We built 3 devices (Fig. 1, Fig. 2, Fig. 3) according to Interlab study instructions. First designed in software (Geneious v. 7.0.6). Then made in our wet lab using the Biobrick Distribution Kits and confirmed by electrophoresis gel analytic digestion as well as sequencing. Finally, stocked as a glycerol stock and used for the measurements of GFP expression.
Team:Paris Bettencourt/Project/Interlab Study
From 2014.igem.org
(21 intermediate revisions not shown) | |||
Line 92: | Line 92: | ||
} | } | ||
#devices .image img { | #devices .image img { | ||
- | width : | + | width : 75%; |
} | } | ||
#results { | #results { | ||
Line 169: | Line 169: | ||
margin-top : 200px; | margin-top : 200px; | ||
} | } | ||
- | |||
- | |||
- | |||
- | |||
.division { | .division { | ||
width : 100%; | width : 100%; | ||
Line 185: | Line 181: | ||
font-size : 15px; | font-size : 15px; | ||
} | } | ||
+ | .division .text1 li { | ||
+ | font-size : 15px; | ||
+ | } | ||
.division .text2 { | .division .text2 { | ||
position : absolute; | position : absolute; | ||
Line 210: | Line 209: | ||
#firstimg { | #firstimg { | ||
top : 800px; | top : 800px; | ||
+ | width : 75%; | ||
} | } | ||
#fond ul { | #fond ul { | ||
Line 221: | Line 221: | ||
.separation { | .separation { | ||
width : 100%; | width : 100%; | ||
- | height : | + | height : 900px; |
} | } | ||
</style> | </style> | ||
Line 243: | Line 243: | ||
<div class=division> | <div class=division> | ||
<h5>Achievements</h5> | <h5>Achievements</h5> | ||
- | <p class=text2><img id=imgfluo src="https://static.igem.org/mediawiki/2014/b/bd/GFPpb.jpg"></br><b>Photo 1. Fluorescent devices and LB control.</b> A photo of the three devices and an LB control was taken with a help of transillumiantor</p> | + | <p class=text2><img id=imgfluo src="https://static.igem.org/mediawiki/2014/b/bd/GFPpb.jpg"></br><span class=definition><b>Photo 1. Fluorescent devices and LB control.</b> A photo of the three devices and an LB control was taken with a help of transillumiantor</span></p> |
<p class=text1><ul> | <p class=text1><ul> | ||
<li>Successfully built the three devices</li> | <li>Successfully built the three devices</li> | ||
Line 255: | Line 255: | ||
<p class=text1><i>"The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. "</i></p> | <p class=text1><i>"The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. "</i></p> | ||
<h5>Motivation</h5> | <h5>Motivation</h5> | ||
- | <p class=text1>iGEM Paris Bettencourt team supported this initiative with pleasure. We strongly believe that this study will help to define standards for BioBrick constructs and measure the difference between different labs and measurement methods. It was also a great training for inexperienced synthetic biologist | + | <p class=text1>iGEM Paris Bettencourt team supported this initiative with pleasure. We strongly believe that this study will help to define standards for BioBrick constructs and measure the difference between different labs and measurement methods. It was also a great training for transformation and ligation techniques for the inexperienced synthetic biologist on the team.</p> |
</div> | </div> | ||
</br></br></br><h5>Devices</h5> | </br></br></br><h5>Devices</h5> | ||
- | <div class=text><p>We built 3 devices (Fig. 1, Fig. 2, Fig. 3) according to <a href"https://2014.igem.org/Tracks/Measurement/Interlab_study">Interlab study instructions</a>. First designed in | + | <div class=text><p>We built 3 devices (Fig. 1, Fig. 2, Fig. 3) according to <a href"https://2014.igem.org/Tracks/Measurement/Interlab_study">Interlab study instructions</a>. First designed in software (Geneious v. 7.0.6). Then made in our wet lab using the Biobrick Distribution Kits and confirmed by electrophoresis gel analytic digestion as well as sequencing. Finally, stocked as a glycerol stock and used for the measurements of GFP expression. </p></div> |
<div class=image id=firstimg><img src="https://static.igem.org/mediawiki/2014/9/91/Device_1.png"><p class=definition><b>Figure 1. Device 1.</b> Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/</p></div> | <div class=image id=firstimg><img src="https://static.igem.org/mediawiki/2014/9/91/Device_1.png"><p class=definition><b>Figure 1. Device 1.</b> Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/</p></div> | ||
</br><h6>Device 1</h6></br> | </br><h6>Device 1</h6></br> | ||
Line 270: | Line 270: | ||
<ul><li>BBa_I20260: Plate 2, Well 17F</li> | <ul><li>BBa_I20260: Plate 2, Well 17F</li> | ||
</ul> | </ul> | ||
- | <p> We followed <a href=kit>iGEM Distribution Kit instructions </a> to extract DNA from the Biobrick Plate 2, Well 17F (2012) and then <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1"> Heat Shock | + | <p> We followed <a href=kit>iGEM Distribution Kit instructions </a> to extract DNA from the Biobrick Plate 2, Well 17F (2012) and then <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1"> Heat Shock transformed the <i>E. coli</i></a> colonies that grew in the selective Kanymycin were grown in liquid media and made into <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stocks</a> labelled G.22.</p> |
</div> | </div> | ||
<div id=divimage class=image><div class=separation2></div><img src="https://static.igem.org/mediawiki/2014/0/02/Device_2.png"><p class=definition><b>Figure 2. Device 2.</b>Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/</p></div> | <div id=divimage class=image><div class=separation2></div><img src="https://static.igem.org/mediawiki/2014/0/02/Device_2.png"><p class=definition><b>Figure 2. Device 2.</b>Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/</p></div> | ||
Line 283: | Line 283: | ||
<li> BBa_E0240 (in pSB1C3): Plate 2, Well 24B</li> | <li> BBa_E0240 (in pSB1C3): Plate 2, Well 24B</li> | ||
</ul> | </ul> | ||
- | <p> We followed the <a>iGEM Distribution Kit instructions </a> to extract DNA from the Biobrick BBa_K823005 and BBa_E0240 and then <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1"> Heat Shock | + | <p> We followed the <a>iGEM Distribution Kit instructions </a> to extract DNA from the Biobrick BBa_K823005 and BBa_E0240 and then <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1"> Heat Shock transformed <i>E. coli</i></a></br>The colonies that survived after selection in choloamphenicol were cultured overnight. We used 750uL of the liquid cultures for a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stock </a>. The remaining 4.25 mL were used to make <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot4"> minipreps </a>. We measured DNA content with the nanodrop. |
</br></br><u>Digestion analysis</u>:</br> | </br></br><u>Digestion analysis</u>:</br> | ||
<ul><li> 5 ug plasmid </li> | <ul><li> 5 ug plasmid </li> | ||
Line 290: | Line 290: | ||
<li> Complete with H2O</li></ul> | <li> Complete with H2O</li></ul> | ||
(Final volume of 50 uL)</br> | (Final volume of 50 uL)</br> | ||
- | We made an eletrophoresis gel to check the fragments (the bands at around 876 bp for GFP and 2100 bp for the promoter + backbone)and then | + | We made an eletrophoresis gel to check the fragments (the bands at around 876 bp for GFP and 2100 bp for the promoter + backbone) and then extracted BBa_E0240 with a gel extraction kit. For the plasmid with the promoter we used a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot5">PCR purification kit.</a> |
We introduced the GFP fragment to the Plasmid + backbone through ligation of the sticky ends SpeI and XbeI. Quantified DNA in two parts with nanodrop. The amount of vector:insert has been calculated with Promega calculator. | We introduced the GFP fragment to the Plasmid + backbone through ligation of the sticky ends SpeI and XbeI. Quantified DNA in two parts with nanodrop. The amount of vector:insert has been calculated with Promega calculator. | ||
</br> | </br> | ||
Line 300: | Line 300: | ||
<li>Incubate at 22°C for 1h</li> | <li>Incubate at 22°C for 1h</li> | ||
<li> 16°C overnight</li></ul> | <li> 16°C overnight</li></ul> | ||
- | We transformed the ligation product following <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1"> Heat Shock transformation of <i>E.coli</i></a>. | + | We transformed the ligation product following <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot1"> Heat Shock transformation of <i>E. coli</i></a>. |
- | We made liquid | + | We made liquid cultures of single colonies with the appropriate antibiotic and the next day we prepared a <a href="https://2014.igem.org/Team:Paris_Bettencourt/Protocols#prot8">glycerol stock</a>.</p> |
</div> | </div> | ||
<div class=image><img src="https://static.igem.org/mediawiki/2014/d/d9/Device_3.png"><p class=definition><b>Figure 3. Device 3.</b>Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/</p></div> | <div class=image><img src="https://static.igem.org/mediawiki/2014/d/d9/Device_3.png"><p class=definition><b>Figure 3. Device 3.</b>Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/</p></div> | ||
Line 308: | Line 308: | ||
<div class=text> | <div class=text> | ||
<p>Our part in the registry: <a href="http://parts.igem.org/Part:BBa_K1403001">BBa_K1403001</a></p> | <p>Our part in the registry: <a href="http://parts.igem.org/Part:BBa_K1403001">BBa_K1403001</a></p> | ||
- | <p><i>*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 | + | <p><i>*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 mismatched basepairs.</i></p> |
<p><u>BBa_J23115 + BBa_E0240</u> (B0032-E0040-B0010-B0012), in the <u>pSB1C3</u> vector.</br> | <p><u>BBa_J23115 + BBa_E0240</u> (B0032-E0040-B0010-B0012), in the <u>pSB1C3</u> vector.</br> | ||
Selection marker : Chloramphenicol</br> | Selection marker : Chloramphenicol</br> | ||
- | Promoter expected sequence : tttatagctagctcag<u>t</u>cct<u>a</u>ggtacaatgctagc ( | + | Promoter expected sequence : tttatagctagctcag<u>t</u>cct<u>a</u>ggtacaatgctagc (mismatched basepairs compared to real BBa_J23115 are underlined)</p> |
<u>2014 Biobrick Kit locations</u> | <u>2014 Biobrick Kit locations</u> | ||
<ul><li> BBa_K823012 (BBa_J23115 in pSB1C3): Plate 1, Well 22I</li> | <ul><li> BBa_K823012 (BBa_J23115 in pSB1C3): Plate 1, Well 22I</li> | ||
Line 317: | Line 317: | ||
</ul> | </ul> | ||
</br> | </br> | ||
- | <p>In order to prepare the third device we | + | <p>In order to prepare the third device we proceeded exactly in the same way as for the Device 2, except we used BBa_K823012 instead of BBa_K823005</p> |
</div> | </div> | ||
</div> | </div> | ||
Line 324: | Line 324: | ||
<p>We sequenced all the three devices using iGEM Verification Primers (forward). Sequences are matching expected constructs.</p> | <p>We sequenced all the three devices using iGEM Verification Primers (forward). Sequences are matching expected constructs.</p> | ||
</br><h6>1. Device 1</h6> | </br><h6>1. Device 1</h6> | ||
- | <div>... | + | <div></br></br></br></br>...GTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAATAACCGGCCGCTGCAGTCCCGGCAAAAAAAGGGCAAAGGTGTCCACCA</div> |
<p>Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc</br></br> | <p>Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc</br></br> | ||
Sequenced device’s promoter: TTTACAGCTAGCTCAGTCCTAGGTTATTATGCTAGC</br></br> | Sequenced device’s promoter: TTTACAGCTAGCTCAGTCCTAGGTTATTATGCTAGC</br></br> | ||
Complete sequenced device:</br></br> | Complete sequenced device:</br></br> | ||
- | + | ATTTGTATCTTACTATAAATAGGCGTATCACGAGGCACGAAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGAGCCGCTTCTAGAGATTTACAGCTAGCTCAGTCCTAGGTTATTATGCTAGCTACTAGAGTTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAA...</p> | |
</br></br><h6>2. Device 2</h6> | </br></br><h6>2. Device 2</h6> | ||
- | <div>...AGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCCCGTTATGCAGGCTTCCTCGCTCACTGAATCGCTGCGCTCGGTCGTTCGGCTGCGGCGAACGGTATCAGCTCACTCAAAGGCGGTAATACCGGTTATCCCAAGAAATCAGGGGATAACCCCAGGAAAAAAACTTGGGACCAAAAGGCCACCCAAAGGGCCAGGAACCGTAAAAAAGGCCCCGTTTTCTGGGGTTTTTTCCAAAAGGCTCCGGCCCCCCTGGAAAAGACTTCAAAAATTCCGCCTTCTAATCCTAAAGGTGGGAAAACCCCCAA</div> | + | <div></br></br></br></br>...AGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCCCGTTATGCAGGCTTCCTCGCTCACTGAATCGCTGCGCTCGGTCGTTCGGCTGCGGCGAACGGTATCAGCTCACTCAAAGGCGGTAATACCGGTTATCCCAAGAAATCAGGGGATAACCCCAGGAAAAAAACTTGGGACCAAAAGGCCACCCAAAGGGCCAGGAACCGTAAAAAAGGCCCCGTTTTCTGGGGTTTTTTCCAAAAGGCTCCGGCCCCCCTGGAAAAGACTTCAAAAATTCCGCCTTCTAATCCTAAAGGTGGGAAAACCCCCAA</div> |
<p>Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc</br></br> | <p>Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc</br></br> | ||
Sequenced device’s promoter: TTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGC</br></br> | Sequenced device’s promoter: TTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGC</br></br> | ||
Line 336: | Line 336: | ||
TTTGATAACTATAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGCTACTAGAGTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGA...</p> | TTTGATAACTATAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGCTACTAGAGTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGA...</p> | ||
</br></br><h6>3. Device 3</h6> | </br></br><h6>3. Device 3</h6> | ||
- | <div>... | + | <div></br></br></br></br>...GTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCCGGGGGATAACCGCAGGAAAAAACATGTGGAGCCAAAAGGCCAACCAAAAGGCCAGGAACCGTAAAAAAGGCCCCGTTTGCTGGGGTTTTTTCCCAAGGGTCCCGCCCCCCTGGAAAAAGTTCCAA</div> |
<p>Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc</br></br> | <p>Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc</br></br> | ||
Sequenced promoter sequence:TTTATAGCTAGCTCAGTCCTAGGTACAATGCTAGC</br></br> | Sequenced promoter sequence:TTTATAGCTAGCTCAGTCCTAGGTACAATGCTAGC</br></br> | ||
Complete sequence: </br></br> | Complete sequence: </br></br> | ||
- | + | GACTCTGATAACTATAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTTTATAGCTAGCTCAGTCCTAGGTACAATGCTAGCTACTAGAGTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAA...</p> | |
- | <div><img src="https://static.igem.org/mediawiki/2014/0/0a/OD600_min.jpg"></br><b>Figure 4. Mean OD600 absorbance measured over 20h.</b> Background absorbance (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for each sample).</br><img src="https://static.igem.org/mediawiki/2014/e/e7/Fluo_samples_min.jpg"></br><b>Figure 5. Mean of green fluorescence for three devices and NEB turbo cells.</b> </br>Background fluorescence (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for Devices 1, 2, 3 and 6 replicates for NEB).</br> | + | <div><img src="https://static.igem.org/mediawiki/2014/0/0a/OD600_min.jpg"></br><b><span class=definition>Figure 4. Mean OD600 absorbance measured over 20h.</b> Background absorbance (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for each sample).</span></br><img src="https://static.igem.org/mediawiki/2014/e/e7/Fluo_samples_min.jpg"></br><span class=definition><b>Figure 5. Mean of green fluorescence for three devices and NEB turbo cells.</b> </br>Background fluorescence (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for Devices 1, 2, 3 and 6 replicates for NEB).</span></br> |
- | <img src="https://static.igem.org/mediawiki/2014/d/d0/Fluo_od_min.jpg"></br><b>Figure 6. Mean of green fluorescence divided by optical density 600 for three devices and NEB turbo cells.</b> </br>Background fluorescence (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for Devices 1, 2, 3 and 6 replicates for NEB).</div> | + | <img src="https://static.igem.org/mediawiki/2014/d/d0/Fluo_od_min.jpg"></br><span class=definition><b>Figure 6. Mean of green fluorescence divided by optical density 600 for three devices and NEB turbo cells.</b> </br>Background fluorescence (LB) subtracted from the samples. Values reported in the log scale with error bars for standard deviation (7 replicates for Devices 1, 2, 3 and 6 replicates for NEB).</span></div> |
</br></br></br><h5>OD600 and fluorescence measure over 20h</h5> | </br></br></br><h5>OD600 and fluorescence measure over 20h</h5> | ||
<p><u>Samples preparation:</u> Single colonies were inoculated in 5mL LB broth with appropriate antibiotic and grown to saturation overnight (16h) at 37°C with shaking (220 rpm). | <p><u>Samples preparation:</u> Single colonies were inoculated in 5mL LB broth with appropriate antibiotic and grown to saturation overnight (16h) at 37°C with shaking (220 rpm). | ||
Line 356: | Line 356: | ||
</p> | </p> | ||
</br></br></br><h5>Results</h5> | </br></br></br><h5>Results</h5> | ||
- | <p>Here we present the result of the measurments. The measument has been realised in a comparable growth conditions for all Devices (Fig. 4). We can clearly see that the highest GFP expression levels occures under <a href="http://parts.igem.org/Part:BBa_J23101"> BBa_J23101</a> Anderson's strong promoter in a high copy plasmid sPB1C3 (Device 2: <a href="http://parts.igem.org/Part:BBa_K1403000">BBa_K1403000</a>). The lowest GFP levels occures under very weak Anderson's promoter - mutated <a href="http://parts.igem.org/Part:BBa_J23101"> J23115</a> (Device 3: <a href="http://parts.igem.org/Part:BBa_K1403001">BBa_K1403001</a>)as can be seen in the Fig. 5 & Fig. 6 </p> | + | <p>Here we present the result of the measurments. The measument has been realised in a comparable growth conditions for all Devices (Fig. 4). We can clearly see that the highest GFP expression levels occures under <a href="http://parts.igem.org/Part:BBa_J23101"> BBa_J23101</a> Anderson's strong promoter in a high copy plasmid sPB1C3 (Device 2: <a href="http://parts.igem.org/Part:BBa_K1403000">BBa_K1403000</a>). The lowest GFP levels occures under very weak Anderson's promoter - mutated <a href="http://parts.igem.org/Part:BBa_J23101"> J23115</a> (Device 3: <a href="http://parts.igem.org/Part:BBa_K1403001">BBa_K1403001</a>) as can be seen in the Fig. 5 & Fig. 6 </p> |
</div> | </div> |
Latest revision as of 16:05, 7 December 2014
Devices | Sequencing | Conclusion |
Achievements
Photo 1. Fluorescent devices and LB control. A photo of the three devices and an LB control was taken with a help of transillumiantor
- Successfully built the three devices
- Sequenced and gel verified the three devices
- Characterised all the three devices with the OD600 and fluorescence measurements in a Tecan micro-plate reader
- Reported the results on the Interlab Study page of the iGEM wiki
- Completed the description of the BBa_I20260 (Device 1)
- Submitted and send parts: BBa_K1403000 (Device 2) and BBa_K1403001 (Device 3) to the Biobricks registry
Introduction
"The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. "
Motivation
iGEM Paris Bettencourt team supported this initiative with pleasure. We strongly believe that this study will help to define standards for BioBrick constructs and measure the difference between different labs and measurement methods. It was also a great training for transformation and ligation techniques for the inexperienced synthetic biologist on the team.
Devices
Figure 1. Device 1. Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/
Device 1
Figure 1. Device 1. Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/
BBa_I20260 (J23101-B0032-E0040-B0010-B0012) in the pSB3K3 vector.
Selection marker : Kanamycin
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc
2012 BioBrick Kit location- BBa_I20260: Plate 2, Well 17F
We followed iGEM Distribution Kit instructions to extract DNA from the Biobrick Plate 2, Well 17F (2012) and then Heat Shock transformed the E. coli colonies that grew in the selective Kanymycin were grown in liquid media and made into glycerol stocks labelled G.22.
Figure 2. Device 2.Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/
Device 2
Our part in the registry: BBa_K1403000
BBa_J23101 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector. Selection marker : Chloramphenicol Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc
2014 Biobrick Kit locations- BBa_K823005 (BBa_J23101 in pSB1C3): Plate 1, Well 20K
- BBa_E0240 (in pSB1C3): Plate 2, Well 24B
We followed the iGEM Distribution Kit instructions to extract DNA from the Biobrick BBa_K823005 and BBa_E0240 and then Heat Shock transformed E. coliThe colonies that survived after selection in choloamphenicol were cultured overnight. We used 750uL of the liquid cultures for a glycerol stock . The remaining 4.25 mL were used to make minipreps . We measured DNA content with the nanodrop. Digestion analysis:
- 5 ug plasmid
- 5 ul Buffer
- 2.5 uL SpeI + 2.5 uL PstI (BBa_K823005) / 2.5 uL XbeI + 2.5 uL PstI (BBa_E0240)
- Complete with H2O
- 5X Ligase Reaction Buffer 4 μl
- Insert: Vector Molar Ratio 1:1, 1:3, 1:5
- Total DNA 0.01-0.1 μg
- T4 DNA Ligase 1 uL
- Autoclaved distilled water to 25uL
- Incubate at 22°C for 1h
- 16°C overnight
Figure 3. Device 3.Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/
Device 3
Our part in the registry: BBa_K1403001
*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 mismatched basepairs.
BBa_J23115 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector. Selection marker : Chloramphenicol Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc (mismatched basepairs compared to real BBa_J23115 are underlined)
2014 Biobrick Kit locations- BBa_K823012 (BBa_J23115 in pSB1C3): Plate 1, Well 22I
- BBa_E0240 (in pSB1C3): Plate 2, Well 24B
In order to prepare the third device we proceeded exactly in the same way as for the Device 2, except we used BBa_K823012 instead of BBa_K823005
Sequencing
We sequenced all the three devices using iGEM Verification Primers (forward). Sequences are matching expected constructs.
1. Device 1
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc Sequenced device’s promoter: TTTACAGCTAGCTCAGTCCTAGGTTATTATGCTAGC Complete sequenced device: ATTTGTATCTTACTATAAATAGGCGTATCACGAGGCACGAAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGAGCCGCTTCTAGAGATTTACAGCTAGCTCAGTCCTAGGTTATTATGCTAGCTACTAGAGTTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAA...
2. Device 2
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc Sequenced device’s promoter: TTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGC Complete sequenced device: TTTGATAACTATAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGCTACTAGAGTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGA...
3. Device 3
Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc Sequenced promoter sequence:TTTATAGCTAGCTCAGTCCTAGGTACAATGCTAGC Complete sequence: GACTCTGATAACTATAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTTTATAGCTAGCTCAGTCCTAGGTACAATGCTAGCTACTAGAGTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAA...
OD600 and fluorescence measure over 20h
Samples preparation: Single colonies were inoculated in 5mL LB broth with appropriate antibiotic and grown to saturation overnight (16h) at 37°C with shaking (220 rpm).
Samples were diluted 100x (50um in 5 mL LB with appropriate antibiotic) and incubated for 2h at 37°C prior to measurement.
Control:
LB broth with antibiotics (chloramphenicol/kanamycin)- no fluorescence
NEB turbo without fluorescence - no fluorescence, no cells
Measurment
Greiner 96 plates were loaded with 150um of cells in LB and 30um mineral oil
Cells have been diluted prior to measurement as described above.
Background absorbance and fluorescence was determined from LB control.
Data from the top row were excluded due to the likely evaporation and artefacts (edge effects).
Results
Here we present the result of the measurments. The measument has been realised in a comparable growth conditions for all Devices (Fig. 4). We can clearly see that the highest GFP expression levels occures under BBa_J23101 Anderson's strong promoter in a high copy plasmid sPB1C3 (Device 2: BBa_K1403000). The lowest GFP levels occures under very weak Anderson's promoter - mutated J23115 (Device 3: BBa_K1403001) as can be seen in the Fig. 5 & Fig. 6