED 23 JUL 2014

Reading up on Stochastic Modeling of our genetic circuits

Illustrations and style design of website and poster materials

TODO:

[ ] Make signs by Friday for Exploratorium Exhibition
[ ] Make pPCL2BFP and pAGA1BFP
- [X] Transform BFP to make more of it. Grow up, miniprep. (Will be transforming two more backbones with antibiotic resistance)
- [X] Digest BFP using Xho1 and Not1
- [X] Digest pAGA1RFP and pPCL2RFP with Xho1 and Not1.
- [ ] Ligate BFP with pAGA1backbone and pPCL2backbone.

THUR 24 JUL 2014

See todo list in 23 JUL 2014

E. Coli Transformation Protocol

Materials DNA 1µL DH5α 50µL

Add DNA and DH5α.
Let sit on ice for 10 mins if whole plasmid/30 min if ligation reaction

Heat shock @ 42°C for 45 seconds

Add 250µL of SOC.

Incubate at 37°C for 1 hour (shaking)

Plate on appropriate plate.

Total Time: 80-100 minutes

Incubated at 10:30AM -> 11:30PM

FRI 25 JUL 2014

Pick colonies for miniprep on Monday -> refrigerated and then set to grow on Sunday. Minipreps today.

Developed design guide for website and other materials

Using 4µL of pAGA1_RFP on Monday

Set up Balsamiq for the team. Designing flyers for Exploratorium event.

MON 28 JUL 2014

Miniprep transformations of BFP and shuttle vectors. - Jeffrey

Prepare for presentation today.

Digest pTS94(BFP), pGEM22(pAGA1+mCherry), and (pPCL2+mCherry)x2 with Xho1 and Not1 double overnight digest @ 37°C overnight.

TUES 29 JUL 2014

Gel Extract Digestions from Yesterday. BFP Length: 696 Basepairs.

[CB008DB] + pTEF1rtTA + pTETGFP

Flow plate maps today: Doxycycline concentrations:

        H   G   F   E   D   C   B   A   
1           [----0 µg/ml------------]
2           [----0.03 µg/ml---------]
3           [----0.06 µg/ml---------]
4           [----0.09 µg/ml---------]
5           [----0.3 µg/ml----------]
6           [----0.6 µg/ml----------]
7           [----0.9 µg/ml----------]
8           [----3.0 µg/ml----------]
9           [----6.0 µg/ml----------]
10          [----9.0 µg/ml----------]
11          [----30 µg/ml-----------]
12          [----60 µg/ml-----------]

pTEF1 promoters

  1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008DB]--------------------]  
B [---------------[CB008DB pTET_GFP]-----------]  
C [---------------[CB008DB pTET_GFP pTEF1]-----] 
D [---------------[CB008DB pTET_GFP pTEF1 m3]--]
E [---------------[CB008DB pTET_GFP pTEF1 m6]--] 
F [---------------[CB008DB pTET_GFP pTEF1 m7]--]             
G [---------------[CB008DB pTET_GFP pTEF1 m10]-]
H

x3 plates

100X Dilution started at 7:16AM -> 10:16AM

10:50AM Dox Dose. Plate 1 concentrations backwards. Plate 3 lane 10 had double exposure of two different concentrations.

Gel Extractions of Digestions

Lanes: 
1: 1kb Ladder
2: BFP Digestion
3: BFp Digestion
4: pAGA1 mCherry Digestion
5: pAGA1 mCherry Digestion
6: pPCL2 mCherry Digestion 
7: pPCL2 mCherry Digestion

Gel photo of digestions Digestion smeared.

New strategy: PCR BFP

Ligate with Backbone(pHY130E), and PCL2 and AGA1.

Today, Digest pAGA1 from pTS108 with APA1 (11:35AM-1:35PM) and Xho1 (1:35PM -> 2:35PM) and gel extract (2:35PM -?> 4PM)

Digestion of pAGA1 from pAGA1-SAG1 (pTS108) failed, showing very faint bands and smearing. Will try with new ddH20.

Will now also PCR pAGA1.

WED 30 JUL 2014

Could not run flow cytometry today because no cells grew.

  1   2   3   4   5   6   7   8   9   10  11  12
A [---------------[CB008]----------------------]  
B [---------------[CB008 pTET_GFP]-------------]
C [---------------[CB008 pTET_GFP pTEF1_rtTA]--]  
D [---------------[CB008 pTET_GFP pTEF1 m3]----]     
E [---------------[CB008 pTET_GFP pTEF1 m6]----]    
F [---------------[CB008 pTET_GFP pTEF1 m7]----]  
G [---------------[CB008 pTET_GFP pTEF1 m10]---] 
H

PCR'd pAGA1 and BFP overnight.

Thanks to Jeffrey for his assistance today while I'm out sick:

[X] PCR Clean Up
[X] Digests
- [X] BFP using Xho1 Not1 double digest for 3 hours w/ cutsmart @ 37°C
- [X] pAGA1 using Apa1 w/ cutsmart for 2 hours @ room temp
- [X] pAGA1 using Xho1 w/ cutsmart for 1 hour @ 37°C
[X] Ligations (Overnight)
- [X] Ligate: Hy130E - pAGA1 - BFP (Hy130E in my box! should already be digested!)
- [X] Ligate: Hy130E - pPCL2 - BFP (pPCL2 should also be in my box, already digested!)

THURS 31 JUL 2014

Out sick: Jeffery altruistically offered to help.

FRI 01 AUG 2014

Transformed Ligations from yesterday. Now working on website.

Finished landing page with petri dish now. Will now work on Team and Protocols pages.

Incorporate iGEM logo into top right corner.

Website Map

Home
Project
- Background
- Achievements
- Implications
- Parts
- Safety
Models
Human Practices
- Collaborations
- ALHS
- Super Science!
Notebooks & Protocols
- Notebooks
- Protocols
Team
- Attributions
- Advisors
- Mentors
- Students
- Contact
- iGEM Profile

MON 04 AUG 2014

Worked on website. Picked colonies for miniprep tomorrow. Should have performed a e. coli colony PCR.

Colony PCR for screening E. Coli

Pick single colonies ( 5 or so from each plate ) mix in 25 µl H2O in a tube. Use 5 µl in PCR reaction

Reagents 1X 6X

2X GoTaq Green PCR Master Mix 10 µl 60 µl

10 µM Forward primer 1 µl 6 µl

10 µM Reverse primer 1 µl 6 µl

Water 3 µl 18 µl

Bacterial cells (template) 5 µl -----

Cycle (Varies):

95° C | 5m
  30x:
      95° C | 45s
       55° C | 30s
       72° C | 1m per kb
72° C | 10m 4° C | Forever

load 5 µl onto gel

for all positive bands - take the rest of the bands and inoculate them into an overnight LB (+antibiotic) for miniprep

Started at 10:18AM -> 12:35PM

TUES 05 AUG 2014

Colony PCR of pPCL2BFP and pAGA1BFP

Found bright bands for pAGA1, but unfortunately not for pPCL2 Miniprep'd pAGA1 in lanes 5 and 6.

Picked new colonies from pPCL2 plate and ran colony PCR. pPCL2 colony pcr results

WED 06 AUG 2014

Working on Poster for Santa Cruz today. Found mixed peaks in sequencing reaction. Otherwise, sequences were correct. Will transform minipreps and re-miniprep. Miniprep pPCL2 today.

THURS 07 AUG 2014

Sequences from pPCL2 BFP worked out very well. Colonies grew on pAGA1BFP plate and not on negative control. Will miniprep pAGA1BFP tomorrow.

FRI 08 AUG 2014

1:200 dilution at 7:45AM.

[Dox] dose response of pTEF1rtTA pTETGFP pTETMFalpha pAGA1mCherry

  1   2   3   4   5   6   7   8   9   10  11  12
A [CB008 m6-1]----]       [CB008 m10-3]----]
B [CB008 m6-2]----]       [CB008DB m7-1]---]
C [CB008 m6-3]----]       [CB008DB m7-2]---]
D [CB008 m7-1]----]       [CB008DB m7-3]---]
E [CB008 m7-2]----] 
F [CB008 m7-3]----]           
G [CB008 m10-1]---] 
H [CB008 m10-2]---]

[Dox] Map:

        H   G   F   E   D   C   B   A   
1           [----0 µg/ml------------]
2           [----0.03 µg/ml---------]
3           [----0.06 µg/ml---------]
4           [----0.09 µg/ml---------]
5           [----0.6 µg/ml----------]
6 
7                      [--0 µg/ml---]
8                      [--0.03 µg/ml]
9                      [--0.06 µg/ml]
10                     [--0.09 µg/ml]
11                     [--0.6 µg/ml-]
12

MON 11 AUG 2014

1:200 dilution of 4 different strains into 4 96 well plates.

Need to prepare presentation for group meeting tomorrow.

Dilution of cultures at 7:30AM.

4 different promoters in front of rtTA: pHYM1, pYDR124W, pCLG1, pASG7

Dox

        H   G   F   E   D   C   B   A   
1           [----0 µg/ml------------]
2           [----0.03 µg/ml---------]
3           [----0.06 µg/ml---------]
4           [----0.09 µg/ml---------]
5           [----0.3 µg/ml----------]
6           [----0.6 µg/ml----------]
7           [----0.9 µg/ml----------]
8           [----3.0 µg/ml----------]
9           [----6.0 µg/ml----------]
10          [----9.0 µg/ml----------]
11          [----30 µg/ml-----------]
12          [----60 µg/ml-----------]

Alpha Factor Concentration Map

    1   2   3   4   5   6   7   8   9   10  11  12
A   [-------------------{0 nM}-------------------]
B   [-------------------{0.5 nM}-----------------]
C   [-------------------{1 nM}-------------------]
D   [-------------------{10 nM}------------------]
E   [-------------------{100 nM}-----------------]
F   [-------------------{1000 nM}----------------]
G   [-------------------{3000 nM}----------------]
H

Single cell scatter.

Correlation Coefficient between GFP and RFP.

CV (noise) for all strains.

TUES 12 AUG 2014

Rest of the AFRPrtTA pTETGFP

Set in induction at 8:11AM.

Notes about pTEF1rtTA pTETGFP pTETMFa pAGA1RFP data from Friday:

GFP Noise: Very consistent pattern across almost all strains(mutations of pTEF1). High [Doxycycline] induces noise to decrease over time, while lower doxycycline concentrations maintain similar noise levels over time, and some even increase.

WEDS 13 AUG 2014

Pick colonies for Jeffrey. Rest of pTEF1rtTA pTETGFP pTETMFa pAGA1mCherry

1:200 dilution at 7:50AM.

[Dox] dose response of pTEF1rtTA pTETGFP pTETMFalpha pAGA1mCherry

  1   2   3   4   5   6   7   8   9   10  11  12
A [CB008 pTEF1-1]-]       [CB008DB m3-3]--] 
B [CB008 pTEF1-2]-]       [CB008DB m6-1]---]
C [CB008 pTEF1-3]-]       [CB008DB m6-2]---]
D [CB008DB pTEF1-1]       [CB008DB m6-3]---]
E [CB008DB pTEF1-2]  
F [CB008DB pTEF1-3]           
G [CB008DB m3-1]--] 
H [CB008DB m3-2]--]

THURS 14 AUG 2014

1:200 Dilution at 7:52AM

[Dox] dose response of pTEF1rtTA pTETGFP pTETMFalpha pAGA1mCherry

  1   2   3   4   5   6   7   8   9   10  11  12
A [CB008 pTEF1-1]-]       [CB008 m7-3]-----] 
B [CB008 pTEF1-2]-]       [CB008 m10-1]----]
C [CB008 pTEF1-3]-]       [CB008 m10-2]----]
D [CB008 m6-1]----]       [CB008 m10-3]----]
E [CB008 m6-2]----]  
F [CB008 m6-3]----]          
G [CB008 m7-1]----] 
H [CB008 m7-2]----]

Plate failed due to large amounts of contamination. Flow FSC/SSC plots showed large amounts of contamination.

FRI 15 AUG 2014

UCSC Meetup!

MON 18 AUG 2014

Moving!

TUES 19 AUG 2014

Moving!

WED 20 AUG 2014

Back at it! Taught people how to generate graphs from flow data. Also taught people how to generate scatter plots from flow data. Produced graphs for flow data from many days ago.

Decided to not continue with pECM18 and pPRM6 as they did not seem to express more than basal level.

THURS 21 AUG 2014

Attempted to use R for further data analysis. Importing data into R may be too complicated and time-consuming.

FRI 22 AUG 2014

Seems like all DB strains have RFP expression without induction with Doxy. Most likely due to leakiness in Tet-On circuit.

Decided to not analyze data from Tuesday and will be running experiments again on Monday.

Downloaded and install flowjo on my computer for easier remote work.

George's Lab Notebook

6/9/14

PCR for Constitutive Promoters (m10)

Materials	1x reaction	4.5x Master Mix
x Phusion HF Buffer	10 µl	45 µl
dNTP's (10 mM)	1 µl	4.5 µl
Forward Primer (10µm)	2.5 µl	11.25 µl
Reverse Primer (10µm)	2.5 µl	11.25 µl
*Template DNA (m10)	0.3 µl	1.35 µl
Phusion Polymerase	0.5 µl	2.25 µl
Water	33.2 µl	149.4 µl

Total	50 µl	225 µl

1. Mix materials in a 4.5x Master Mix on ice. Mix well.
2. Pipetter 50 µl from the Master Mix into 4 labeled PCR tubes
3. Thermocycler for : 

    Initial Duration   | 98° C | 30s 
      35 Cycles of: 
          Denaturation | 98° C | 10s
          Annealing    | 55° C | 20s
          Extension    | 72° C | 30s
    Final Extension    | 72° C | 5m
    Hold               | 4°  C | Forever

Possible Errors:
Incomplete thawing of dNTPs, not well mixed

Working Stock of Reverse and Forward Primers for pTEF1 kept in my freezer box. 6/9/14

6/10/14

Gel loading of pTEF1 in Gel

Loading order: 15Wells 100bp ladder|Eleanorx4|Robertx4|Sabrinax4|100bp ladder

20wells 100bp ladder|Jeffreyx5|skip|Georgex2|100bp ladder

*m10 only had two wells loaded because a centrifuge spin burst onpen my caps and 2 flew out. Luckily one was unharmed and I was able to load two samples in.

Gel Extraction

Cut DNA band from PCR of constitutive promoter gel
Weigh gel: .280g
QG Buffer: 840ul
    *QG buffer amount is 3:1 of gel weight

1. Mix gel slice with QG Buffer in 50C heat bath for 10 min.
2. Add 1 ml isopropanol. Mix.
3. Add 750 ul of mixture into purple Qiagen spin column. Spin for 30 sec. Discard liquid.  Repeat.
4. Add 750 ul of Buffer PE and spin for 1 min. Discard waste.
5. Dry spin the column for 1 min. Replace the spin column in a new microcentrifuge tube
6. Elute in 50 of ddH2O. Wait 1 min and then spin for 1 min.
7.Keep the runthrough and discard the column

Restriction Digest with ApaI

40 ul of DNA (m10 gel extraction)
5 ul of 10x CutSmart Buffer
.5 ul of ApaI Enzyme

*digest overnight at room temperature*

6/11/14

Restriction Digest with XhoI

Add .5 ul of XhoI enzyme to ApaI digestion from 6/10/14
Incubate in the 37°C shaker.

PCR Purification

1. Add 250 ul of Buffer PB to digestion.
2. Place sample in a purple QIAquick spin column. Spin for 1 min. Discard waste.
3. Wash with 750 ul of Buffer PE. Spin for 1 min. Discard waste.
4. Dry spin for 1 min. Replace spin column in a new microcentrifuge tube.
5. 6. Elute in 50 ul of ddH2O (add directly into the column film). Wait 1 min and then spin for 1 min.

Total concentration: 40.28ul

DNA Ligation

Materials	Volume
10x Ligase Buffer	1 ul
DNA Backbone PSV606	.2 ul
DNA Insert (PCR Purication)	.2 ul
T4 DNA Ligase	.5 ul
H2O	8.1 ul

Total                       | 10 ul
----------------------------------------------------
Mix reagents and incubate at room temperature for 2 hrs

Ligation of pTEF1 into PSV606 kept in my freezer box. 6/11/14

Transformation

10 ul of ligation
50 ul of E. Coli competent cells

30 min    | ice
45 sec    | 42°C heat shock
2 min     | ice

Add 250 ul of SOC media. Incubate at 37°C for 1 hr.
Plate on LB+Carb. 

Only 2 colonies formed on plate

6/12/14

Redo Transformation

Follow procedure from 6/11/14 with minor alterations.
1. Use .4 ul of ligation instead of .2 ul.
2. Use more competant cells.
    *REMEMBER NEGATIVE CONTROL GUYS

6/13/14

Transforming α-inducible promoters

Transforming 11 different inducible promoters into CB008 and CB008DB strains of yeast.

1. Boil salmon sperm DNA (ssDNA) for 10 min.-->10 ul of 10 mg/ml stock per transformation
2. Cool ssdna on ice for at least 10 minutes
3. Pellet yeast cultures in centrifuge. (3000 rpm for 2-5 min.)
4. Resuspend with 1ml .1M LiOAc in TE.
5. Pellet cells (3000 rpm for 2-5 min.)
6. Resuspend in 100 ul .1M LiOAc in TE per 2.5 ml culture. 
7. Aliquot 100 ul into each microcentrifuge per transformation. (22 tubes)
Per Tube:
8. Add 100 ug ssDNA, 1 ug of target DNA (1~5 ul)

ADD IN ORDER
9. 480 ul 50% PEG 3350
10. 60 ul 10x TE
11. 60 ul 1 M LiOAc
12. 75 ul DMSO

13. Vortex
14. Incubate at 42°C for 30 min. 
15. Pellet cells (6000 rpm for 2 min)
16. Resuspend with 500 ul YPD.
17. Pellet cells.
18. Resuspend with 50 ul  YPD
19. Plate on SDS-Ura. 

Incubate 2 days at 30°C.

6/16/14

Colony PCR for Screening E. coli

1. Pick a single colony using a sterile wooden stick and mix in 25ul of water in a PCR tube. Do this for about 4-6 colonies. Use 5ul for the PCR reaction below, adn save the rest for later.

2. Set up PCR reaction as below:
                                            1x Reaction      6x master mix
                                        ----------------------------------
2X Go Taq Green PCR Master Mix                  10ul               60ul
10 uM FW primer                                  1ul                6ul
10uM RV primer                                   1ul                6ul
Water                                            3ul               18ul 
Bacterial cells (template)                       5ul                --      


Cycles:
            95                      5 min
            30X:    95              45 s
                    55              30 s
                    72              1 min per kb (adjust accordingly)
            72                      10 min

3. Analyze products on a 1% agarose gel. The GoTaq mix alread has gel loading dye in it, so you can just directly load 5ul of your PCR readction into a gel.

4. For all positive bands on the gel, take the rest of the bacterial cells from step 1 and inoculate them into and overnight LB (+antibiotic) for miniprep the next day.

E. coli Colony PCR results

*refer to gel photo on 6/13/14 in George's Lab notebook-> Gel Photos -> 6-13-14 E. Coli Colony PCR

**Additional Notes: I was m10 so I occupied lanes 11-15 on row 2 and all the results looked quite bomb.

6/16/14

Sequencing

All sucessful sequences (all of them)

Colony PCR for Yeast + Patching

1. Label the patch plate with the strain and promoter along with the colony number picked. 
2. Pick 3 big isolated colonies and patch with a stick to the patch plate.
3. # the colonies that you picked on the plate.
4. Fill PCR tubes with 10ul of NaOH
5. Stick the rest of the yeast on the stick into the PCR tubes
6. Boil for 10 mins@ 95
7. PCR TIME
8. Set up reactions as followed:

1x Reaction      7x Master Mix
                                        ---------------------------------
    2X Go Taq Green PCR Master Mix              10ul               70ul
    10 uM FW primer                              1ul                7ul
    10uM RV primer                               1ul                7ul
    Water                                        5ul               35ul 
    ----------------------------------------------------------------------
    Boiled Yeast cells (template)                3ul          

9. Set up Thermocycler for:
    95°C       | 5 min
    30x |95°C   | 45 sec
        |50°C   | 30 sec
        |72°C   | 1 min per kb
    72°C       | 10 min
    4°C            | hold

Running a gel for AFRPs

1st gel 
1st row
20wells

1       2       3       4       5       6       7       8       9       10      11      12      13      14      15      16      17      18      19      20
100bb          SAG1                   ECM18                    PRM3                     HYM1                  ASG7                    CLO7            PRM1                                              
ladder  1       2       3       1       2       3       1       2       3       1       2       3       1       2       3       1       2       3       1


2nd row
15 wells
I give up

Refer to the gel photo in George's noteboot -> Gel photos->6-16-14 AFRPS stuffs i'll update when i find the picture.

6/18/14

Colony Dilutions

20x dilutions to all CB008 and CB008DB alpha-promoter yeast.

*Note: CB008DB PRM1-2 sticker was labled on top of CB008 SAG1-3 and could've resulted in a sticker coming off at night.

Glycerol stocks

1:20 Dillution
200ul cells + 9.8ml YPD media.
FREEZE

6/19/14

Flow Cytometry

1. Start overnight cultures of our strains to be tested om SD complete media instead of YPD (YPD has fluorescence).
2. Dilute overnight cultures to OD 0.05-0.1 in the 96-well shakeplate.  The plates are in a cabinet in the limlab wrapped in shiny paper. USe SD complete media and the total volume of the well should be 1mL. Make a plate map now.
3. Allow cells to enter growth phase by putting wells in plate shakers for 3 hours at 1000rpm@30 degrees.
4. Allow induction with alpha factor. The stock alpha factor is 3mM and we used 0, 1, 10, 100, 1000nM. (Stocks cannot be refrozen, discard after use)
5. Allow cells to enter growth stage by putting on plate for 90-120 minutes, no more.96 
6. Transfer 20ul of each culture to the 96 well flow-cytometry v-bottom plate. Use cycloheximide to arrest cells. Cycloheximide suspends cell division.
7. Run on Flow Cytometer
    1. Check liquid box for sufficient amount of liquid, if too low, scream for help.
    2. Check the second tub for liquid with clear top. It should also have some liquid, don;t shake too harshly
    3. Check the gasoline tank, if kinda full dump out and add some bleach to the bottom of the container.
    4. You can open the iGEM 2014 path and the default settings will be default, but check it anyway to be sure.
    5. For each new experiment, load 2 neg control wells and run those first as a blank.

(Voltage settings: FSC:250, SSC:280, FTC:550

Select wells by double-clicking until it is green and you can just add more. The volume can be modified, but 200ul is suggested (decrease by 50ul from our load)

Flow speed is usually kept at either 0.5ul per second or 1ul/second and can be adjusted relatively quickly. VOlume can be less than our sample volume.

Data is exported by usb, no internet is allowed.)

8. Analyze data (graphs: histogram vs FTC,FSC vs SSC) Flowjo note on page 17 and export to matlab yo.

96 well plates

Select a Protocol

Miniprep

Resuspend pelleted bacterial cells in 250 µl Buffer PI and transfer to a microcentrifuge tube.
Add 250 µl Buffer P2 and gently invert tube 4-6 times to mix
Add 350 µl Buffer N3 and invert immediately 4-6 times
Centrifuge for 10 min at 13,000 rpm
Add supernatant to QIAprep spin column
Centrifuge for 30-60s - Discard flow through
Wash QIAprep spin column by adding 0.5 ml Buffer PB and centrifuging for 30-60s - Discard flow through
Wash column by adding 0.75 ml Buffer PE and centrifuginh for 30-60s
Discard flow through and centrifuge for an additional 1 min to remove residual wash buffer
Place column in clean 1.5 ml microcentrifuge tube. To elute DNA add 50 µl water or buffer EB, let stand for 1 min and centrifuge for 1 min.

PCR Purification

5 volumes of Buffer PB (with ethanol) to 1 volume PCR sample
Apply sample to column and spin for 1 min
Discard flow through
To wash add 0.75 ml of Buffer PE to column and centrifuge for 1 min
Discard flow through and place column back in the same tube
Cetrifuge for an addtitional minute (Dry Spin)
Place column in clean 1.5 ml tube
[Elute DNA] Add 30µl water to column, let stand for 1 min and centrifuge for 1 min

Gel Extraction

QlAquick Gel Extraction Kit

Cut Gel
Weigh it in a colorless tube
Add 3 volumes Buffer Q G to 1 volime Gel (100mg ~ 100µl)
Incubate @ 50° C for 10 min or until completely dissolved (vortex every 2-3 min to help dissolve)
Add 1 gel volume isopropanal to the sample and mix
Place a QlAquick soin column in a provided 2ml collection tube
Place sample in column & spin for 1 min --> discard flow through
To wash add 0.75 ml Buffer PE to column & centrifue for 1 min, then dry spin
Place column in 1.5 ml tube
Add 35µl H2O & centrifuge for 1 min.

E. Coli Transformation (Digestion/Ligation)

 
- 10 µl ligation
- 50 µl competent cells
--> 30m on ice
--> 45s heatshock 42° C
--> 2m on ice
- 250 µl of SOC media
--> 1h shake 37° C

Yeast Transformation

Reagents
YPD
1 M LiOAc
10X TE pH 7.5
1X TE pH 7.5, 0.1 M LiOAc
50% PEG 3350
DMSO
Salmon Sperm DNA (ssDNA)

PEG = viscous, pipette slow
boil ssDNA aliquots

Previous Day : Grow yeast strain to be transformed in 5-10 mL YPD overnight at 30° C

Set up digest to linearize DNA
Dilute O/N culture ~ 1:20 in YPD grow 2-4 hours at 30° C
Prepare ssDNA - boil for 10m cool on ice for at least 10m (10 µl of 10 mg/mL stock per transformation)
Harvest cells in centrifuge - 3000 rpm, 2-5 min
Wash with 1 ml 0.1 M LiOAin TE
Pellet cells - 3000 rpm , 2-5 min
Resuspend pellet in 100 µl 0.1 M LiOAc in TE per 2.5 ml culture, split into 100 µl per epindorph tube for each transformation
to 100 µl cells add 100 µg ssDNA (10 µl of 10 mg/mL sock), 1-5 µl target DNA
Add (in order): 480 µl 50% PEG 3350, 60 µl 10X TE, 60 µl 1 M LiOAc (for final 40% PEG, 1X TE, 0.1 M LiOAc) Optional: Add 75 µl DMSO definitely did
Vortex
Incubate 42° C for 30m & begin drying plates
Pellet (6000 rpm - 2m), discard supernatant (remove PEG completely by pipetting), resuspend in 500 µl YPD (or selective media)
Pellet, discard supernatant, resuspend in risidual ~ 50 µl YPD
Plate on selective media
Incubate 1-3 days

Colony PCR for screening E. Coli

Pick single colonies ( 5 or so from each plate ) mix in 25 µl H2O in a tube. Use 5 µl in PCR reaction

Reagents	1X	6X
2X GoTaq Green PCR Master Mix	10 µl	60 µl
10 µM Forward primer	1 µl	6 µl
10 µM Reverse primer	1 µl	6 µl
Water	3 µl	18 µl
Bacterial cells (template)	5 µl	-----

Cycle (Varies):

95° C | 5m

   30x:
        95° C | 45s
        55° C | 30s
        72° C | 1m per kb

72° C | 10m 
 4° C | Forever

load 5 µl onto gel

for all positive bands - take the rest of the bands and inoculate them into an overnight LB (+antibiotic) for miniprep

Colony PCR for Yeast & Patching

Number colonies
Patch on plate
Mix in 10 µl NaOH
Boil for 20m
PCR

Cycle (varies):


95° C | 5m
30x:
        95° C | 45s
        55° C | 30s
        72° C | 1m per kb

72° C | 10m 
 4° C | Forever

Frozen Glycerol Stocks Yeast

Grow Overnight in YPD (2-5 mL) then dilute 1:20 in YPD, grow to OD 0.4-0.5
Add 350 µl cells to 350 µl sterile 60% glycerol in cryovial, vortex to mix, snap freeze in liquid nitrogen and store at -80° C (but actually we just stuck it in the freezer because nobody will let us use liquid nitrogen).

@@ Line 1: / Line 1: @@
 {{:Team:UCSF_UCB/CSS}}
 {{:Team:UCSF_UCB/font}}
 <html>
+<body>
+<script src="http://ajax.googleapis.com/ajax/libs/jquery/1.11.1/jquery.min.js"></script>
 <svg height = "0px" width = "0px">
 <defs>
@@ Line 89: / Line 92: @@
                      <ul>
                          <li class = "project"><a href="./project.html">Project</a></li>
-                         <li class = "models"><a href= "./models.html">Models</a></li>
+                         <li class = "judging"><a href= "./judging.html">Judging</a></li>
                          <li class = "hp" ><a href="./hp.html">Human Practices</a></li>
                          <li class = "notebooks"><a class = "on-page" href="./notebooks.html">Notebooks & Protocols</a></li>
@@ Line 176: / Line 179: @@
                  </article>
                      <article id = "h-shuaixin">
-                    		</html>
+                    		<p>ShuaiXin's Lab Notebook is unfortunately not available in digital form. </p>
-                    {{:Team:UCSF_UCB/shuaixin}}
-                        <html>
                  </article>
                      <article id = "e-wong">
@@ Line 450: / Line 451: @@
                                  <li ><a href = "./project.html#design">Design</a></li>
                                  <li ><a href = "./project.html#achievements">Achievements</a></li>
-                                 <li ><a href = "./project.html#implications">Implications</a></li>
+<li ><a href = "./project.html#model">Models</a></li>
-                                 <li ><a href = "./project.html#safety">Safety</a></li>
                              </ul>
                          </li>
                           <li class = "page">
-                             <h4><a href = "./models.html">Models</a></h4>
+                             <h4><a href = "./judging.html">Judging</a></h4>
+                            <ul class = "sections">
+                            		<li ><a href = "./judging.html#medal">Medal Requirements</a></li>
+                            		<li ><a href = "./judging.html#safety">Safety</a></li>
+                                <li ><a href = "./judging.html#implications">Implications</a></li>
+                            </ul>
                          </li>
                          <li class = "page">
-                             <h4><a href = "./human_practices.html">Human Practices</a></h4>
+                             <h4><a href = "./hp.html">Human Practices</a></h4>
                              <ul class = "sections" >
-                                 <li ><a href = "./human_practices.html#collaborations">Collaborations</a></li>
+                                 <li ><a href = "./hp.html#super_science">Super Science!</a></li>
-                                 <li ><a href = "./human_practices.html#alhs">ALHS</a></li>
+                                 <li ><a href = "./hp.html#collaborations">Collaborations</a></li>
-                                <li ><a href = "./human_practices.html#super_science">Super Science!</a></li>
                              </ul>
                          </li>
@@ Line 490: / Line 495: @@
              </footer>
          </div>
- <script>
+    </body>
+<script>
              //FUNCTIONS!
 //-----------
@@ Line 527: / Line 533: @@
      var elemTop = $(elem).offset().top;
      var elemBottom = elemTop + $(elem).height();
+     if(elemBottom < docViewBottom) {
-     return ((elemBottom < docViewBottom) && (elemTop > docViewTop));
+    	if(elemTop > docViewTop){
+    		return true;
+    	}
+    }
 }
@@ Line 588: / Line 597: @@
                  });
          </script>
-        <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.11.1/jquery.min.js"></script>
-        <script src="js/main.js"></script>
-    </body>
 </html>

	1	2	3	4	5	6	7	8	9	10	11	12
A	1	1	1	1	1	1	7	7	7	7	7	7
B	1	1	1	1	1	1	10	10	10	10	10	10
C	1	1	1	1	1	1	10	10	10	10	10	10
D	6	6	6	6	6	6	10	10	10	10	10	10
E	6	6	6	6	6	6
F	6	6	6	6	6	6
G	7	7	7	7	7	7
H	7	7	7	7	7	7

	1	2	3	4	5	6	7	8	9	10	11	12
A	1	1	1	1	1	1	6	6	6	6	6	6
B	1	1	1	1	1	1	7	7	7	7	7	7
C	1	1	1	1	1	1	7	7	7	7	7	7
D	3	3	3	3	3	3	7	7	7	7	7	7
E	3	3	3	3	3	3	10	10	10	10	10	10
F	3	3	3	3	3	3	10	10	10	10	10	10
G	6	6	6	6	6	6	10	10	10	10	10	10
H	6	6	6	6	6	6

	1	2	3	4	5	6	7	8	9	10	11	12
A	1	1	1	1	1	1	7	7	7	7	7	7
B	1	1	1	1	1	1	10	10	10	10	10	10
C	1	1	1	1	1	1	10	10	10	10	10	10
D	6	6	6	6	6	6	10	10	10	10	10	10
E	6	6	6	6	6	6
F	6	6	6	6	6	6
G	7	7	7	7	7	7
H	7	7	7	7	7	7

AFRP	1	2	3	4	5
1	✓	X	X	✓	✓
2	✓	✓	X	✓	✓
4	✓	✓	✓	✓	✓
6	✓	✓	✓	✓	✓
10	X	✓	✓	X	X
11	X	✓	X	✓	✓
12	✓	✓	✓	✓	✓

	1	2	3	4	5	6	7	8	9	10	11	12
A	1	1	1	1	1	1	7	7	7	7	7	7
B	1	1	1	1	1	1	10	10	10	10	10	10
C	1	1	1	1	1	1	10	10	10	10	10	10
D	6	6	6	6	6	6	10	10	10	10	10	10
E	6	6	6	6	6	6
F	6	6	6	6	6	6
G	7	7	7	7	7	7
H	7	7	7	7	7	7

	1	2	3	4	5	6	7	8	9	10	11	12
A	1	1	1	1	1	1	6	6	6	6	6	6
B	1	1	1	1	1	1	7	7	7	7	7	7
C	1	1	1	1	1	1	7	7	7	7	7	7
D	3	3	3	3	3	3	7	7	7	7	7	7
E	3	3	3	3	3	3	10	10	10	10	10	10
F	3	3	3	3	3	3	10	10	10	10	10	10
G	6	6	6	6	6	6	10	10	10	10	10	10
H	6	6	6	6	6	6

	1	2	3	4	5	6	7	8	9	10	11	12
A	1	1	1	1	1	1	7	7	7	7	7	7
B	1	1	1	1	1	1	10	10	10	10	10	10
C	1	1	1	1	1	1	10	10	10	10	10	10
D	6	6	6	6	6	6	10	10	10	10	10	10
E	6	6	6	6	6	6
F	6	6	6	6	6	6
G	7	7	7	7	7	7
H	7	7	7	7	7	7

AFRP	1	2	3	4	5
1	✓	X	X	✓	✓
2	✓	✓	X	✓	✓
4	✓	✓	✓	✓	✓
6	✓	✓	✓	✓	✓
10	X	✓	✓	X	X
11	X	✓	X	✓	✓
12	✓	✓	✓	✓	✓

Team:UCSF UCB/notebooks.html

From 2014.igem.org

Latest revision as of 01:05, 18 October 2014

Notebooks

Protocols

Eleanor's Lab Notebook

June 9, 2014

PCR for Constitutive Promoters (pTEF1(M6))

June 10, 2014

Gel of Constitutive Promoters

Gel Extraction

Restriction Enzyme Digest with APA1

June 11, 2014

Digest with Xho1

PCR Purification

M6 + PSV606 ligation

E. Coli Transformation

June 12, 2014

June 13, 2014

Yeast Transformation (CB008 + Inducible Promoters)

June 16, 2014

Colony PCR for screening E. Coli (Constitutive promoters + GFP)

Colony PCR for Yeast & Patching

June 17, 2014

Gel Photos

June 18, 2014

Frozen Glycerol Stocks Yeast

Constitutive Promoters Miniprep

June 19, 2014

Adding α Factor to CB008 Promoters and Flow Cytometry

June 20, 2014

Yeast Transformation w/ Constitutive Promoters

June 23, 2014

Colony PCR and Gels (Constitutive Yeast)

June 25, 2014

Glycerol Stocks of Constitutive Promoters in Yeast

Parts Registry Inducible Promoters PCR with pSB1C3 overhang

June 26, 2014

PCR Constitutive and Inducible Promoters with PSB1C3 overhang

June 27, 2014

Constitutive Promoter Digest

Parts Registry PCR Redo & PCR Purification

Gibson Assembly

Transformation

June 30, 2014

Colony PCR for Yeast ( pTET GFP & pAGA GFP CB008 + CB008 DB )

July 1, 2014

pTET-GFP/pAGA-GFP Colony PCR's

Making iGEM Backbone

July 2, 2014

Glycerol Stocks for pTET-GFP & pAGA-GFP

PCR Cleanup of pSB1C3

Digestion of pGEM insert with pSB1C3 overhang and pSB1C3 backbone

July 3 - July 6, 2014

July 7, 2014

Colony PCR

July 8, 2014

Colony PCR (Redo pGEM's 3, 10, 13)

July 9, 2014

Parts Registry Miniprep

Transformation of pGEM 13

July 10, 2014

July 11, 2014

Miniprep pGEM 13

July 12, 2014

July 17, 2014

July 21, 2014

July 22, 2o14

July 23, 2014

Fluorescent Protein Transformations for Exploratoreum

July 25, 2014

Yeast Transformations

E. Coli Transformation pGEM 22 ( pAGA1-mCherry)

August 5, 2014

August 6, 2014

August 8, 2014

August 11, 2014

August 13, 2014

Flow

August 14, 2014

	1	2	3	4	5	6	7	8	9	10	11	12
A	1	1	1	1	1	1	7	7	7	7	7	7
B	1	1	1	1	1	1	10	10	10	10	10	10
C	1	1	1	1	1	1	10	10	10	10	10	10
D	6	6	6	6	6	6	10	10	10	10	10	10
E	6	6	6	6	6	6
F	6	6	6	6	6	6
G	7	7	7	7	7	7
H	7	7	7	7	7	7

	1	2	3	4	5	6	7	8	9	10	11	12
A	1	1	1	1	1	1	6	6	6	6	6	6
B	1	1	1	1	1	1	7	7	7	7	7	7
C	1	1	1	1	1	1	7	7	7	7	7	7
D	3	3	3	3	3	3	7	7	7	7	7	7
E	3	3	3	3	3	3	10	10	10	10	10	10
F	3	3	3	3	3	3	10	10	10	10	10	10
G	6	6	6	6	6	6	10	10	10	10	10	10
H	6	6	6	6	6	6

	1	2	3	4	5	6	7	8	9	10	11	12
A	1	1	1	1	1	1	7	7	7	7	7	7
B	1	1	1	1	1	1	10	10	10	10	10	10
C	1	1	1	1	1	1	10	10	10	10	10	10
D	6	6	6	6	6	6	10	10	10	10	10	10
E	6	6	6	6	6	6
F	6	6	6	6	6	6
G	7	7	7	7	7	7
H	7	7	7	7	7	7

AFRP	1	2	3	4	5
1	✓	X	X	✓	✓
2	✓	✓	X	✓	✓
4	✓	✓	✓	✓	✓
6	✓	✓	✓	✓	✓
10	X	✓	✓	X	X
11	X	✓	X	✓	✓
12	✓	✓	✓	✓	✓