"
Team:Paris Bettencourt/Project/Interlab Study
From 2014.igem.org
(→First device) |
(→iGEM 2014 Measurement Interlab Study) |
||
| Line 5: | Line 5: | ||
<I>"The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. Can you measure fluorescence somewhere in your lab? Then this is the perfect study for you! Even if your lab or the organisms you work with mean that you can’t measure GFP from the specific devices, we want every team to be able to participate: email measurement at igem dot org and we will work out an alternative."</I> | <I>"The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. Can you measure fluorescence somewhere in your lab? Then this is the perfect study for you! Even if your lab or the organisms you work with mean that you can’t measure GFP from the specific devices, we want every team to be able to participate: email measurement at igem dot org and we will work out an alternative."</I> | ||
| - | [[File:GFP.jpg| | + | [[File:GFP.jpg|100px|center]] |
<br> | <br> | ||
Revision as of 12:59, 20 August 2014
Contents |
iGEM 2014 Measurement Interlab Study
iGEM Paris Bettencourt team participates in the iGEM interlab study
"The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. Can you measure fluorescence somewhere in your lab? Then this is the perfect study for you! Even if your lab or the organisms you work with mean that you can’t measure GFP from the specific devices, we want every team to be able to participate: email measurement at igem dot org and we will work out an alternative."
First device
BBa_I20260 (J23101-B0032-E0040-B0010-B0012) in the pSB3K3 vector.
Selection marker : Kanamycin
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc
- BBa_I20260: Plate 2, Well 17F
- BBa_K823005 (BBa_J23101 in pSB1C3): Plate 1, Well 20K
- BBa_E0240 (in pSB1C3): Plate 2, Well 24B
- BBa_K823012 (BBa_J23115 in pSB1C3): Plate 1, Well 22I
- BBa_E0240 (in pSB1C3): Plate 2, Well 24B
- 2012 BioBrick Kit location
Second device
BBa_J23101 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.
Selection marker : Chloramphenicol
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc
- 2014 Biobrick Kit locations
Third device*
*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 missmatched basepairs.
BBa_J23115 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.
Selection marker : Chloramphenicol
Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc (missmatched basepairs compared to real BBa_J23115 are underlined)
- 2014 Biobrick Kit locations
