Team:Paris Bettencourt/Project/Interlab Study

From 2014.igem.org

(Difference between revisions)
 
(203 intermediate revisions not shown)
Line 4: Line 4:
<style>
<style>
body {
body {
-
        width : 100%;
+
width : 100%;
}
}
.background {
.background {
Line 14: Line 14:
height : 300px;
height : 300px;
margin-top : 40px;
margin-top : 40px;
-
background-image : url("https://static.igem.org/mediawiki/2014/b/ba/Smell_of_roses.png");
+
background-image : url("https://static.igem.org/mediawiki/2014/7/73/InterlabPB.png");
-
        background-size : cover;
+
background-size : cover;
background-color : transparent;
background-color : transparent;
-
}
+
}
-
+
-
.separation {
+
-
width : 100%;
+
-
height : 300px;
+
-
background : transparent;
+
-
}
+
-
+
h6 {
h6 {
 +
font-family : Arial;
 +
font-size : 16px;
 +
font-weight : bold;
 +
margin-left : 5%;
 +
}
 +
h5 {
font-family : Arial;
font-family : Arial;
font-size : 20px;  
font-size : 20px;  
font-weight : bold;
font-weight : bold;
-
                margin-left : 5%;
+
margin-left : 5%;
-
}
+
-
#logoblanc {
+
-
position : absolute;
+
-
width : 100px;
+
-
height : 100px;
+
-
right : 0;
+
-
left : 0;
+
-
margin : auto;
+
-
margin-top : -50px;
+
-
background : transparent;
+
-
align : center;
+
-
z-index : 50;
+
-
display : block;
+
-
}
+
-
#logorose {
+
-
position : absolute;
+
-
width : 100px;
+
-
height : 100px;
+
-
right : 0;
+
-
left : 0;
+
-
margin : auto;
+
-
margin-top : -50px;
+
-
background : transparent;
+
-
align : center;
+
-
z-index : 50;
+
-
display : none;
+
-
}
+
-
#logo:hover #logoblanc {
+
-
}
+
-
#logo:hover #logorose {
+
}
}
p {
p {
Line 65: Line 34:
background-color : transparent;
background-color : transparent;
}
}
-
        #fond {
+
 
-
                width : 100%
+
-
                height : 300px;
+
-
background : rgb(225,0,112);
+
-
        }
+
#headtable {
#headtable {
width : 92.5%;
width : 92.5%;
height : 300px;
height : 300px;
text-align : center;
text-align : center;
-
background : rgb(225,0,112);
+
background : rgb(255,0,99);
-
                margin-right : 3.75%;
+
margin-right : 3.75%;
-
                margin-left : 3.75%;
+
margin-left : 3.75%;
}
}
#headtable tr td {
#headtable tr td {
Line 82: Line 47:
heigth : 100%;
heigth : 100%;
color : rgb(255,255,255);
color : rgb(255,255,255);
-
                font-size : 14px;  
+
font-size : 12px;
 +
padding : 0 20px;
 +
font-size : 15px;
 +
        font-size : 12px;  
}
}
 +
#headtable tr td  ul {
 +
                text-align : left;
 +
        }
#tablelien {
#tablelien {
width : 100%;
width : 100%;
-
height : 80px;
+
height : 50px;
text-align : center;
text-align : center;
 +
background-color : rgb(255,255,255);
}
}
#tablelien tr td {
#tablelien tr td {
-
width : 20%;
+
width : 33.3333%;
height : 50px;
height : 50px;
 +
font-size : 16px;
 +
background-color : rgb(255,255,255);
 +
}
 +
#tablelien tr td a {
color : rgb(197,192,193);
color : rgb(197,192,193);
-
                font-size : 16px;
+
text-decoration : none;
}
}
#devices {
#devices {
width : 100%;
width : 100%;
-
height : 1800px;
 
display : inline-block;
display : inline-block;
}
}
-
#devices p {
+
#devices .text {
display : inline-block;
display : inline-block;
vertical-align : middle;
vertical-align : middle;
Line 106: Line 81:
width : 44%;
width : 44%;
margin-left : 5%;
margin-left : 5%;
-
                font-size : 15px;
+
font-size : 14px;
}
}
-
#devices img {
+
#devices .image {
position : absolute;
position : absolute;
-
width : 44%;
+
width : 45%;
height : 400px;
height : 400px;
-
                left : 51%;
+
left : 51%;
-
background-color : rgb(197,192,193);
+
margin-top : 60px;
 +
text-align : center;
}
}
-
#sequencing {
+
#devices .image img {
 +
width : 75%;
 +
}
 +
#results {
 +
position : relative;
width : 100%;
width : 100%;
-
height : 500px;
 
display : inline-block;
display : inline-block;
}
}
-
#sequencing p {
+
#results p {
display : inline-block;
display : inline-block;
vertical-align : middle;
vertical-align : middle;
Line 126: Line 105:
width : 44%;
width : 44%;
margin-left : 5%;
margin-left : 5%;
-
                font-size : 15px;
+
font-size : 14px;
-
 
+
word-wrap: break-word;
 +
text-align :justify;
}
}
-
#sequencing img {
+
#results div {
position : absolute;
position : absolute;
width : 44%;
width : 44%;
-
height : 400px;
+
height : 450px;
-
                left : 51%;
+
left : 51%;
-
background-color : rgb(197,192,193);
+
text-align :justify;
 +
margin-top : 60px;
 +
word-wrap: break-word;
}
}
-
#fluo {
+
#results div img {
 +
width : 100%;
 +
}
 +
#ccl {
 +
position : relative;
width : 100%;
width : 100%;
-
height : 500px;
 
display : inline-block;
display : inline-block;
}
}
-
#fluo p {
+
#ccl .text1 {
display : inline-block;
display : inline-block;
vertical-align : middle;
vertical-align : middle;
position : relative;
position : relative;
-
width : 44%;
+
width : 90%;
margin-left : 5%;
margin-left : 5%;
-
                font-size : 15px;
+
font-size : 14px;
 +
word-wrap: break-word;
 +
                text-align : center;
}
}
-
#fluo img {
+
#ccl .text1 img {
-
position : absolute;
+
width : 65%;
-
width : 44%;
+
-
height : 400px;
+
-
                left : 51%;
+
-
background-color : rgb(197,192,193);
+
}
}
#top {
#top {
Line 160: Line 143:
right : 20px;
right : 20px;
bottom : 10px;
bottom : 10px;
-
                width : 25px;
+
width : 20px;
-
                height : 25px;
+
height : 20px;
z-index : 100;
z-index : 100;
}
}
-
        #top img {
+
#top img {
-
                width : 100%;
+
width : 100%;
-
                height : 100%;
+
height : 100%;
-
        }
+
}
.nameimg {
.nameimg {
position : absolute;
position : absolute;
-
width : 200px;
+
width : 280px;
-
height : 200px;
+
margin-left : 8%;
-
margin-left : 10%;
+
                margin-top : 60px;
background : transparent;
background : transparent;
z-index : 60;
z-index : 60;
}
}
-
         .text1 {
+
#headtable tr td b {
-
              text-align : justify;
+
font-size : 18px;
-
              margin-left : 5%;
+
}
-
              margin-right : 5%;
+
.definition {
-
        }
+
font-size :11px;
-
         #headtable tr td b {
+
width : 100%;
-
               font-size : 18px;
+
}
 +
         #divimage {
 +
                margin-top : 200px;
 +
        }
 +
.division {
 +
width : 100%;
 +
display : inline-block;
 +
}
 +
.division .text1 {
 +
display : inline-block;
 +
vertical-align : middle;
 +
position : relative;
 +
width : 44%;
 +
margin-left : 5%;
 +
font-size : 15px;
 +
}
 +
.division .text1 li {
 +
font-size : 15px;
 +
        }     
 +
.division .text2 {
 +
position : absolute;
 +
width : 44%;
 +
height : 250px;
 +
left : 51%;
 +
margin-top : 60px;
 +
font-size : 14px;
 +
                text-align : center;
 +
}
 +
        #imgfluo {
 +
                width : 65%;
 +
                margin-left : 17.5%;
 +
        }
 +
.division .text3 {
 +
width : 90%;
 +
margin-left : 5%;
 +
font-size : 15px;
 +
}
 +
#fond {
 +
width : 100%
 +
height : 300px;
 +
background : rgb(255,0,99);
 +
}
 +
         #firstimg {
 +
               top : 800px;
 +
              width : 75%;
 +
        }
 +
        #fond ul {
 +
                list-style-image : url("https://static.igem.org/mediawiki/2014/f/f2/MicodonPB.png");
 +
        }
 +
        ul {
 +
            margin-left : 5%;
 +
            list-style : disc;
 +
            list-style-position : inside;
 +
        }
 +
        .separation {
 +
              width : 100%;
 +
              height : 900px;
         }
         }
</style>
</style>
Line 188: Line 227:
<p id=top><a href="#topheader"><img src="https://static.igem.org/mediawiki/2014/4/41/Arrow.png"></a></p>
<p id=top><a href="#topheader"><img src="https://static.igem.org/mediawiki/2014/4/41/Arrow.png"></a></p>
<div id="topheader">
<div id="topheader">
-
<img src="https://static.igem.org/mediawiki/2014/b/b1/Smelltheroses.png" class=nameimg>
+
<img src="https://static.igem.org/mediawiki/2014/8/8d/PB14interlab_study.png" class=nameimg>
</div>
</div>
-
<div id=logo><img id=logoblanc src="https://static.igem.org/mediawiki/2014/7/7d/Logoblanc.png"><img id=logorose src="https://static.igem.org/mediawiki/2014/2/28/Logorose.png"></div>
 
<div id=fond>
<div id=fond>
-
        <table id=headtable>
 
-
<tr>
 
-
<td><p class=text1>The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. Can you measure fluorescence somewhere in your lab? Then this is the perfect study for you! </p></td>
 
-
<td><p class=text1>Even if your lab or the organisms you work with mean that you can’t measure GFP from the specific devices, we want every team to be able to participate: email measurement at igem dot org and we will work out an alternative. </p></td>
 
-
</tr>
 
-
</table>
 
         </div>
         </div>
<table id=tablelien>
<table id=tablelien>
<tr>
<tr>
<td><a href="#devices">Devices</a></td>
<td><a href="#devices">Devices</a></td>
-
<td><a href="#">Sequencing</a></td>
+
<td><a href="#results">Sequencing</a></td>
-
<td><a href="#motivation">Fluorescence</a></td>
+
<td><a href="#ccl">Conclusion</a></td>
</tr>
</tr>
</table>
</table>
<div id=devices>
<div id=devices>
-
<h6>Devices</h6><br>
 
-
<p><b>Device 1</b><br><br>
 
-
BBa_I20260 (J23101-B0032-E0040-B0010-B0012) in the pSB3K3 vector.<br> Selection marker : Kanamycin<br> Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc<br> 2012 BioBrick Kit location<br> BBa_I20260: Plate 2, Well 17F<br><br> We followed <a href=kit>iGEM Distribution Kit instructions</a> to extract DNA from the Biobrick Plate 2, Well 17F (2012) and then <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1">Heat Shock transformation of <i>E.coli</i></a>. For successful Kanymycin plates we prepared <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stock</a> and labbeled it G.22.<br><br>
 
-
<b>Device 2</b><br><br>
+
<div class=division>
-
BBa_J23101 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.<br> Selection marker : Chloramphenicol<br> Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc<br> 2014 Biobrick Kit locations<br> BBa_K823005 (BBa_J23101 in pSB1C3): Plate 1, Well 20K<br> BBa_E0240 (in pSB1C3): Plate 2, Well 24B<br><br>
+
<h5>Achievements</h5>
-
We followed iGEM Distribution Kit instructions to extract DNA from the Biobrick BBa_K823005 and BBa_E0240 and then Heat Shock transformation of E.coli
+
<p class=text2><img id=imgfluo src="https://static.igem.org/mediawiki/2014/b/bd/GFPpb.jpg"></br><span class=definition><b>Photo 1. Fluorescent devices and LB control.</b> A photo of the three devices and an LB control was taken with a help of transillumiantor</span></p>
-
For successful Chloramphenicol plates, form single colonies we prepared liquid cultures overnight. We used 750uL of the liquid cultures for aglycerol stock . We used remaining 4,25 mL to make minipreps . We measured DNA content with the nanodrop.<br><br>
+
<p class=text1><ul>
-
Digestion analysis: <br>
+
<li>Successfully built the three devices</li>
-
- 5 ug plasmid<br>
+
<li>Sequenced and gel verified the three devices</li>
-
- 5 ul FD Buffer<br>
+
<li>Characterised all the three devices with the OD600 and fluorescence measurements in a Tecan micro-plate reader</li><li>Reported the results on the <a href="https://2014.igem.org/Team:Paris_Bettencourt/Project/Interlab_Study">Interlab Study</a> page of the iGEM wiki</li>
-
- 2.5 uL SpeI + 2.5 uL PstI (BBa_K823005) / 2.5 uL XbeI + 2.5 uL PstI (BBa_E0240)<br>
+
<li>Completed the description of the <a href="http://parts.igem.org/Part:BBa_I20260">BBa_I20260</a> (Device 1)
-
- complete with H2O<br>
+
<li>Submitted and send parts: <a href="http://parts.igem.org/Part:BBa_K1403000">BBa_K1403000</a> (Device 2) and <a href="http://parts.igem.org/Part:BBa_K1403001">BBa_K1403001</a> (Device 3) to the Biobricks registry</li> </ul></p></div>
-
(Final volume of 50 uL)<br><br>
+
-
We made an eletrophoresis gel to check the fragments (the bands at around 876 bp for GFP and 2100 bp for the promoter + backbone) and then extract BBa_E0240 with Gel extraction kit. For the plasmid with the promoter I used a PCR purification kit. We introduced the GFP fragment to the Plasmid + backbone through ligation of the sticky ends SpeI and XbeI. Quantified DNA in two parts with nanodrop. The amount of vector: insert has been calculated with Promega calculator. <br><br>
+
-
5X Ligase Reaction Buffer 4 μl<br>
+
-
Insert: Vector Molar Ratio 1:1, 1:3, 1:5<br>
+
-
Total DNA 0.01-0.1 μg<br>
+
-
T4 DNA Ligase 1 uL<br>
+
-
Autoclaved distilled water to 25uL<br>
+
-
Incubate at 22°C for 1h<br>
+
-
16°C overnight<br><br>
+
-
We transformed the ligation product following Heat Shock transformation of E.coli. We have put a single colony into a liquid culture with the appropriate antibiotic and the next day We prepared a glycerol stock .<br><br>
+
-
<b>Device 3</b><br><br>
+
<div class=division>
-
*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 missmatched basepairs.<br>BBa_J23115 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.<br>
+
</br><h5>Introduction</h5>
-
Selection marker : Chloramphenicol<br> Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc (missmatched basepairs compared to real BBa_J23115 are underlined)<br> 2014 Biobrick Kit locations<br> BBa_K823012 (BBa_J23115 in pSB1C3): Plate 1, Well 22I<br> BBa_E0240 (in pSB1C3): Plate 2, Well 24B<br><br>
+
<p class=text1><i>"The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. "</i></p>
-
In order to prepare the third device we proceed exactly in the same way as for the Device 2, except we used BBa_K823012 instead of BBa_K823005
+
<h5>Motivation</h5>
 +
<p class=text1>iGEM Paris Bettencourt team supported this initiative with pleasure. We strongly believe that this study will help to define standards for BioBrick constructs and measure the difference between different labs and measurement methods. It was also a great training for transformation and ligation techniques for the inexperienced synthetic biologist on the team.</p>
 +
</div>
-
</p>
+
</br></br></br><h5>Devices</h5>
-
<img src="">
+
<div class=text><p>We built 3 devices (Fig. 1, Fig. 2, Fig. 3) according to <a href"https://2014.igem.org/Tracks/Measurement/Interlab_study">Interlab study instructions</a>. First designed in  software (Geneious v. 7.0.6). Then made in our wet lab using the Biobrick Distribution Kits and confirmed by electrophoresis gel analytic digestion as well as sequencing. Finally, stocked as a glycerol stock and used for the measurements of GFP expression. </p></div>
-
</div>
+
<div class=image id=firstimg><img src="https://static.igem.org/mediawiki/2014/9/91/Device_1.png"><p class=definition><b>Figure 1. Device 1.</b> Geneious version 7.0.6 created by Biomatters. Available from ​http://www.geneious.com/​​</p></div>
-
<div id=sequencing>
+
</br><h6>Device 1</h6></br>
-
<h6>Sequencing</h6><br>
+
<div class=image id=firstimg><img src="https://static.igem.org/mediawiki/2014/9/91/Device_1.png"><p class=definition><b>Figure 1. Device 1.</b> Geneious version 7.0.6 created by Biomatters. Available from ​http://www.geneious.com/​​</p></div>
-
<p>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Nullam bibendum purus eu neque finibus, eget pellentesque sapien viverra. Vestibulum ultrices posuere tempor. Maecenas ultrices sodales magna ac placerat. Sed a ex dignissim, ornare metus non, malesuada arcu. Etiam ullamcorper odio leo, at molestie eros sollicitudin in. Morbi aliquam scelerisque facilisis. Aenean tincidunt aliquam erat, quis ullamcorper nulla accumsan ac. Proin interdum nibh quam, in lacinia ipsum dignissim at. Nunc elementum lacus sed purus pharetra tincidunt. Sed ac velit vel turpis pulvinar accumsan ut in mauris. Praesent ac dapibus dui. Nullam finibus turpis et turpis sagittis congue. </p>
+
 
-
<img src="">
+
<div class=text><p><u>BBa_I20260</u> (J23101-B0032-E0040-B0010-B0012) in the <u>pSB3K3</u> vector.</p>
-
</div>
+
<p>Selection marker : Kanamycin</p>
-
<div id=fluo>
+
<p>Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc</p>
-
<h6>OD600 and fluorescence measure over 20h</h6><br>
+
<u>2012 BioBrick Kit location</u>
-
<p>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Sed sit amet laoreet metus, ac viverra dolor. Sed et orci imperdiet sem vulputate ultricies. Aliquam erat volutpat. Cras semper ex non odio aliquet, eget feugiat eros tempor. Integer hendrerit odio et bibendum maximus. Duis scelerisque lacus in odio faucibus fringilla. Nulla eleifend aliquet molestie. Morbi aliquam rhoncus efficitur. Proin consectetur augue aliquam risus convallis egestas. Nunc viverra felis non nibh consequat, nec faucibus ipsum rutrum. Proin placerat faucibus libero vitae dapibus. </p>
+
  <ul><li>BBa_I20260: Plate 2, Well 17F</li>
-
<img src="">
+
</ul>
 +
<p> We followed <a href=kit>iGEM Distribution Kit instructions </a> to extract DNA from the Biobrick Plate 2, Well 17F (2012) and then <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1"> Heat Shock transformed the <i>E. coli</i></a> colonies that grew in the selective Kanymycin were grown in liquid media and made into <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stocks</a> labelled G.22.</p>
 +
</div>
 +
                <div id=divimage class=image><div class=separation2></div><img src="https://static.igem.org/mediawiki/2014/0/02/Device_2.png"><p class=definition><b>Figure 2. Device 2.</b>Geneious version 7.0.6 created by Biomatters. Available from ​http://www.geneious.com/​​</p></div>
 +
</br></br><h6>Device 2</h6></br>
 +
<div class=text>
 +
<p>Our part in the registry: <a href="http://parts.igem.org/Part:BBa_K1403000">BBa_K1403000</a></p>
 +
<p><u>BBa_J23101 + BBa_E0240</u> (B0032-E0040-B0010-B0012), in the <u>pSB1C3</u> vector.</br>
 +
Selection marker : Chloramphenicol</br>
 +
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc</p>
 +
<u>2014 Biobrick Kit locations</u>
 +
  <ul><li>  BBa_K823005 (BBa_J23101 in pSB1C3): Plate 1, Well 20K</li>
 +
  <li>  BBa_E0240 (in pSB1C3): Plate 2, Well 24B</li>
 +
</ul>
 +
<p> We followed the <a>iGEM Distribution Kit instructions </a> to extract DNA from the Biobrick BBa_K823005 and BBa_E0240 and then <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1"> Heat Shock transformed <i>E. coli</i></a></br>The colonies that survived after selection in choloamphenicol were cultured overnight. We used 750uL of the liquid cultures for a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stock </a>. The remaining 4.25 mL were used to make <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot4"> minipreps </a>. We measured DNA content with the nanodrop.
 +
</br></br><u>Digestion analysis</u>:</br>
 +
<ul><li> 5 ug plasmid </li>
 +
<li> 5 ul Buffer</li>
 +
<li> 2.5 uL SpeI + 2.5 uL PstI (BBa_K823005) / 2.5 uL XbeI + 2.5 uL PstI (BBa_E0240)</li>
 +
<li> Complete with H2O</li></ul>
 +
(Final volume of 50 uL)</br>
 +
We made an eletrophoresis gel to check the fragments (the bands at around  876 bp for GFP and 2100 bp for the promoter + backbone) and then extracted BBa_E0240 with a gel extraction kit. For the plasmid with the promoter we used a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot5">PCR purification kit.</a>
 +
We introduced the GFP fragment to the Plasmid + backbone through ligation of the sticky ends SpeI and XbeI. Quantified DNA in two parts with nanodrop. The amount of  vector:insert has been calculated with Promega calculator.
 +
</br>
 +
<ul><li>5X Ligase Reaction Buffer 4 μl</li>
 +
<li>Insert: Vector Molar Ratio 1:1, 1:3, 1:5</li>
 +
<li>Total DNA 0.01-0.1 μg</li>
 +
<li>T4 DNA Ligase 1 uL</li>
 +
<li>Autoclaved distilled water to 25uL</li>
 +
<li>Incubate at 22°C for 1h</li>
 +
<li> 16°C overnight</li></ul>
 +
We transformed the ligation product following <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1"> Heat Shock transformation of <i>E. coli</i></a>.
 +
We made liquid cultures of single colonies with the appropriate antibiotic and the next day we prepared a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stock</a>.</p>
 +
</div>
 +
<div class=image><img src="https://static.igem.org/mediawiki/2014/d/d9/Device_3.png"><p class=definition><b>Figure 3. Device 3.</b>Geneious version 7.0.6 created by Biomatters. Available from ​http://www.geneious.com/​​</p></div>
 +
 
 +
</br></br><h6>Device 3</h6></br>
 +
<div class=text>
 +
<p>Our part in the registry: <a href="http://parts.igem.org/Part:BBa_K1403001">BBa_K1403001</a></p>
 +
<p><i>*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 mismatched basepairs.</i></p>
 +
<p><u>BBa_J23115 + BBa_E0240</u> (B0032-E0040-B0010-B0012),  in the <u>pSB1C3</u> vector.</br>
 +
Selection marker : Chloramphenicol</br>
 +
Promoter expected sequence : tttatagctagctcag<u>t</u>cct<u>a</u>ggtacaatgctagc (mismatched basepairs compared to real BBa_J23115 are underlined)</p>
 +
<u>2014 Biobrick Kit locations</u>
 +
  <ul><li>  BBa_K823012 (BBa_J23115 in pSB1C3): Plate 1, Well 22I</li>
 +
  <li>  BBa_E0240 (in pSB1C3): Plate 2, Well 24B </li>
 +
</ul>
 +
</br>
 +
<p>In order to prepare the third device we proceeded exactly in the same way as for the Device 2, except we used  BBa_K823012 instead of BBa_K823005</p>
 +
</div>
</div>
</div>
 +
<div id=results>
 +
</br></br></br><h5>Sequencing</h5>
 +
<p>We sequenced all the three devices using iGEM Verification Primers (forward). Sequences are matching expected constructs.</p>
 +
</br><h6>1. Device 1</h6>
 +
<div></br></br></br></br>...GTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAATAACCGGCCGCTGCAGTCCCGGCAAAAAAAGGGCAAAGGTGTCCACCA</div>
 +
<p>Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc</br></br>
 +
Sequenced device’s promoter: TTTACAGCTAGCTCAGTCCTAGGTTATTATGCTAGC</br></br>
 +
Complete sequenced device:</br></br>
 +
ATTTGTATCTTACTATAAATAGGCGTATCACGAGGCACGAAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGAGCCGCTTCTAGAGATTTACAGCTAGCTCAGTCCTAGGTTATTATGCTAGCTACTAGAGTTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAA...</p>
 +
</br></br><h6>2. Device 2</h6>
 +
<div></br></br></br></br>...AGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCCCGTTATGCAGGCTTCCTCGCTCACTGAATCGCTGCGCTCGGTCGTTCGGCTGCGGCGAACGGTATCAGCTCACTCAAAGGCGGTAATACCGGTTATCCCAAGAAATCAGGGGATAACCCCAGGAAAAAAACTTGGGACCAAAAGGCCACCCAAAGGGCCAGGAACCGTAAAAAAGGCCCCGTTTTCTGGGGTTTTTTCCAAAAGGCTCCGGCCCCCCTGGAAAAGACTTCAAAAATTCCGCCTTCTAATCCTAAAGGTGGGAAAACCCCCAA</div>
 +
<p>Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc</br></br>
 +
Sequenced device’s promoter: TTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGC</br></br>
 +
Complete sequenced device:</br></br>
 +
TTTGATAACTATAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGCTACTAGAGTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGA...</p>
 +
</br></br><h6>3. Device 3</h6>
 +
<div></br></br></br></br>...GTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCCGGGGGATAACCGCAGGAAAAAACATGTGGAGCCAAAAGGCCAACCAAAAGGCCAGGAACCGTAAAAAAGGCCCCGTTTGCTGGGGTTTTTTCCCAAGGGTCCCGCCCCCCTGGAAAAAGTTCCAA</div>
 +
<p>Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc</br></br>
 +
Sequenced promoter sequence:TTTATAGCTAGCTCAGTCCTAGGTACAATGCTAGC</br></br>
 +
Complete sequence: </br></br>
 +
GACTCTGATAACTATAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTTTATAGCTAGCTCAGTCCTAGGTACAATGCTAGCTACTAGAGTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAA...</p>
 +
<div><img src="https://static.igem.org/mediawiki/2014/0/0a/OD600_min.jpg"></br><b><span class=definition>Figure 4. Mean OD600 absorbance measured over 20h.</b> Background absorbance (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for each sample).</span></br><img src="https://static.igem.org/mediawiki/2014/e/e7/Fluo_samples_min.jpg"></br><span class=definition><b>Figure 5. Mean of green fluorescence for three devices and NEB turbo cells.</b> </br>Background fluorescence (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for Devices 1, 2, 3 and 6 replicates for NEB).</span></br>
 +
<img src="https://static.igem.org/mediawiki/2014/d/d0/Fluo_od_min.jpg"></br><span class=definition><b>Figure 6. Mean of green fluorescence divided by optical density 600 for three devices and NEB turbo cells.</b> </br>Background fluorescence (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for Devices 1, 2, 3 and 6 replicates for NEB).</span></div>
 +
</br></br></br><h5>OD600 and fluorescence measure over 20h</h5>
 +
<p><u>Samples preparation:</u> Single colonies were inoculated in 5mL LB broth with appropriate antibiotic and grown to saturation overnight (16h) at 37°C with shaking (220 rpm).
 +
Samples were diluted 100x (50um in 5 mL LB with appropriate antibiotic) and incubated for 2h at 37°C prior to measurement.
 +
</br></br><u>Control:</u></br>
 +
LB broth with antibiotics (chloramphenicol/kanamycin)- no fluorescence</br>
 +
NEB turbo without fluorescence - no fluorescence, no cells</br>
 +
<br><u>Measurment</u></br>
 +
Greiner 96 plates were loaded with 150um of cells in LB and 30um mineral oil
 +
Cells have been diluted prior to measurement as described above.
 +
Background absorbance and fluorescence was determined from LB control.
 +
</br>Data from the top row were excluded due to the likely evaporation and artefacts (edge effects).
 +
</p>
 +
</br></br></br><h5>Results</h5>
 +
<p>Here we present the result of the measurments. The measument has been realised in a comparable growth conditions for all Devices (Fig. 4). We can clearly see that the highest GFP expression levels occures under <a href="http://parts.igem.org/Part:BBa_J23101"> BBa_J23101</a> Anderson's strong promoter in a high copy plasmid sPB1C3 (Device 2: <a href="http://parts.igem.org/Part:BBa_K1403000">BBa_K1403000</a>). The lowest GFP levels occures under very weak Anderson's promoter - mutated <a href="http://parts.igem.org/Part:BBa_J23101"> J23115</a> (Device 3: <a href="http://parts.igem.org/Part:BBa_K1403001">BBa_K1403001</a>) as can be seen in the Fig. 5 & Fig. 6 </p>
 +
</div>
 +
        <div class=separation></div>
</body>
</body>
</html>
</html>
 +
 +
{{:Team:Paris_Bettencourt/Footer}}

Latest revision as of 16:05, 7 December 2014

Devices Sequencing Conclusion
Achievements


Photo 1. Fluorescent devices and LB control. A photo of the three devices and an LB control was taken with a help of transillumiantor

  • Successfully built the three devices
  • Sequenced and gel verified the three devices
  • Characterised all the three devices with the OD600 and fluorescence measurements in a Tecan micro-plate reader
  • Reported the results on the Interlab Study page of the iGEM wiki
  • Completed the description of the BBa_I20260 (Device 1)
  • Submitted and send parts: BBa_K1403000 (Device 2) and BBa_K1403001 (Device 3) to the Biobricks registry


Introduction

"The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. "

Motivation

iGEM Paris Bettencourt team supported this initiative with pleasure. We strongly believe that this study will help to define standards for BioBrick constructs and measure the difference between different labs and measurement methods. It was also a great training for transformation and ligation techniques for the inexperienced synthetic biologist on the team.




Devices

We built 3 devices (Fig. 1, Fig. 2, Fig. 3) according to Interlab study instructions. First designed in software (Geneious v. 7.0.6). Then made in our wet lab using the Biobrick Distribution Kits and confirmed by electrophoresis gel analytic digestion as well as sequencing. Finally, stocked as a glycerol stock and used for the measurements of GFP expression.

Figure 1. Device 1. Geneious version 7.0.6 created by Biomatters. Available from ​http://www.geneious.com/​​


Device 1

Figure 1. Device 1. Geneious version 7.0.6 created by Biomatters. Available from ​http://www.geneious.com/​​

BBa_I20260 (J23101-B0032-E0040-B0010-B0012) in the pSB3K3 vector.

Selection marker : Kanamycin

Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc

2012 BioBrick Kit location
  • BBa_I20260: Plate 2, Well 17F

We followed iGEM Distribution Kit instructions to extract DNA from the Biobrick Plate 2, Well 17F (2012) and then Heat Shock transformed the E. coli colonies that grew in the selective Kanymycin were grown in liquid media and made into glycerol stocks labelled G.22.

Figure 2. Device 2.Geneious version 7.0.6 created by Biomatters. Available from ​http://www.geneious.com/​​



Device 2

Our part in the registry: BBa_K1403000

BBa_J23101 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.
Selection marker : Chloramphenicol
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc

2014 Biobrick Kit locations
  • BBa_K823005 (BBa_J23101 in pSB1C3): Plate 1, Well 20K
  • BBa_E0240 (in pSB1C3): Plate 2, Well 24B

We followed the iGEM Distribution Kit instructions to extract DNA from the Biobrick BBa_K823005 and BBa_E0240 and then Heat Shock transformed E. coli
The colonies that survived after selection in choloamphenicol were cultured overnight. We used 750uL of the liquid cultures for a glycerol stock . The remaining 4.25 mL were used to make minipreps . We measured DNA content with the nanodrop.

Digestion analysis:

  • 5 ug plasmid
  • 5 ul Buffer
  • 2.5 uL SpeI + 2.5 uL PstI (BBa_K823005) / 2.5 uL XbeI + 2.5 uL PstI (BBa_E0240)
  • Complete with H2O
(Final volume of 50 uL)
We made an eletrophoresis gel to check the fragments (the bands at around 876 bp for GFP and 2100 bp for the promoter + backbone) and then extracted BBa_E0240 with a gel extraction kit. For the plasmid with the promoter we used a PCR purification kit. We introduced the GFP fragment to the Plasmid + backbone through ligation of the sticky ends SpeI and XbeI. Quantified DNA in two parts with nanodrop. The amount of vector:insert has been calculated with Promega calculator.
  • 5X Ligase Reaction Buffer 4 μl
  • Insert: Vector Molar Ratio 1:1, 1:3, 1:5
  • Total DNA 0.01-0.1 μg
  • T4 DNA Ligase 1 uL
  • Autoclaved distilled water to 25uL
  • Incubate at 22°C for 1h
  • 16°C overnight
We transformed the ligation product following Heat Shock transformation of E. coli. We made liquid cultures of single colonies with the appropriate antibiotic and the next day we prepared a glycerol stock.

Figure 3. Device 3.Geneious version 7.0.6 created by Biomatters. Available from ​http://www.geneious.com/​​



Device 3

Our part in the registry: BBa_K1403001

*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 mismatched basepairs.

BBa_J23115 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.
Selection marker : Chloramphenicol
Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc (mismatched basepairs compared to real BBa_J23115 are underlined)

2014 Biobrick Kit locations
  • BBa_K823012 (BBa_J23115 in pSB1C3): Plate 1, Well 22I
  • BBa_E0240 (in pSB1C3): Plate 2, Well 24B

In order to prepare the third device we proceeded exactly in the same way as for the Device 2, except we used BBa_K823012 instead of BBa_K823005




Sequencing

We sequenced all the three devices using iGEM Verification Primers (forward). Sequences are matching expected constructs.


1. Device 1




...GTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAATAACCGGCCGCTGCAGTCCCGGCAAAAAAAGGGCAAAGGTGTCCACCA

Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc

Sequenced device’s promoter: TTTACAGCTAGCTCAGTCCTAGGTTATTATGCTAGC

Complete sequenced device:

ATTTGTATCTTACTATAAATAGGCGTATCACGAGGCACGAAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGAGCCGCTTCTAGAGATTTACAGCTAGCTCAGTCCTAGGTTATTATGCTAGCTACTAGAGTTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAA...



2. Device 2




...AGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCCCGTTATGCAGGCTTCCTCGCTCACTGAATCGCTGCGCTCGGTCGTTCGGCTGCGGCGAACGGTATCAGCTCACTCAAAGGCGGTAATACCGGTTATCCCAAGAAATCAGGGGATAACCCCAGGAAAAAAACTTGGGACCAAAAGGCCACCCAAAGGGCCAGGAACCGTAAAAAAGGCCCCGTTTTCTGGGGTTTTTTCCAAAAGGCTCCGGCCCCCCTGGAAAAGACTTCAAAAATTCCGCCTTCTAATCCTAAAGGTGGGAAAACCCCCAA

Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc

Sequenced device’s promoter: TTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGC

Complete sequenced device:

TTTGATAACTATAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGCTACTAGAGTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGA...



3. Device 3




...GTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCCGGGGGATAACCGCAGGAAAAAACATGTGGAGCCAAAAGGCCAACCAAAAGGCCAGGAACCGTAAAAAAGGCCCCGTTTGCTGGGGTTTTTTCCCAAGGGTCCCGCCCCCCTGGAAAAAGTTCCAA

Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc

Sequenced promoter sequence:TTTATAGCTAGCTCAGTCCTAGGTACAATGCTAGC

Complete sequence:

GACTCTGATAACTATAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTTTATAGCTAGCTCAGTCCTAGGTACAATGCTAGCTACTAGAGTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAA...


Figure 4. Mean OD600 absorbance measured over 20h. Background absorbance (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for each sample).

Figure 5. Mean of green fluorescence for three devices and NEB turbo cells.
Background fluorescence (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for Devices 1, 2, 3 and 6 replicates for NEB).

Figure 6. Mean of green fluorescence divided by optical density 600 for three devices and NEB turbo cells.
Background fluorescence (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for Devices 1, 2, 3 and 6 replicates for NEB).



OD600 and fluorescence measure over 20h

Samples preparation: Single colonies were inoculated in 5mL LB broth with appropriate antibiotic and grown to saturation overnight (16h) at 37°C with shaking (220 rpm). Samples were diluted 100x (50um in 5 mL LB with appropriate antibiotic) and incubated for 2h at 37°C prior to measurement.

Control:
LB broth with antibiotics (chloramphenicol/kanamycin)- no fluorescence
NEB turbo without fluorescence - no fluorescence, no cells

Measurment
Greiner 96 plates were loaded with 150um of cells in LB and 30um mineral oil Cells have been diluted prior to measurement as described above. Background absorbance and fluorescence was determined from LB control.
Data from the top row were excluded due to the likely evaporation and artefacts (edge effects).




Results

Here we present the result of the measurments. The measument has been realised in a comparable growth conditions for all Devices (Fig. 4). We can clearly see that the highest GFP expression levels occures under BBa_J23101 Anderson's strong promoter in a high copy plasmid sPB1C3 (Device 2: BBa_K1403000). The lowest GFP levels occures under very weak Anderson's promoter - mutated J23115 (Device 3: BBa_K1403001) as can be seen in the Fig. 5 & Fig. 6

Centre for Research and Interdisciplinarity (CRI)
Faculty of Medicine Cochin Port-Royal, South wing, 2nd floor
Paris Descartes University
24, rue du Faubourg Saint Jacques
75014 Paris, France
+33 1 44 41 25 22/25
paris-bettencourt-igem@googlegroups.com
Copyright (c) 2014 igem.org. All rights reserved.

Retrieved from "http://2014.igem.org/Team:Paris_Bettencourt/Project/Interlab_Study"