Team:DTU-Denmark/Achievements/Parts

From 2014.igem.org

(Difference between revisions)
 
(52 intermediate revisions not shown)
Line 8: Line 8:
   <maincontent>
   <maincontent>
-
<p>
+
<br><br>
-
Our main part contribution is the Spinach2 BioBrick (BBa_xxx).
+
<h2>Main Contribution</h2>
-
Spinach is an RNA aptamer, developed at Cornell University, that binds and activates a fluorophore called DFHBI. Spinach2 is an improved version of Spinach with increased fluorescence. Spinach2 has not been included in any BioBrick until now.
+
<p>Our main part contribution is the Spinach2.1 BioBricks (BBa_K1330000 & BBa_K1330001). Spinach is an RNA aptamer, developed at Cornell University, that binds and activates a fluorophore called DFHBI. Spinach2 is an improved version of Spinach with increased fluorescence. Spinach2 has not been included in any BioBrick until now.</p>
</p>
</p>
<p>
<p>
Line 17: Line 17:
<p>
<p>
<span style="font-family: Courier">Spinach2:&nbsp;&nbsp;&nbsp;GATGTAACTGAATGAAATGGTGAAGGACGGGTCCAGTAGGCTGCTTCGGCAGCCTACTTGTTGAGTAGAGTGTGAGCTCCGTA<span style="color:blue;">ACTAGT</span>TACATC</span></br>
<span style="font-family: Courier">Spinach2:&nbsp;&nbsp;&nbsp;GATGTAACTGAATGAAATGGTGAAGGACGGGTCCAGTAGGCTGCTTCGGCAGCCTACTTGTTGAGTAGAGTGTGAGCTCCGTA<span style="color:blue;">ACTAGT</span>TACATC</span></br>
-
<span style="font-family: Courier">Spinach2.1: GATGTA<span style="color:red;">T</span>CTGAATGAAATGGTGAAGGACGGGTCCAGTAGGCTGCTTCGGCAGCCTACTTGTTGAGTAGAGTGTGAGCTCCGTAACTAG<span style="color:red;">A</span>TACATC</span></br>
+
<span style="font-family: Courier">Spinach2.1:&nbsp;GATGTA<span style="color:red;">T</span>CTGAATGAAATGGTGAAGGACGGGTCCAGTAGGCTGCTTCGGCAGCCTACTTGTTGAGTAGAGTGTGAGCTCCGTAACTAG<span style="color:red;">A</span>TACATC</span></br>
</br>
</br>
-
The sequences of Spinach2 and Spinach2.1 are shown above. The SpeI site is highlighted in blue. The two point mutations we introduced are highlighted in red.
+
The sequences of Spinach2 and Spinach2.1 are shown above. The SpeI site is highlighted in <span style="color:blue">blue</span>. The two point mutations we introduced are highlighted in <span style="color:red">red</span>.
</p>
</p>
<p>
<p>
-
[Image of the predicted folding of Spinach2 and Spinach2.1]
+
Figure 1 shows predicted folding of Spinach2 and Spinach2.1 and Figure 2 shows the results of our <a href="/Team:DTU-Denmark/Achievements/Experimental_Results#lab-comparison-div">comparison</a> of the two sequences. The Vienna RNA web server was used to predict folding.
-
</p>
+
-
<p>
+
-
[Data on in vitro fluorescence comparisons of Spinach2 and Spinach2.1]
+
</p>
</p>
 +
 +
<img src="https://static.igem.org/mediawiki/2014/7/74/DTU-Denmark-RNAFold.png" width=600 style="display:block;margin:auto;" />
 +
<p class="figure-text"><b>Figure 1: </b>Predicted folding of Spinach2 and Spinach2.1. The blue circle shows the the bases that were exchanged in Spinach2.1.</p>
 +
 +
</br>
 +
<table style="background-color:transparent;">
 +
<tr>
 +
<td>
 +
    <img src="https://static.igem.org/mediawiki/2014/4/47/DTU-Denmark-SpinachComparison.png" width="500" />
 +
</td>
 +
<td>
 +
    <img src="https://static.igem.org/mediawiki/2014/9/97/DTU-Denmark-wt_m2_barchart.png" width="400">
 +
</td>
 +
</table>
 +
<p class="figure-text"><b>Figure 2: </b>Graphs showing that Spinach2.1 is comparable to Spinach2 with regard to ability to activate DFHBI-1T and folding efficiency. See our <a href="/Team:DTU-Denmark/Achievements/Experimental_Results#lab-comparison-div">Lab results</a> page for more details.</p>
<p>
<p>
-
Our BioBrick contains the Spinach2.1 sequence flanked by a human tRNALys3 and followed by terminator BBa_B0052.
+
To increase the stability of the Spinach2.1 RNA-aptamer our BioBrick contains the sequence flanked by a human tRNA<sub>Lys</sub><sup>3</sup>. We have submitted two versions of our Spinach2.1 BioBrick:</p>
-
This BioBrick can be combined with various promoters using Standard Assembly, allowing for rapid assays of different promoters’ activities.
+
<ul>
-
</p>
+
<li><a href="http://parts.igem.org/Part:BBa_K1330000"target="_blank">BBa_K1330000</a> contains the Spinach2.1 tRNA<sub>Lys</sub><sup>3</sup> complex in backbone <a href="http://parts.igem.org/Part:pSB1C3"target="_blank">pSB1C3</a>.
 +
<li><a href="http://parts.igem.org/Part:BBa_K1330001"target="_blank">BBa_K1330001</a> contains the Spinach2.1 tRNA<sub>Lys</sub><sup>3</sup> complex followed by terminator <a href="http://parts.igem.org/Part:BBa_B0052"target="_blank">BBa_B0052</a> in backbone pSB1C3.
 +
</ul>
 +
<br>
 +
<p>BBa_K1330000 can be used for reporter fusions. The fused mRNA product can be used both as a characterisation standard for the promoter, but can also be used to calculate the concentration of the fused transcript.</p>
 +
 
 +
<p>BBa_K1330001 can be used as stand-alone to characterise promoter activity. The submitted BioBrick contains one mismatch in the tRNA scaffold, the brick has not been tested with this mismatch, but we expect the mismatch wont affect the function of Spinach2.1.<br>
 +
To be safe we recommend that BBa_K1330000 is used and ligated with a terminator if needed.</p>
 +
<br>
 +
 
 +
<h2> Additional Parts</h2>
 +
<p>In addition to our main contributions we decided to streamline the Anderson promoter library, as only 15 of the 20 promoters were distributed in the standard backbone pSB1C3. We were successful in cloning 4 of the 5 missing promoters into pSB1C3 and have submitted these parts as:</p>
 +
 
 +
<ul>
 +
<li><a href="http://parts.igem.org/Part:BBa_K1330002" target="_blank">BBa_K1330002</a> contains the promoter <a href="http://parts.igem.org/Part:BBa_J23105"target="_blank">BBa_J23105</a>
 +
 
 +
<li><a href="http://parts.igem.org/Part:BBa_K1330003" target="_blank">BBa_K1330003</a> contains the promoter <a href="http://parts.igem.org/Part:BBa_J23110"target="_blank">BBa_J23110</a>
 +
 
 +
<li><a href="http://parts.igem.org/Part:BBa_K1330004" target="_blank">BBa_K1330004</a> contains the promoter <a href="http://parts.igem.org/Part:BBa_J23112"target="_blank">BBa_J23112</a>
 +
 
 +
<li><a href="http://parts.igem.org/Part:BBa_K1330005" target="_blank">BBa_K1330005</a> contains the promoter <a href="http://parts.igem.org/Part:BBa_J23116"target="_blank">BBa_J23116</a>
 +
</ul>
 +
 
 +
<br>We believe that this streamlining will help future iGEM teams as these promoters are now ready to use in the iGEM standard backbone.
 +
 
 +
 
</maincontent>
</maincontent>
</div>
</div>
Line 39: Line 76:
</body>
</body>
</html>
</html>
 +
 +
 +
{{:Template:Team:DTU-Denmark/footer}}

Latest revision as of 23:06, 17 October 2014

Technical University of Denmark

Parts

Main Contribution

Our main part contribution is the Spinach2.1 BioBricks (BBa_K1330000 & BBa_K1330001). Spinach is an RNA aptamer, developed at Cornell University, that binds and activates a fluorophore called DFHBI. Spinach2 is an improved version of Spinach with increased fluorescence. Spinach2 has not been included in any BioBrick until now.

The Spinach2 sequence contains an internal SpeI site, which makes it incompatible with the iGEM assembly standard. To overcome this we predicted several mutations that should not affect folding, and synthesized these mutated versions of the sequence. One of these mutated sequences, Spinach2.1, was confirmed to have fluorescence comparable to the original Spinach2.

Spinach2:   GATGTAACTGAATGAAATGGTGAAGGACGGGTCCAGTAGGCTGCTTCGGCAGCCTACTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTTACATC
Spinach2.1: GATGTATCTGAATGAAATGGTGAAGGACGGGTCCAGTAGGCTGCTTCGGCAGCCTACTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGATACATC

The sequences of Spinach2 and Spinach2.1 are shown above. The SpeI site is highlighted in blue. The two point mutations we introduced are highlighted in red.

Figure 1 shows predicted folding of Spinach2 and Spinach2.1 and Figure 2 shows the results of our comparison of the two sequences. The Vienna RNA web server was used to predict folding.

Figure 1: Predicted folding of Spinach2 and Spinach2.1. The blue circle shows the the bases that were exchanged in Spinach2.1.


Figure 2: Graphs showing that Spinach2.1 is comparable to Spinach2 with regard to ability to activate DFHBI-1T and folding efficiency. See our Lab results page for more details.

To increase the stability of the Spinach2.1 RNA-aptamer our BioBrick contains the sequence flanked by a human tRNALys3. We have submitted two versions of our Spinach2.1 BioBrick:


BBa_K1330000 can be used for reporter fusions. The fused mRNA product can be used both as a characterisation standard for the promoter, but can also be used to calculate the concentration of the fused transcript.

BBa_K1330001 can be used as stand-alone to characterise promoter activity. The submitted BioBrick contains one mismatch in the tRNA scaffold, the brick has not been tested with this mismatch, but we expect the mismatch wont affect the function of Spinach2.1.
To be safe we recommend that BBa_K1330000 is used and ligated with a terminator if needed.


Additional Parts

In addition to our main contributions we decided to streamline the Anderson promoter library, as only 15 of the 20 promoters were distributed in the standard backbone pSB1C3. We were successful in cloning 4 of the 5 missing promoters into pSB1C3 and have submitted these parts as:


We believe that this streamlining will help future iGEM teams as these promoters are now ready to use in the iGEM standard backbone.


Technical University of Denmark
Department of Systems Biology
Søltofts Plads 221
2800 Kgs. Lyngby
Denmark
+45 45 25 25 25
dtuigem14@gmail.com .

Retrieved from "http://2014.igem.org/Team:DTU-Denmark/Achievements/Parts"