Team:XMU-China/Notebook Protocol
From 2014.igem.org
Fengshao18 (Talk | contribs) |
|||
(25 intermediate revisions not shown) | |||
Line 248: | Line 248: | ||
/*Protocol*/ | /*Protocol*/ | ||
.Notebook_title{position:absolute;width:300px;} | .Notebook_title{position:absolute;width:300px;} | ||
- | #Notebook_Protocol{position:relative;top:230px;width:1000px;margin-left:- | + | #Notebook_Protocol{position:relative;top:230px;width:1000px;margin-left:-500px;left:50%;} |
#Notebook_Protocol_wd{ | #Notebook_Protocol_wd{ | ||
background:rgba(0, 0, 0, 0.7) none repeat scroll 0 0 !important;/*FF*/ | background:rgba(0, 0, 0, 0.7) none repeat scroll 0 0 !important;/*FF*/ | ||
Line 255: | Line 255: | ||
padding-left: 30px; | padding-left: 30px; | ||
padding-right: 30px; | padding-right: 30px; | ||
- | + | line-height:1.5; | |
position:relative; | position:relative; | ||
top:150px; | top:150px; | ||
Line 336: | Line 336: | ||
var sidebar_sub_hover_display = side_bar_hover_target.children(".sidebar_sub").css("display"); | var sidebar_sub_hover_display = side_bar_hover_target.children(".sidebar_sub").css("display"); | ||
if(sidebar_sub_hover_display = "none"){ | if(sidebar_sub_hover_display = "none"){ | ||
- | side_bar_hover_target.animate({width:"275px"},200 | + | side_bar_hover_target.stop().animate({width:"275px"},200); |
- | + | ||
}; | }; | ||
$(".sidebar_main").mouseleave(function(){ | $(".sidebar_main").mouseleave(function(){ | ||
Line 343: | Line 342: | ||
var sidebar_sub_hoveroff_display = side_bar_hoveroff_target.children(".sidebar_sub").css("display"); | var sidebar_sub_hoveroff_display = side_bar_hoveroff_target.children(".sidebar_sub").css("display"); | ||
if(sidebar_sub_hover_display = "block"){ | if(sidebar_sub_hover_display = "block"){ | ||
- | side_bar_hover_target. | + | side_bar_hover_target.stop().animate({width:"155px"},100); |
- | + | ||
}; | }; | ||
}); | }); | ||
Line 351: | Line 349: | ||
$(".navbar_main").mouseenter(function(){ | $(".navbar_main").mouseenter(function(){ | ||
var nav_bar_hover_target = $(this); | var nav_bar_hover_target = $(this); | ||
- | nav_bar_hover_target.children(".navbar_sub").slideDown(); | + | nav_bar_hover_target.children(".navbar_sub").stop().slideDown(); |
$(".navbar_main").mouseleave(function(){ | $(".navbar_main").mouseleave(function(){ | ||
var nav_bar_hoveroff_target = $(this); | var nav_bar_hoveroff_target = $(this); | ||
- | nav_bar_hoveroff_target.children(".navbar_sub").slideUp(); | + | nav_bar_hoveroff_target.children(".navbar_sub").stop().slideUp(); |
}); | }); | ||
}); | }); | ||
Line 363: | Line 361: | ||
<body style="font-family:Arial;color:#8ccFFF"> | <body style="font-family:Arial;color:#8ccFFF"> | ||
<div id="background" style="position:fixed;z-index:-1;width:100%;height:100%;top:0px;left:0px;"> | <div id="background" style="position:fixed;z-index:-1;width:100%;height:100%;top:0px;left:0px;"> | ||
- | <img src="https://static.igem.org/mediawiki/2014/ | + | <img src="https://static.igem.org/mediawiki/2014/a/a6/Xmu_background_veir.jpg" width="100%" height="100%"/> |
</div> | </div> | ||
<div id="warp_navbar_main"> | <div id="warp_navbar_main"> | ||
Line 436: | Line 434: | ||
</div> | </div> | ||
</div> | </div> | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
<!--Protocol--> | <!--Protocol--> | ||
<div id="Notebook_Protocol"> | <div id="Notebook_Protocol"> | ||
<img id="Notebook_Protocol_title" class="Notebook_title" src="https://static.igem.org/mediawiki/2014/2/26/Xmu_notebook_protocol_zwei.png"/> | <img id="Notebook_Protocol_title" class="Notebook_title" src="https://static.igem.org/mediawiki/2014/2/26/Xmu_notebook_protocol_zwei.png"/> | ||
<div id="Notebook_Protocol_wd"> | <div id="Notebook_Protocol_wd"> | ||
- | <p style="text-align: center; ; font-size: 21px;"> | + | <p style="font-family:Arial;font-size:29px;text-align:center;"> |
- | <span style="; font-size: 21px; font-weight: 700;"> | + | <span style="font-family:Arial;font-weight:700;font-size:29px;">Protocols</span> |
+ | </p> | ||
+ | <p style="font-family:Arial;font-size:21px;"> | ||
+ | <span style="font-family:Arial;font-weight:700;font-size:21px;">General Considerations</span> | ||
+ | </p> | ||
+ | <p > | ||
+ | <span style="font-family:Arial;font-weight:700;font-style:italic;color:#fff;font-size:16px;">E. coli</span><span style="font-family:Arial;font-weight:700;color:#fff;font-size:16px;"> </span><span style="font-family:Arial;font-weight:700;color:#fff;font-size:16px;">S</span><span style="font-family:Arial;font-weight:700;color:#fff;font-size:16px;">train</span><span style="font-family:Arial;font-weight:700;color:#fff;font-size:16px;">s</span> | ||
+ | </p> | ||
+ | <p > | ||
+ | <span style="font-family:Arial;font-weight:700;font-style:italic;color:#fff;font-size:16px;">E. coli</span><span style="font-family:Arial;color:#fff;font-size:16px;"> strain DH5</span><span style="font-family:Arial;color:#fff;font-size:16px;">α</span><span style="font-family:Arial;color:#fff;font-size:16px;">, was offered by </span><span style="font-family:Arial;color:#fff;font-size:16px;">XMU-China iGEM 2013.</span> | ||
+ | </p> | ||
+ | <p > | ||
+ | <span style="font-family:Arial;font-weight:700;font-style:italic;color:#fff;font-size:16px;">E. coli</span><span style="font-family:Arial;color:#fff;font-size:16px;"> strain </span><span style="font-family:Arial;color:#fff;font-size:16px;">CL-1</span><span style="font-family:Arial;color:#fff;font-size:16px;">, </span><span style="font-family:Arial;color:#fff;font-size:16px;">whose gene of</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> cheZ</span><span style="font-family:Arial;color:#fff;font-size:16px;"> had been knocked out, </span><span style="font-family:Arial;color:#fff;font-size:16px;">was offered generously by </span><span style="font-family:Arial;color:#fff;font-size:16px;">iGEMer </span><span style="font-family:Arial;color:#fff;font-size:16px;">JianDong Huang and Lizhong Liu, from Department of Biochemistry, </span><span style="font-family:Arial;color:#fff;font-size:16px;">The University of Hong Kong.</span> | ||
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Times New Roman;font-size:21px;"> |
- | < | + | <br/> |
</p> | </p> | ||
- | <p | + | <p > |
- | <span style=" | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">Antibiotic</span> |
</p> | </p> | ||
- | <table style=" | + | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;"> |
<tbody> | <tbody> | ||
- | <tr | + | <tr style="height:18px;" class="firstRow"> |
- | <td style="border- | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">Antibiotic</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center; ; font- | + | <p style="font-family:Arial;text-align:center;"> |
- | + | <span style="font-family:Arial;">Stock </span><span style="font-family:Arial;">Concentration</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">(mg/mL</span><span style="font-family:Arial;">)</span> | |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center; | + | <p style="font-family:Arial;text-align:center;"> |
- | + | <span style="font-family:Arial;">Final </span><span style="font-family:Arial;">Concentration</span><span style="font-family:Arial;"> (μ</span><span style="font-family:Arial;">g/mL</span><span style="font-family:Arial;">)</span> | |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">Solvent</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: 18px;"> | + | <tr style="height:18px;"> |
- | <td style=" | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">Chloramphenicol</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">50</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">50</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">Absolute ethyl alcohol</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: 18px;"> | + | <tr style="height:18px;"> |
- | <td style=" | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">Ampicillin</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">50</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">100</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">ddH2O</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: 18px;"> | + | <tr style="height:18px;"> |
- | <td style=" | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">Kanamycin</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">50</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">50</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">ddH2O</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: 15px;"> | + | <tr style="height:15px;"> |
- | <td style=" | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">Tetracycline</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">50</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">50</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=" | + | <span style="font-family:Arial;">Absolute ethyl alcohol</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: | + | <tr style="height:0;"> |
- | <td style=" | + | <td style="width:134px;border:none;"></td> |
- | <td style=" | + | <td style="width:155px;border:none;"></td> |
- | <td style=" | + | <td style="width:152px;border:none;"></td> |
- | <td style=" | + | <td style="width:112px;border:none;"></td> |
</tr> | </tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >All the antibiotics above require filtration to </span><span >sterilize</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Stock in -20°C</span> |
</p> | </p> | ||
- | <p style="; font-size: 16px;"> | + | <p style="font-family:Times New Roman;font-size:16px;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p style="; font-size: 16px;"> | + | <p > |
- | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">LB </span><span style="font-family:Arial;font-weight:700;font-size:16px;">Liquid </span><span style="font-family:Arial;font-weight:700;font-size:16px;">Medium</span> | |
</p> | </p> | ||
- | <table style=" | + | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;"> |
<tbody> | <tbody> | ||
<tr class="firstRow"> | <tr class="firstRow"> | ||
- | <td style="border- | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | + | <span style="font-family:Arial;">Ingredients</span> | |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">Percent</span><span style="font-family:Arial;"> (g/mL)</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | </tr> |
- | <p style="text-align: center | + | <tr> |
- | <span style=";"> | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
+ | <p style="font-family:Arial;text-align:center;"> | ||
+ | <span style="font-family:Arial;">Yeast Extract</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;text-align:center;"> | ||
+ | <span style="font-family:Arial;">0.5%</span> | ||
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">Tryptone</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">1%</span> |
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;text-align:center;"> | ||
+ | <span style="font-family:Arial;">NaCl</span> | ||
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center; ;"> | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">1%</span> |
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr style="height:0;"> | ||
+ | <td style="width:184px;border:none;"></td> | ||
+ | <td style="width:184px;border:none;"></td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | <p style="font-family:Arial;font-size:16px;text-align:left;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | <p style="font-family:Arial;font-size:16px;text-align:left;"> | ||
+ | <span style="font-family:Arial;font-weight:700;font-size:16px;">LB Solid Medium </span> | ||
+ | </p> | ||
+ | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;"> | ||
+ | <tbody> | ||
+ | <tr class="firstRow"> | ||
+ | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;text-align:center;"> | ||
+ | <span style="font-family:Arial;">Ingredients</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;text-align:center;"> | ||
+ | <span style="font-family:Arial;">Percent (g/mL)</span> | ||
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">Yeast Extract</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">0.5%</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | </tr> |
- | <p style="text-align: center | + | <tr> |
- | <span style=";">1%</span> | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
+ | <p style="font-family:Arial;text-align:center;"> | ||
+ | <span style="font-family:Arial;">Tryptone</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;text-align:center;"> | ||
+ | <span style="font-family:Arial;">1%</span> | ||
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=";">NaCl</span> | + | <span style="font-family:Arial;">NaCl</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">1%</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | </tr> |
- | <p style="text-align: center | + | <tr> |
- | <span style=";">1%</span> | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
+ | <p style="font-family:Arial;text-align:center;"> | ||
+ | <span style="font-family:Arial;">Agar</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;text-align:center;"> | ||
+ | <span style="font-family:Arial;">1.5%</span> | ||
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: | + | <tr style="height:0;"> |
- | <td style=" | + | <td style="width:184px;border:none;"></td> |
- | <td style=" | + | <td style="width:184px;border:none;"></td> |
- | + | ||
</tr> | </tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
- | <p style=" | + | <p style="font-family:Arial;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;text-align:left;"> |
- | <span style="; font-size: 16px;">LB Solid Medium | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">LB Semi-Solid Medium</span> |
</p> | </p> | ||
- | <table style=" | + | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;"> |
<tbody> | <tbody> | ||
<tr class="firstRow"> | <tr class="firstRow"> | ||
- | <td style="border- | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">Ingredients</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">Percent (g/mL)</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | </tr> |
- | <p style="text-align: center | + | <tr> |
- | <span style=";"> | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
+ | <p style="font-family:Arial;text-align:center;"> | ||
+ | <span style="font-family:Arial;">Yeast Extract</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;text-align:center;"> | ||
+ | <span style="font-family:Arial;">0.5%</span> | ||
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style=" | + | <tr> |
- | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | |
- | <td style="border: | + | <p style="font-family:Arial;text-align:center;"> |
- | + | <span style="font-family:Arial;">Tryptone</span> | |
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;text-align:center;"> | ||
+ | <span style="font-family:Arial;">1%</span> | ||
+ | </p> | ||
+ | </td> | ||
</tr> | </tr> | ||
- | + | <tr> | |
- | < | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | + | <p style="font-family:Arial;text-align:center;"> | |
- | + | <span style="font-family:Arial;">NaCl</span> | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | <p style="text-align: center | + | |
- | <span style=";"> | + | |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">1%</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | </tr> |
- | <p style="text-align: center | + | <tr> |
- | <span style=";">0.25%</span> | + | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
+ | <p style="font-family:Arial;text-align:center;"> | ||
+ | <span style="font-family:Arial;">Agar</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:184px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;text-align:center;"> | ||
+ | <span style="font-family:Arial;">0.25%</span> | ||
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: | + | <tr style="height:0;"> |
- | <td style=" | + | <td style="width:184px;border:none;"></td> |
- | <td style=" | + | <td style="width:184px;border:none;"></td> |
- | + | ||
</tr> | </tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
- | <p style=";"> | + | <p style="font-family:Times New Roman;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p style="; font-size: 16px;"> | + | <p > |
- | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">Preparation of </span><span style="font-family:Arial;font-weight:700;font-size:16px;">Competent Cell (</span><span >TaKaRa Competent Cell Preparation Kit</span><span >)</span> | |
</p> | </p> | ||
- | <p style=";"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Activate the </span><span style="font-family:Arial;font-style:italic;font-size:16px;">E.</span><span style="font-family:Arial;font-style:italic;font-size:16px;"> </span><span style="font-family:Arial;font-style:italic;font-size:16px;">coli </span><span >strain on LB-plate from glycerol stock under the condition of 37°C for 12 hours.</span> | |
</p> | </p> | ||
- | <p style="; font-size: 16px;"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style=" | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Pre-culture </span><span >a single </span><span >colony in 5 mL LB </span><span >liquid </span><span >medium under the condition of 37°C, 200 rpm for 12 hours.</span> |
</p> | </p> | ||
- | <p style="; font-size: 16px;"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="; font- | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Add 200 μL</span><span > pre-culture </span><span >bacteria </span><span >into 20 mL LB liquid medium. Culture </span><span >under the condition of 37°C, 200 rpm for 2 hours.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font- | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Place on ice for 30 min.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Subpackage the 20 mL </span><span >culture medium</span><span > </span><span >into </span><span >1.5 mL </span><span >sterile </span><span >centrifuge tube</span><span >, each centrifuge tube containing 1 mL. </span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >C</span><span >entrifuge</span><span > at 1500×g for 5 min at 4°C, then discard supernatant.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font- | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >R</span><span >e-suspend each </span><span >centrifuge tube </span><span >gently </span><span >with 100</span><span > </span><span >μL Solution A</span><span >,</span><span > </span><span >which has been </span><span >precooled in ice</span><span >. </span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Centrifuge at 1500×g for 5 min </span><span >at 4°C, then</span><span > discard supernatant.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Re-suspend each </span><span >centrifuge tube</span><span > </span><span >gently </span><span >with 100 μL Solution B</span><span >,</span><span > </span><span >which has been precooled in ice. </span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font- | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Stock in -20°C</span> |
</p> | </p> | ||
- | <p | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:0em;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p | + | <p > |
- | <span style="font-family: | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">Transformation</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Add 1 μL </span><span >purified </span><span >plasmid or 10 μL ligation system into 100 μL fresh competent cells</span><span >, which is</span><span > </span><span >contained in 1.5 mL centrifuge tube. Then </span><span >mix gently.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Leave on ice for 30 minutes.</span> | |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"> | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >H</span><span >eat shock at</span><span > 42°C</span><span > for 90 seconds.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Leave on ice for 10 minutes immediately.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Add </span><span >400 μL fresh LB medium into the centrifuge tube</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Incubate for </span><span >2 hours</span><span > under the condition of 37°C, 200 rpm</span><span >. </span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:0em;"> |
- | <span | + | <span >Note: If </span><span >the </span><span >resistance </span><span >of vector</span><span > </span><span >is ampicillin, </span><span >incubation</span><span > time</span><span > is </span><span >shortened to </span><span >1 h</span><span >ou</span><span >r.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Spread 100 μL culture medium on a</span><span > LB so</span><span >lid medium plate, which contains appropriate antibiotics.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >I</span><span >ncubate overnight at 37°C</span> | |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Times New Roman;font-size:16px;"> |
- | < | + | <br/> |
</p> | </p> | ||
- | <p style="; font-size: 16px;"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;"> |
- | <span style=" | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">Confirmation</span> |
</p> | </p> | ||
- | <p style="; font-size: 16px;"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="; font-size: | + | <span style="font-size:14px;">1.</span><span style="font-size:14px;"> </span><span >Plasmid Extraction</span><span > (</span><span >Omega Plasmid Mini Kit</span><span >)</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Add 1 mL overnight suspension culture into a 1.5 mL sterile centrifuge tube. Centrifuge at 10000 x g for 1 min, then discard supernatant.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Repeat the step above several times, until the amount of bacteria is appropriate.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Re</span><span >-</span><span >suspend </span><span >cells gently with</span><span > 250 μL Solution I/RNase A.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Add 250 μL</span><span > Solution II</span><span > into each centrifuge tube</span><span >. Mix gently by inverting 4-6 times to obtain </span><span >cleared</span><span > lysate. </span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Add 350 μL</span><span > Solution III </span><span >into each centrifuge tube. M</span><span >ix well to form </span><span >protein </span><span >precipitate.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Centrifuge at </span><span >≥</span><span >13</span><span >000 x g for 10 min.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Transfer cleared lysate into a </span><span >HiBind Mini Column</span><span > placed in a 2 mL collection tube. </span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Centrifuge at 10000 x g for 1 min</span><span >. Discard liquid.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Wash </span><span >the </span><span >HiBind Mini Column</span><span > with 500 μL </span><span >HB </span><span >Buffer</span><span >.</span><span > </span><span >Centrifuge at 10000 x g for 1 min. Discard liquid.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Using the same collection tube, wash </span><span >the HiBind Mini Column</span><span > with 700</span><span > </span><span >Μl </span><span >DNA Wash Buffer</span><span >, which is</span><span > diluted with ethanol.</span><span > Centrifuge at 10000 x g for 1 min. Discard liquid.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Wash </span><span >the </span><span >HiBind Mini Column a second t</span><span >ime with an additional 700 μL </span><span >DNA Wash Buffer.</span><span > Centrifuge at 10000 x g for 1 min. Discard liquid.</span> |
</p> | </p> | ||
- | <p style="text-align: justify; text-indent: | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Centrifuge </span><span >the </span><span >empty HiBind Mini Column at</span><span > ≥ 13000 x g for 2 min</span><span > to </span><span >spin-dry</span><span >.</span> | |
+ | </p> | ||
+ | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> | ||
+ | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Place the HiBind Mini Column into a sterile</span><span > 1.5 mL</span><span > centrifuge tube. </span> | ||
+ | </p> | ||
+ | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> | ||
+ | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Add 30 μL sterile ultrapure water directly into the HiBind Mini Column. Sit at room temperature for 2 minutes. Centrifuge at maximum speed (≥ 13000 x g) for 1 min to elute DNA.</span> | ||
+ | </p> | ||
+ | <p style="font-family:Times New Roman;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:0em;"> | ||
+ | <br/> | ||
</p> | </p> | ||
- | <p style="; font-size: 16px;"> | + | <p style="font-family:Arial,微软雅黑;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="; font-size: | + | <span style="font-size:14px;">2.</span><span style="font-size:14px;"> </span><span style="font-family:Arial,微软雅黑;font-size:16px;">Digestion for Confirmation</span> |
</p> | </p> | ||
- | <p style="text-align: justify; text-indent: 0em | + | <p style="font-family:Arial,微软雅黑;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;"> |
- | <span style=";">Reaction condition: 37°C for 2 hours.</span> | + | <span style="font-family:Arial,微软雅黑;font-size:16px;">Reaction condition: 37°C for 2 hours.</span> |
</p> | </p> | ||
- | <table style=" | + | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;width:579px;border-collapse:collapse;border:none;"> |
<tbody> | <tbody> | ||
- | <tr | + | <tr style="height:27px;" class="firstRow"> |
- | <td style="border- | + | <td colspan="2" style="width:279px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";">Single Digestion</span> | + | <span style="font-family:Arial,微软雅黑;">Single Digestion</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td rowspan="7" style="width:20px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | + | <br/> | |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td colspan="2" style="width:280px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";">Double Digestion</span> | + | <span style="font-family:Arial,微软雅黑;">Double Digestion</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: 29px;"> | + | <tr style="height:29px;"> |
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";">Plasmid</span> | + | <span style="font-family:Arial,微软雅黑;">Plasmid</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial,微软雅黑;">5</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";">Plasmid</span> | + | <span style="font-family:Arial,微软雅黑;">Plasmid</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial,微软雅黑;">5</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: 27px;"> | + | <tr style="height:27px;"> |
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style="; font-style: italic;">Eco</span><span style=";">R I</span> | + | <span style="font-family:Arial,微软雅黑;font-style:italic;">Eco</span><span style="font-family:Arial,微软雅黑;">R I</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial,微软雅黑;">0.5 </span><span style="font-family:Arial,微软雅黑;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style="; font-style: italic;">Xba </span><span style=";">I</span> | + | <span style="font-family:Arial,微软雅黑;font-style:italic;">Xba </span><span style="font-family:Arial,微软雅黑;">I</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";">0. | + | <span style="font-family:Arial,微软雅黑;">0.5</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: 29px;"> | + | <tr style="height:29px;"> |
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | + | <br/> | |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | + | <br/> | |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style="; font-style: italic;">Pst</span><span style=";"> I</span> | + | <span style="font-family:Arial,微软雅黑;font-style:italic;">Pst</span><span style="font-family:Arial,微软雅黑;"> I</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";">0. | + | <span style="font-family:Arial,微软雅黑;">0.5</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: 27px;"> | + | <tr style="height:27px;"> |
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";">10×H | + | <span style="font-family:Arial,微软雅黑;">10×H B</span><span style="font-family:Arial,微软雅黑;">uffer</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial,微软雅黑;">1</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";">10×M | + | <span style="font-family:Arial,微软雅黑;">10×M B</span><span style="font-family:Arial,微软雅黑;">uffer</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial,微软雅黑;">1</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: 29px;"> | + | <tr style="height:29px;"> |
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";">ddH</span><span style="; valign: sub;">2</span><span style=";">O</span> | + | <span style="font-family:Arial,微软雅黑;">ddH</span><span style="font-family:Arial,微软雅黑;valign:sub;">2</span><span style="font-family:Arial,微软雅黑;">O</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial,微软雅黑;">3</span><span style="font-family:Arial,微软雅黑;">.5 </span><span style="font-family:Arial,微软雅黑;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";">ddH</span><span style="; valign: sub;">2</span><span style=";">O</span> | + | <span style="font-family:Arial,微软雅黑;">ddH</span><span style="font-family:Arial,微软雅黑;valign:sub;">2</span><span style="font-family:Arial,微软雅黑;">O</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial,微软雅黑;">3</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: 27px;"> | + | <tr style="height:27px;"> |
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";">Total Volume</span> | + | <span style="font-family:Arial,微软雅黑;">Total Volume</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial,微软雅黑;">10</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";">Total Volume</span> | + | <span style="font-family:Arial,微软雅黑;">Total Volume</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial,微软雅黑;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial,微软雅黑;">10</span><span style="font-family:Arial,微软雅黑;"> </span><span style="font-family:Arial,微软雅黑;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: | + | <tr style="height:0;"> |
- | <td style=" | + | <td style="width:140px;border:none;"></td> |
- | <td style=" | + | <td style="width:140px;border:none;"></td> |
- | <td style=" | + | <td style="width:20px;border:none;"></td> |
- | <td style=" | + | <td style="width:140px;border:none;"></td> |
- | <td style=" | + | <td style="width:140px;border:none;"></td> |
</tr> | </tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
- | <p style=";"> | + | <p style="font-family:Times New Roman;font-size:16px;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p style="; font-size: 16px;"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style=" | + | <span style="font-size:14px;">3.</span><span style="font-size:14px;"> </span><span >DNA gel electrophoresis</span><span > (take 20</span><span > </span><span >mL as example)</span> |
</p> | </p> | ||
- | <p style="; font-size: 16px;"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="; font- | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Dilute </span><span >50×TAE to 1×TAE with ddH</span><span style="font-family:Arial;font-size:16px;valign:sub;">2</span><span >O.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Measure 20 mL</span><span > 1×TAE buffer.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Pour</span><span > 1×TAE buffer </span><span >in</span><span >to an e</span><span >rlenmeyer flask.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Weigh</span><span > 0.2g agarose to make 1% </span><span >DNA </span><span >gel.</span> |
</p> | </p> | ||
- | <p style=";"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style=";"> | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Pour</span><span > agarose </span><span >in</span><span >to </span><span >the e</span><span >rlenmeyer flask.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Make</span><span > agarose </span><span >melt </span><span >by</span><span > microwave, lasting for</span><span > 105</span><span > seconds until melt</span><span > completely</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >C</span><span >ool </span><span >for 5 minutes</span><span >.</span><span > </span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Assemble gel pouring apparatus by inserting gate into slots.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font- | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >P</span><span >our</span><span style="font-family:Arial;"> </span><span >agarose gel</span><span > into gel tray.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Bring a piece of silver paper</span><span > on</span><span > the top of the </span><span >gel pouring apparatus</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Wait for 30-</span><span >40 minutes to solidify the </span><span >DNA agarose g</span><span >el.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:0em;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p style=" | + | <p > |
- | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">Ligation</span> | |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font- | + | <span style="font-size:14px;">1.</span><span style="font-size:14px;"> </span><span >Digestion for</span><span > Ligation</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:0em;"> |
- | + | <span >Reaction condition: 37°C for 2.5 hours.</span> | |
</p> | </p> | ||
- | < | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:0em;"> |
+ | <br/> | ||
+ | </p> | ||
+ | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;width:586px;border-collapse:collapse;border:none;"> | ||
<tbody> | <tbody> | ||
- | <tr | + | <tr style="height:42px;" class="firstRow"> |
- | <td style="border- | + | <td colspan="4" style="width:293px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">Insert(A) + Vector(B)</span> | + | <span style="font-family:Arial;">Insert(A) + Vector(B)</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td colspan="4" style="width:293px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:32px;text-align:center;"> |
- | + | <span style="font-family:Arial;">Vector (A) + Insert (B)</span> | |
</p> | </p> | ||
- | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:32px;text-align:center;"> | |
- | + | <br/> | |
- | + | ||
- | < | + | |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: 42px;"> | + | <tr style="height:42px;"> |
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">Insert(A)</span> | + | <span style="font-family:Arial;">Insert(A)</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">30</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">Vector(B)</span> | + | <span style="font-family:Arial;">Vector(B)</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">30</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=" | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=";">Insert( | + | <span style="font-family:Arial;">Insert(B)</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">30</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">Vector( | + | <span style="font-family:Arial;">Vector(A)</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">30</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | |||
</tr> | </tr> | ||
- | <tr style="height: 42px;"> | + | <tr style="height:42px;"> |
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style="; font-style: italic;">Eco</span><span style=";">R I</span> | + | <span style="font-family:Arial;font-style:italic;">Eco</span><span style="font-family:Arial;">R I</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">3</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style="; font-style: italic;">Eco</span><span style=";">R I</span> | + | <span style="font-family:Arial;font-style:italic;">Eco</span><span style="font-family:Arial;">R I</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">4. | + | <span style="font-family:Arial;">4.5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=" | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style="; font-style: italic;">Xba</span><span style=";"> I</span> | + | <span style="font-family:Arial;font-style:italic;">Xba</span><span style="font-family:Arial;"> I</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">3</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style="; font-style: italic;">Spe</span><span style=";"> I</span> | + | <span style="font-family:Arial;font-style:italic;">Spe</span><span style="font-family:Arial;"> I</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">4. | + | <span style="font-family:Arial;">4.5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | |||
</tr> | </tr> | ||
- | <tr style="height: 42px;"> | + | <tr style="height:42px;"> |
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style="; font-style: italic;">Spe</span><span style=";"> I</span> | + | <span style="font-family:Arial;font-style:italic;">Spe</span><span style="font-family:Arial;"> I</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">3</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style="; font-style: italic;">Xba</span><span style=";"> I</span> | + | <span style="font-family:Arial;font-style:italic;">Xba</span><span style="font-family:Arial;"> I</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">4. | + | <span style="font-family:Arial;">4.5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=" | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style="; font-style: italic;">Pst</span><span style=";"> I</span> | + | <span style="font-family:Arial;font-style:italic;">Pst</span><span style="font-family:Arial;"> I</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">3</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style="; font-style: italic;">Pst</span><span style=";"> I</span> | + | <span style="font-family:Arial;font-style:italic;">Pst</span><span style="font-family:Arial;"> I</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">4. | + | <span style="font-family:Arial;">4.5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | |||
</tr> | </tr> | ||
- | <tr style="height: 42px;"> | + | <tr style="height:42px;"> |
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">10×H | + | <span style="font-family:Arial;">10×H Buffer</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">4</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">10×M | + | <span style="font-family:Arial;">10×M Buffer</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">4</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">10×M | + | <span style="font-family:Arial;">10×M Buffer</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">4</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">10×H | + | <span style="font-family:Arial;">10×H Buffer</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">4</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | |||
</tr> | </tr> | ||
- | <tr style="height: 42px;"> | + | <tr style="height:42px;"> |
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">ddH</span><span style="; valign: sub;">2</span><span style=";">O</span> | + | <span style="font-family:Arial;">ddH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">O</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">0</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">ddH</span><span style="; valign: sub;">2</span><span style=";">O</span> | + | <span style="font-family:Arial;">ddH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">O</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">7</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=" | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=";">ddH</span><span style="; valign: sub;">2</span><span style=";">O</span> | + | <span style="font-family:Arial;">ddH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">O</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">0</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">ddH</span><span style="; valign: sub;">2</span><span style=";">O</span> | + | <span style="font-family:Arial;">ddH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">O</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">7</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | |||
</tr> | </tr> | ||
- | <tr style="height: 42px;"> | + | <tr style="height:42px;"> |
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">Total Volume</span> | + | <span style="font-family:Arial;">Total Volume</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">40</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">Total Volume</span> | + | <span style="font-family:Arial;">Total Volume</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">50</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">Total Volume</span> | + | <span style="font-family:Arial;">Total Volume</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:57px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">40</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:85px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">Total Volume</span> | + | <span style="font-family:Arial;">Total Volume</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">50</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
- | |||
</tr> | </tr> | ||
- | <tr style="height: | + | <tr style="height:0;"> |
- | <td style=" | + | <td style="width:85px;border:none;"></td> |
- | <td style=" | + | <td style="width:57px;border:none;"></td> |
- | <td style=" | + | <td style="width:85px;border:none;"></td> |
- | <td style=" | + | <td style="width:66px;border:none;"></td> |
- | <td style=" | + | <td style="width:85px;border:none;"></td> |
- | <td style=" | + | <td style="width:57px;border:none;"></td> |
- | <td style=" | + | <td style="width:85px;border:none;"></td> |
- | + | <td style="width:66px;border:none;"></td> | |
- | <td style=" | + | |
- | + | ||
</tr> | </tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
- | <p style=" | + | <p style="font-family:Times New Roman;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:0em;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style=" | + | <span style="font-size:14px;">2.</span><span style="font-size:14px;"> </span><span >Gel Extraction of DNA</span><span > (</span><span >Omega Gel Extraction K</span><span >it</span><span >)</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="; font- | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Perform</span><span > DNA gel electrophoresis</span><span > to fractionate DNA fragments.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="; font- | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >When adequate separation of bands has occurred, exci</span><span >se the DNA fragments of interest carefully.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Weigh in sterile 1.5 mL centrifuge tube</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span style=" | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Add</span><span style="font-family:Arial;"> </span><span >corresponding</span><span > volume of Binding Buffer (XP2)</span><span > into the centrifuge tube</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Heat the DNA/gel mixture at 55-65°C for 7 min, until the gel melt</span><span > completely</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Put</span><span > a HiBind DN</span><span >A Mini Column in a 2 mL</span><span > collection tube. Add the DNA/</span><span >gel</span><span > solution to the HiBind DNA Mini Column.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span style=" | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Centrifuge at 10000 x g for 1 min at room temperature.</span><span style="font-family:Arial;"> </span><span >Discard the flow-through liquid.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style=" | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Add 300 μL</span><span > Binding Buffer (XP2)</span><span > into the centrifuge tube</span><span >.</span><span > Centrifuge at </span><span >10</span><span >000 x g</span><span > for 1 minute at room temperature. Then discard the flow-through liquid.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Add 700 μL</span><span > SPW Wash Buffer (diluted with absolute ethanol). </span><span >Centrifuge at 10</span><span >000 x g for 1 min</span><span >ute</span><span > at room temperature. Then discard the flow-through liquid</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Repeat the previous step.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Centrifuge the empty HiBind Mini Column at ≥ 13000 x g for 2 min to spin-dry.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Place the HiBind </span><span >Mini Column into a </span><span >sterile</span><span > 1.5 mL</span><span > centrifuge tube. </span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >A</span><span >dd 3</span><span >0 μL Elution Buffer directly i</span><span >nto the </span><span >HiBind Mini C</span><span >olumn</span><span >. Sit </span><span >at room temperature for 2 minutes. Centrifuge</span><span > at maximum speed (≥ 13</span><span >000 x g)</span><span > for 1 min</span><span > to elute DNA.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Times New Roman;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font- | + | <span style="font-size:14px;">3.</span><span style="font-size:14px;"> </span><span >Ligation</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style=" | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Reaction condition: 16°C for 5-12 hours.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Measure</span><span > the concentration of DNA fragments and vector which are going to be ligated.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Calculate the volume</span><span > of insert </span><span >fragments </span><span >and vector </span><span >which should be added, based on the </span><span >formula: </span><img src="http://convert.wenku.baidu.com/rtcs/math?md5sum=50a7536e3d313010db05dc35e367433d.docx&math=23cce6a9e11a7f0381d4959dad7f64fd"/> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:28px;text-indent:-28px;"> |
- | <span style="font-family: Wingdings;"></span><span style="font-family: Wingdings;"> </span><span | + | <span style="font-family:Wingdings;"></span><span style="font-family:Wingdings;"> </span><span >Add </span><span >DNA fragments, vector, ligation buffer</span><span > and </span><span >T4 Ligase together in an</span><span > EP tube</span><span > as the table below</span><span >.</span> |
</p> | </p> | ||
- | <table style=" | + | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;"> |
<tbody> | <tbody> | ||
<tr class="firstRow"> | <tr class="firstRow"> | ||
- | <td style="border- | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">Insert</span> | + | <span style="font-family:Arial;">Insert</span><span style="font-family:Arial;"> Fragments</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">V</span><span style="; valign: sub;">1</span><span style=";"> | + | <span style="font-family:Arial;">V</span><span style="font-family:Arial;valign:sub;">1</span><span style="font-family:Arial;"> μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">Vector</span> | + | <span style="font-family:Arial;">Vector</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">V</span><span style="; valign: sub;">2 </span><span style=";"> | + | <span style="font-family:Arial;">V</span><span style="font-family:Arial;valign:sub;">2 </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">10</span><span style=";">×</span><span style=";"> | + | <span style="font-family:Arial;">10</span><span style="font-family:Arial;">×</span><span style="font-family:Arial;">Ligation B</span><span style="font-family:Arial;">uffer</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">1 | + | <span style="font-family:Arial;">1 μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">T4 Ligase</span> | + | <span style="font-family:Arial;">T4 Ligase</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">1 | + | <span style="font-family:Arial;">1 μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: 5px;"> | + | <tr style="height:5px;"> |
- | <td style=" | + | <td colspan="2" style="width:553px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">Add ddH</span><span style="; valign: sub;">2</span><span style=";">O until the total volume | + | <span style="font-family:Arial;">Add ddH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">O until the total volume equals</span><span style="font-family:Arial;"> 10.0</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: | + | <tr style="height:0;"> |
- | <td style=" | + | <td style="width:277px;border:none;"></td> |
- | <td style=" | + | <td style="width:277px;border:none;"></td> |
</tr> | </tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
- | <p | + | <p > |
- | <span | + | <span >Note</span><span >: </span><span >Mix</span><span >ing</span><span > the </span><span >ligation system well by pipetting up and down gently is</span><span > necessary</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Times New Roman;font-size:16px;"> |
- | < | + | <br/> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;"> |
- | <span style="font-family: | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">General PCR </span><span >(Polymerase Chain Reaction)</span> |
</p> | </p> | ||
- | <p style=";"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;"> |
- | <span | + | <span >PCR System</span> |
</p> | </p> | ||
- | < | + | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;"> |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
<tbody> | <tbody> | ||
<tr class="firstRow"> | <tr class="firstRow"> | ||
- | <td style="border- | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style="border: 1px | + | <span style="border:1px none #fff;"><span style="font-family:Arial;color:#fff;">Template</span></span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">1</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">Forward Primer</span> | + | <span style="font-family:Arial;">Forward Primer</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">2</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">Reverse Primer</span> | + | <span style="font-family:Arial;">Reverse Primer</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">2</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">dNTP Mixture</span> | + | <span style="font-family:Arial;">dNTP Mixture</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">2</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">10×PCR Buffer</span> | + | <span style="font-family:Arial;">10×PCR Buffer</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">r Taq (TakaRa)</span> | + | <span style="font-family:Arial;">r</span><span style="font-family:Arial;">Taq (TakaRa)</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">1</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">ddH</span><span style="; valign: sub;">2</span><span style=";">O</span> | + | <span style="font-family:Arial;">ddH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">O</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">37</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">Total Volume</span> | + | <span style="font-family:Arial;">Total Volume</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">50</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">μL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: | + | <tr style="height:0;"> |
- | <td style=" | + | <td style="width:277px;border:none;"></td> |
- | <td style=" | + | <td style="width:277px;border:none;"></td> |
</tr> | </tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
- | <p style="text-align: justify; text-indent: 0em | + | <p style="font-family:Times New Roman;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;"> |
- | < | + | <br/> |
+ | </p> | ||
+ | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;"> | ||
+ | <span >PCR Condition</span> | ||
</p> | </p> | ||
- | <table style=" | + | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;"> |
<tbody> | <tbody> | ||
<tr class="firstRow"> | <tr class="firstRow"> | ||
- | <td style="border- | + | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">1</span> | + | <span style="font-family:Arial;">1</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">94°C</span> | + | <span style="font-family:Arial;">94°C</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">min</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | + | <br/> | |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">2</span> | + | <span style="font-family:Arial;">2</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">94°C</span> | + | <span style="font-family:Arial;">94°C</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">30</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">s</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td rowspan="3" style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">30 loops</span> | + | <span style="font-family:Arial;">30 loops</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">3</span> | + | <span style="font-family:Arial;">3</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">Tm°C</span> | + | <span style="font-family:Arial;">Tm°C</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">30</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">s</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">4</span> | + | <span style="font-family:Arial;">4</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">72°C</span> | + | <span style="font-family:Arial;">72°C</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">1 min/kb</span> | + | <span style="font-family:Arial;">1 min/kb</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: 5px;"> | + | <tr style="height:5px;"> |
- | <td style=" | + | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">5</span> | + | <span style="font-family:Arial;">5</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">72°C</span> | + | <span style="font-family:Arial;">72°C</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">10</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">min</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | + | <br/> | |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: 5px;"> | + | <tr style="height:5px;"> |
- | <td style=" | + | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">6</span> | + | <span style="font-family:Arial;">6</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";">15°C</span> | + | <span style="font-family:Arial;">15°C</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">min</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: | + | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> |
- | + | <br/> | |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: | + | <tr style="height:0;"> |
- | <td style=" | + | <td style="width:137px;border:none;"></td> |
- | <td style=" | + | <td style="width:149px;border:none;"></td> |
- | <td style=" | + | <td style="width:140px;border:none;"></td> |
- | <td style=" | + | <td style="width:127px;border:none;"></td> |
</tr> | </tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
- | <p style=" | + | <p style="font-family:Times New Roman;font-size:21px;"> |
- | + | <br/> | |
- | </ | + | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:21px;"> |
- | <span style="font-family: | + | <span style="font-family:Arial;font-weight:700;font-size:21px;">Conic curve formation</span> |
</p> | </p> | ||
- | <p style="; font-size: | + | <p > |
- | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">Medium: </span><span style="font-family:Arial;font-weight:700;font-size:16px;">M63 </span><span style="font-family:Arial;font-weight:700;font-size:16px;valign:sup;">[1]</span><span style="font-family:Arial;font-weight:700;font-size:16px;"> </span><span style="font-family:Arial;font-weight:700;font-size:16px;">semi-solid medium preparation</span> | |
</p> | </p> | ||
- | <table style=" | + | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;"> |
<tbody> | <tbody> | ||
<tr class="firstRow"> | <tr class="firstRow"> | ||
- | <td style="padding: 0px 7px; border: 1px solid | + | <td colspan="2" style="width:553px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style="text-align: center | + | <p style="font-family:Arial;text-align:center;"> |
- | <span style=";">M63 semi-solid medium/ | + | <span style="font-family:Arial;">M63 semi-solid medium/100</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">mL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">Ingredients</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">Quantities</span> | + | <span style="font-family:Arial;">Quantities</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">KH</span><span style="; valign: sub;">2</span><span style=";">PO</span><span style="; valign: sub;">4</span> | + | <span style="font-family:Arial;">KH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">PO</span><span style="font-family:Arial;valign:sub;">4</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">1. | + | <span style="font-family:Arial;">1.36</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">KOH</span> | + | <span style="font-family:Arial;">KOH</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0. | + | <span style="font-family:Arial;">0.42</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">(NH</span><span style="; valign: sub;">4</span><span style=";">)</span><span style="; valign: sub;">2</span><span style=";">SO</span><span style="; valign: sub;">4</span> | + | <span style="font-family:Arial;">(NH</span><span style="font-family:Arial;valign:sub;">4</span><span style="font-family:Arial;">)</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">SO</span><span style="font-family:Arial;valign:sub;">4</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0. | + | <span style="font-family:Arial;">0.2</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">MgSO</span><span style="; valign: sub;">4</span> | + | <span style="font-family:Arial;">MgSO</span><span style="font-family:Arial;valign:sub;">4</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0. | + | <span style="font-family:Arial;">0.012</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">Agar( gel strength>750 g/cm</span><span style="; valign: sup;">2</span><span style=";">)</span> | + | <span style="font-family:Arial;">Agar( gel strength>750 g/cm</span><span style="font-family:Arial;valign:sup;">2</span><span style="font-family:Arial;">)</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0. | + | <span style="font-family:Arial;">0.25</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">H</span><span style="; valign: sub;">2</span><span style=";">O</span> | + | <span style="font-family:Arial;">H</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">O</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;valign:sup;">1</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">96</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">mL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">Glycerol</span> | + | <span style="font-family:Arial;">Glycerol</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0. | + | <span style="font-family:Arial;">0.2</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">mL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">FeSO</span><span style="; valign: sub;">4 | + | <span style="font-family:Arial;">FeSO</span><span style="font-family:Arial;valign:sub;">4</span><span style="font-family:Arial;valign:sub;"> </span><span style="font-family:Arial;valign:sup;">2</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">10.84*10</span><span style="; valign: sup;">-4</span><span style=";">g</span> | + | <span style="font-family:Arial;">10.84*10</span><span style="font-family:Arial;valign:sup;">-4</span><span style="font-family:Arial;valign:sup;"> </span><span style="font-family:Arial;">g</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">D-glucose</span> | + | <span style="font-family:Arial;">D-glucose</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0. | + | <span style="font-family:Arial;">0.4</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span><span style="font-family:Arial;"> </span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">Asp | + | <span style="font-family:Arial;">Asp</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;valign:sup;">3</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">6.6*10</span><span style="; valign: sup;">- | + | <span style="font-family:Arial;">6.6*10</span><span style="font-family:Arial;valign:sup;">-6</span><span style="font-family:Arial;valign:sup;"> </span><span style="font-family:Arial;">g</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">Met, Leu, His, Thr (0. | + | <span style="font-family:Arial;">Met, Leu, His, Thr (0.015</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g/mL)</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;valign:sup;">4</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">1</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">mL</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: | + | <tr style="height:0;"> |
- | <td style=" | + | <td style="width:277px;border:none;"></td> |
- | <td style=" | + | <td style="width:277px;border:none;"></td> |
</tr> | </tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
- | <p style=";"> | + | <p style="font-family:Times New Roman;font-size:16px;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p | + | <p > |
- | <span | + | <span >Note</span><span >:</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">1.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">1.</span><span style="font-size:14px;"> </span><span >Add</span><span > 0.25</span><span > </span><span >g Agar into a erlenmeyer flask first, then pour into 96</span><span > </span><span >mL H</span><span style="font-family:Arial;font-size:16px;valign:sub;">2</span><span >O, shaking up</span><span >, continue to add</span><span > glycerol using </span><span >pipette</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">2.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">2.</span><span style="font-size:14px;"> </span><span >Add 10</span><span > </span><span >μL 0.1</span><span > </span><span >g/mL FeSO</span><span style="font-family:Arial;font-size:16px;valign:sub;">4</span><span > solution into the medium.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">3.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">3.</span><span style="font-size:14px;"> </span><span >Add 10</span><span > </span><span >μL 66</span><span > </span><span >mg/mL Asp solution into the medium.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">4.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">4.</span><span style="font-size:14px;"> </span><span >Met, Leu, His, Thr could be premixed for convenience, and the amino acid should be added by injector through 0.22</span><span > </span><span >μ</span><span >m filter membrane. Pay attention that this process must be carried out after high temperature sterilization of the M63 semi-solid medium.</span> |
</p> | </p> | ||
- | <p style=";"> | + | <p style="font-family:Times New Roman;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:0em;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p style="; font-size: | + | <p > |
- | + | <span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;">I</span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;">. </span><span style="font-family:Arial;font-weight:700;font-size:16px;">Mix-doting bacteria</span><span style="font-family:Arial;font-weight:700;font-size:16px;">, inductor and inhibitor on </span><span style="font-family:Arial;font-weight:700;font-size:16px;">M63 </span><span style="font-family:Arial;font-weight:700;font-size:16px;">semi-solid medium</span><span style="font-family:Arial;font-weight:700;font-size:16px;"> plate</span><span style="font-family:Arial;font-weight:700;font-size:16px;"> </span><span style="font-family:Arial;font-weight:700;font-size:16px;valign:sup;">[2]</span> | |
</p> | </p> | ||
- | <p style=";"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style=";">1. | + | <span style="font-size:14px;">1.</span><span style="font-size:14px;"> </span><span >Pour 20</span><span > </span><span >ml M63 semi</span><span >-solid medium on a</span><span > pla</span><span >te, leave the </span><span >plate </span><span >air-dried for 90 min </span><span >in </span><span >laminar flow clean bench.</span> |
</p> | </p> | ||
- | <p style=";"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style=";">2. | + | <span style="font-size:14px;">2.</span><span style="font-size:14px;"> </span><span >Dot</span><span > 15</span><span > </span><span >μ</span><span >L inductor (IPTG) or inhibitor (</span>L-Arabinose<span >) on the plate through</span><span > pipette, take care when </span><span >insert the tip into the medium. L</span><span >eave the </span><span >plate </span><span >air-dried for 20 min in </span><span >laminar flow clean bench</span><span >.</span> |
</p> | </p> | ||
- | <p style=";"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style=";">3. | + | <span style="font-size:14px;">3.</span><span style="font-size:14px;"> </span><span >Dot 3</span><span > </span><span >μ</span><span >L culture medium at the </span><span >same </span><span >position of</span><span > the inductor (IPTG) or inhibitor (</span>L-Arabinose<span >),</span><span > leave the </span><span >plate </span><span >air-dried for 5 min in </span><span >laminar flow clean bench</span><span >.</span> |
</p> | </p> | ||
- | <p style=";"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style=";">4. | + | <span style="font-size:14px;">4.</span><span style="font-size:14px;"> </span><span >Seal</span><span > the plate</span><span >.</span> |
</p> | </p> | ||
- | <p style=";"> | + | <p style="font-family:Times New Roman;font-size:16px;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p style="; font-size: | + | <p > |
- | + | <span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;">II</span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;">. </span><span style="font-family:Arial;font-weight:700;font-size:16px;">Lineation</span><span style="font-family:Arial;font-weight:700;font-size:16px;"> of inductor and inhibitor on the M63 semi</span><span style="font-family:Arial;font-weight:700;font-size:16px;">-</span><span style="font-family:Arial;font-weight:700;font-size:16px;">solid medium plate</span> | |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">1.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">1.</span><span style="font-size:14px;"> </span><span >Pour 20 mL</span><span > M63 semi</span><span >-solid medium on a</span><span > plate,</span><span > leave the </span><span >plate </span><span >air-dried for 90 min in </span><span >laminar flow clean bench</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">2.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">2.</span><span style="font-size:14px;"> </span><span >Inhale 15</span><span > </span><span >μ</span><span >L inductor (IPTG) or inhibitor (</span>L-Arabinose<span >), doting along the line pre-pianted carefully, bear in mind don’t destroy the semi</span><span >-</span><span >solid medium when moving along the line.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">3.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">3.</span><span style="font-size:14px;"> </span><span >Leave the </span><span >plate </span><span >air-dried for 90 min in </span><span >laminar flow clean bench.</span> |
</p> | </p> | ||
- | <p style="text-align: | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | + | <span style="font-size:14px;">4.</span><span style="font-size:14px;"> </span><span >Repeat the process mix-doting bacteria, inductor and inhibitor on M63 semi-solid medium plate.</span> | |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Times New Roman;font-size:16px;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p style="text-align: | + | <p style="font-family:Arial;font-size:21px;text-align:left;"> |
- | <span style="font-family: | + | <span style="font-family:Arial;font-weight:700;font-size:21px;">Characterization the activity of promoter and efficiency of RBS by chemotaxis</span> |
</p> | </p> | ||
- | <p style="font-family: | + | <p style="font-family:Arial;font-size:16px;text-align:left;"> |
- | <span style="font-family: | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">culture</span> |
</p> | </p> | ||
- | <p style=";"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style=";"> | + | <span style="font-size:14px;">1.</span><span style="font-size:14px;"> </span><span >Add</span><span > 50</span><span > </span><span >μL bacterium solution (pLac-RBS (1.0)-</span><span style="font-family:Arial;font-style:italic;font-size:16px;">CheZ</span><span >-TT,</span><span > </span><span >pLac-RBS (0.3)-</span><span style="font-family:Arial;font-style:italic;font-size:16px;">CheZ</span><span >-TT, </span><span >pLac-RBS (0.01)-</span><span style="font-family:Arial;font-style:italic;font-size:16px;">CheZ</span><span >-TT,</span><span >) into 5</span><span > </span><span >mL</span><span > fresh LB liquid medium</span><span >,</span><span > in which</span><span > chloromyce</span><span >tin concentration is 50</span><span > μ</span><span >g/ml.</span> |
</p> | </p> | ||
- | <p style=";"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style=";"> | + | <span style="font-size:14px;">2.</span><span style="font-size:14px;"> </span><span >Culture overnight under the condition of 37°C, 200 rpm.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font- | + | <span style="font-size:14px;">3.</span><span style="font-size:14px;"> </span><span >Add</span><span > 50</span><span > </span><span >μL bacterium solution from the LB </span><span >liq</span><span >uid medium above to another 5 mL</span><span > fresh</span><span > </span><span >LB liquid medium</span><span >,</span><span > in which </span><span >chloromycetin concentration is 50</span><span > </span><span >μ</span><span >g/mL</span><span >.</span> |
</p> | </p> | ||
- | <p style=";"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style=";"> | + | <span style="font-size:14px;">4.</span><span style="font-size:14px;"> </span><span >Culture under the condition of 37°C, 200 rpm </span><span >for 3 hours.</span><span > Stock </span><span >it in 4</span><span >°C.</span> |
</p> | </p> | ||
- | <p style="font-family: | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font- | + | <span style="font-size:14px;">5.</span><span style="font-size:14px;"> </span><span >Prepare M63 semi-solid medium as above.</span> |
</p> | </p> | ||
- | <p style=";"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style=";"> | + | <span style="font-size:14px;">6.</span><span style="font-size:14px;"> </span><span >D</span><span >raw three dots on a </span><span >M63 semi-solid medium plate first</span><span >, then</span><span > </span><span >inoculate</span><span > the three kind</span><span >s</span><span > of bacterium solution </span><span >at the three</span><span > dot</span><span >s, respectively</span><span >.</span><span > The volume</span><span > </span><span >of the </span><span >inoculate</span><span >d bacterium solution is 3 μL.</span> |
</p> | </p> | ||
- | <p style="text-align: left; ; font-size: 14px;"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | + | <span style="font-size:14px;">7.</span><span style="font-size:14px;"> </span><span >C</span><span >ulture in incubator at 37</span><span >°C</span><span >.</span> | |
</p> | </p> | ||
- | <p style="text-align: left; | + | <p style="font-family:Times New Roman;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:0em;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p | + | <p > |
- | <span style=" | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">Measurement </span> |
</p> | </p> | ||
- | <p style="; font-size: 16px;"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="; font-size: | + | <span style="font-size:14px;">1.</span><span style="font-size:14px;"> </span><span >Use a ruler t</span><span >o measure the radius</span><span > of colony</span><span > from the bottom of the semi-solid medium</span><span > plate</span><span >. The initial colony radius is recorded as R</span><span style="font-family:Arial;font-size:16px;valign:sub;">1</span><span >, and the </span><span >radiuses</span><span > measured at 12h, 24h, 30h, 36h, 42h... as R2, R3, R4, R5, R6, R7…</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | + | <span style="font-size:14px;">2.</span><span style="font-size:14px;"> </span><span >R</span><span >ecord time and diameter</span><span > in a</span><span style="font-family:Arial;"> </span><span >table.</span> | |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | + | <span style="font-size:14px;">3.</span><span style="font-size:14px;"> </span><span >Process</span><span > data with excel.</span> | |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Times New Roman;font-size:16px;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:21px;text-align:left;"> |
- | + | <span style="font-family:Arial;font-weight:700;font-size:21px;">B</span><span style="font-family:Arial;font-weight:700;font-size:21px;">lack hole</span> | |
</p> | </p> | ||
- | <p | + | <p > |
- | <span style=" | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">Plasmid Construction</span> |
</p> | </p> | ||
- | <p style="; font-size: 16px;"> | + | <p > |
- | + | <span style="font-family:Arial;color:#fff;font-size:16px;">All DNA parts applied in these experiments came from the MIT Registry of Standard Biological Parts.</span><span style="font-family:Arial;color:#fff;font-size:16px;"> The new BioBrick part, P</span><span style="font-family:Arial;color:#fff;font-size:16px;">ompC</span><span style="font-family:Arial;color:#fff;font-size:16px;">-</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;">cheZ </span><span style="font-family:Arial;color:#fff;font-size:16px;">(BBa_K1412010)</span><span style="font-family:Arial;color:#fff;font-size:16px;"> was formed by ligating the pre-existing parts, </span><span style="font-family:Arial;color:#fff;font-size:16px;">P</span><span style="font-family:Arial;color:#fff;font-size:16px;">ompC</span><span style="styleName:A17;font-family:Utopia Std;color:#fff;font-size:7px;font-family:Arial;font-size:16px;"> </span><span style="font-family:Arial;color:#fff;font-size:16px;">(BBa_R0082) and </span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;">cheZ</span><span style="styleName:A17;font-family:Utopia Std;color:#fff;font-size:7px;font-family:Arial;font-size:16px;"> </span><span style="font-family:Arial;color:#fff;font-size:16px;">(BBa_K629003). The E.Z.N.A.</span><span style="font-family:Arial;color:#fff;font-size:16px;valign:sup;">TM</span><span style="font-family:Arial;color:#fff;font-size:16px;"> Plasmid Mini Kit </span><span style="font-family:Arial;color:#fff;font-size:16px;"></span><span style="font-family:Arial;color:#fff;font-size:16px;"></span><span style="font-family:Arial;color:#fff;font-size:16px;"></span><span style="font-family:Arial;color:#fff;font-size:16px;">I</span><span style="font-family:Arial;color:#fff;font-size:16px;"></span><span style="font-family:Arial;color:#fff;font-size:16px;"> (200) was used according to the manufacturer’s instructions to extract plasmid DNA. Bio</span><span style="font-family:Arial;color:#fff;font-size:16px;">Brick parts were digested with restriction enzymes,</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> Eco</span><span style="font-family:Arial;color:#fff;font-size:16px;">RI, </span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;">Xba</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> </span><span style="font-family:Arial;color:#fff;font-size:16px;">I, </span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;">Spe</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> </span><span style="font-family:Arial;color:#fff;font-size:16px;">I, and</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> Pst</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> </span><span style="font-family:Arial;color:#fff;font-size:16px;">I</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> </span><span style="font-family:Arial;color:#fff;font-size:16px;">to produce ‘sticky ends’ that were used to com</span><span style="font-family:Arial;color:#fff;font-size:16px;">bine BioBrick parts. Digested DNA was purified using 1% aga</span><span style="font-family:Arial;color:#fff;font-size:16px;">rose gel electrophoresis followed by gel purification with the E.Z.N.A.TM Gel Extraction Kit (200). BioBrick parts with matching ‘sticky ends’ were ligated using T4 ligase produced by Takara Biotechnology (Dalian) Co., Ltd. (Takara Dalian). Plasmid DNA was transformed into DH5α</span> | |
</p> | </p> | ||
- | <p style="; font-size: 16px;"> | + | <p > |
- | + | <span style="font-family:Arial;color:#fff;font-size:16px;"> first</span><span style="font-family:Arial;color:#fff;font-size:16px;">. Then we began a new circulation consisting of extracting plasmids, digestion and</span><span style="font-family:Arial;color:#fff;font-size:16px;"> DNA gel electrophoresis</span><span style="font-family:Arial;color:#fff;font-size:16px;"> to</span><span > </span><span style="font-family:Arial;color:#fff;font-size:16px;">confirm</span><span style="font-family:Arial;color:#fff;font-size:16px;"> the success of the ligation. Finally, the construct was sequenced for verifica</span><span style="font-family:Arial;color:#fff;font-size:16px;">tion.</span> | |
</p> | </p> | ||
- | < | + | <p style="styleName:mw-headline;styleName:Default Paragraph Font;font-family:Times New Roman;font-size:16px;"> |
+ | <br/> | ||
+ | </p> | ||
+ | <p style="styleName:mw-headline;styleName:Default Paragraph Font;font-family:Arial;font-size:16px;"> | ||
+ | <span style="styleName:mw-headline;styleName:Default Paragraph Font;font-family:Arial;font-weight:700;color:#fff;font-size:16px;">Construction of </span><span style="styleName:mw-headline;styleName:Default Paragraph Font;font-family:Arial;font-weight:700;font-style:italic;color:#fff;font-size:16px;">E. coli</span><span style="styleName:mw-headline;styleName:Default Paragraph Font;font-family:Arial;font-weight:700;color:#fff;font-size:16px;"> strain </span><span style="styleName:mw-headline;styleName:Default Paragraph Font;font-family:Arial;font-weight:700;color:#fff;font-size:16px;">CL-1</span> | ||
+ | </p> | ||
+ | <p style="styleName:mw-headline;styleName:Default Paragraph Font;font-family:Arial;font-size:16px;"> | ||
+ | <span style="font-family:Arial;color:#fff;font-size:16px;">The new biob</span><span style="font-family:Arial;color:#fff;font-size:16px;">rick part, P</span><span style="font-family:Arial;color:#fff;font-size:16px;">ompC</span><span style="font-family:Arial;color:#fff;font-size:16px;">-</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;">cheZ </span><span style="font-family:Arial;color:#fff;font-size:16px;">(BBa_K141</span><span style="font-family:Arial;color:#fff;font-size:16px;">2010) on pSB1C3 was introduced </span><span style="font-family:Arial;color:#fff;font-size:16px;">i</span><span style="font-family:Arial;color:#fff;font-size:16px;">nto </span><span style="font-family:Arial;font-weight:700;font-style:italic;color:#fff;font-size:16px;">E. coli</span><span style="font-family:Arial;color:#fff;font-size:16px;"> strain </span><span style="font-family:Arial;color:#fff;font-size:16px;">CL-1</span><span style="font-family:Arial;color:#fff;font-size:16px;">,</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> </span><span style="font-family:Arial;color:#fff;font-size:16px;">whose gene of</span><span style="font-family:Arial;font-style:italic;color:#fff;font-size:16px;"> cheZ</span><span style="font-family:Arial;color:#fff;font-size:16px;"> had been knocked out.</span><span style="font-family:Arial;color:#fff;font-size:16px;"> </span> | ||
+ | </p> | ||
+ | <p style="font-family:Times New Roman;font-size:16px;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | <p > | ||
+ | <span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;">I</span><span style="font-family:Arial;font-weight:700;font-size:16px;"></span><span style="font-family:Arial;font-weight:700;font-size:16px;">. Gradient Plate Experiments (semi-solid medium, Cm 50μg/ml)</span> | ||
+ | </p> | ||
+ | <p > | ||
+ | <span style="font-family:Arial;font-weight:700;font-size:16px;">Medium: </span><span >Medium A</span><span > </span><span style="font-family:Arial;font-size:16px;valign:sup;">[</span><span style="font-family:Arial;font-size:16px;valign:sup;">3</span><span style="font-family:Arial;font-size:16px;valign:sup;">]</span><span style="font-family:Arial;font-size:16px;valign:sup;"> </span><span >(Improved)</span> | ||
+ | </p> | ||
+ | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;"> | ||
<tbody> | <tbody> | ||
<tr class="firstRow"> | <tr class="firstRow"> | ||
- | <td style="padding: 0px 7px; border: 1px solid | + | <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">Ingredients</span> | + | <span style="font-family:Arial;">Ingredients</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">Percent (g/mL)</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">Yeast Extract</span> | + | <span style="font-family:Arial;">Yeast Extract</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0.26%</span> | + | <span style="font-family:Arial;">0.26%</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">Peptone</span> | + | <span style="font-family:Arial;">Peptone</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0.27%</span> | + | <span style="font-family:Arial;">0.27%</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">K</span><span style="; valign: sub;">2</span><span style=";">HPO</span><span style="; valign: sub;">4</span> | + | <span style="font-family:Arial;">K</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">HPO</span><span style="font-family:Arial;valign:sub;">4</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0.37%</span> | + | <span style="font-family:Arial;">0.37%</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">KH</span><span style="; valign: sub;">2</span><span style=";">PO</span><span style="; valign: sub;">4</span> | + | <span style="font-family:Arial;">KH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">PO</span><span style="font-family:Arial;valign:sub;">4</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0.13%</span> | + | <span style="font-family:Arial;">0.13%</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">NaCl</span> | + | <span style="font-family:Arial;">NaCl</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0.05%</span> | + | <span style="font-family:Arial;">0.05%</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">Glycerol</span> | + | <span style="font-family:Arial;">Glycerol</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0.2%</span> | + | <span style="font-family:Arial;">0.2%</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: | + | <tr style="height:0;"> |
- | <td style=" | + | <td style="width:276px;border:none;"></td> |
- | <td style=" | + | <td style="width:277px;border:none;"></td> |
</tr> | </tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
- | <p style="; font-size: 16px;"> | + | <p style="font-family:Times New Roman;font-size:16px;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p | + | <p > |
- | <span style=" | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">Sucrose concentration gradient: </span><span >0~20%, the concentration gradient was 2%.</span> |
</p> | </p> | ||
- | <p style="; font-size: 16px;"> | + | <p style="font-family:Times New Roman;font-size:16px;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p | + | <p > |
- | <span style=" | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">Mid-log-phase c</span><span style="font-family:Arial;font-weight:700;font-size:16px;">ell suspensions </span><span style="font-family:Arial;font-weight:700;font-size:16px;">preparation</span><span style="font-family:Arial;font-weight:700;font-size:16px;">:</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">1.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">1.</span><span style="font-size:14px;"> </span><span >Overnight culture</span><span > of the required strain grow</span><span > at 37 °C in Medium A</span><span style="font-family:Arial;font-size:16px;valign:sup;"> </span><span >(Improved) </span><span >containing appropriate</span><span > chloramphenicol</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">2.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">2.</span><span style="font-size:14px;"> </span><span >Dilute the overnight culture</span><span > a</span><span >t</span><span > </span><span >the ratio of 1:100 in fresh culture</span><span > (Medium A)</span><span >, then </span><span >incub</span><span >ate the culture</span><span > </span><span >under the condition of 37°C, 200 rpm</span><span >, until </span><span >its</span><span > OD590 reaches</span><span > 0.2</span><span >.</span><span > </span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">3.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">3.</span><span style="font-size:14px;"> </span><span >Stock</span><span > in 4</span><span >°C.</span> |
</p> | </p> | ||
- | <p style="; font-size: 16px;"> | + | <p style="font-family:Times New Roman;font-size:16px;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p | + | <p > |
- | <span style=" | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">The method of </span><span style="font-family:Arial;font-weight:700;font-size:16px;">preparing </span><span style="font-family:Arial;font-weight:700;font-size:16px;">gradient semi-solid medium</span><span style="font-family:Arial;font-weight:700;font-size:16px;"> (0.25% agar)</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">1.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">1.</span><span style="font-size:14px;"> </span><span >P</span><span >repare 100% sucrose solution</span><span >. </span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">2.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">2.</span><span style="font-size:14px;"> </span><span >P</span><span >repare the medium with tripled ingredients amount</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">3.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">3.</span><span style="font-size:14px;"> </span><span >Put the 100% sucrose solution, the prepared medium and plenty of deionized water into the autoclave for 121</span><span >°C</span><span >, 20 minutes.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">4.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">4.</span><span style="font-size:14px;"> </span><span >After sterilization, put the 100% sucrose solution, the prepared medium and the deionized water into </span><span >a </span><span >drying oven for around 10 minutes</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">5.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">5.</span><span style="font-size:14px;"> </span><span >Take 5</span><span > </span><span >mL</span><span > tripled Medium A</span><span > (Improved) </span><span >into a 25</span><span > </span><span >mL</span><span > erlenmeyer flask, then </span><span >add</span><span > appropriate volume of</span><span > 100% </span><span >sucrose solution into </span><span >the </span><span >erlenmeyer flask</span><span >, while the </span><span >shortage </span><span >will be complemented by deionized water</span><span > to make the total volume to be 15</span><span > </span><span >mL</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">6.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">6.</span><span style="font-size:14px;"> </span><span >Add </span><span >15</span><span > </span><span >μL</span><span > chloramphenicol</span><span > into the erlenmeyer flask.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">7.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">7.</span><span style="font-size:14px;"> </span><span >Pour </span><span >the mixture into a</span><span > </span><span >Petri dish</span><span > (85 mm dia.)</span><span > as quickly as possible.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">8.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">8.</span><span style="font-size:14px;"> </span><span >Leave the </span><span >plate </span><span >air-dried for 90 min in laminar flow clean bench.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">9.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">9.</span><span style="font-size:14px;"> </span><span >After solidification of the media, cell suspensions from mid-log-phase cultures (</span><span >3</span><span > </span><span >μL</span><span >) were </span><span >inoculated</span><span > in the center of the plate.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">10.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">10.</span><span style="font-size:14px;"> </span><span >Leave </span><span >the plate dried</span><span > </span><span >in air for </span><span >15 min</span><span > </span><span >in laminar flow clean bench.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">11.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">11.</span><span style="font-size:14px;"> </span><span >Leave the plate incubated at 37</span><span >°C. During the period of time, </span><span >measure</span><span > the di</span><span >ameters of the colony and take</span><span > them down.</span> |
</p> | </p> | ||
- | <p style="; font-size: | + | <p style="font-family:Times New Roman;font-size:16px;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p | + | <p > |
- | <span | + | <span ></span><span ></span><span ></span><span >II</span><span ></span><span >.</span><span style="font-family:Arial;font-weight:700;font-size:16px;"> Plates Crossed Experiments (semi-solid medium, Cm 50μg/ml)</span> |
</p> | </p> | ||
- | <p | + | <p > |
- | <span style=" | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">Medium: </span><span >half Medium A</span><span style="font-family:Arial;font-size:16px;valign:sup;"> </span><span >(Improved)</span> |
</p> | </p> | ||
- | <table style=" | + | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;"> |
<tbody> | <tbody> | ||
<tr class="firstRow"> | <tr class="firstRow"> | ||
- | <td style="padding: 0px 7px; border: 1px solid | + | <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">Ingredients</span> | + | <span style="font-family:Arial;">Ingredients</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style="border- | + | <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";"> | + | <span style="font-family:Arial;">Percent (g/mL)</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">Yeast Extract</span> | + | <span style="font-family:Arial;">Yeast Extract</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0.13%</span> | + | <span style="font-family:Arial;">0.13%</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">Peptone</span> | + | <span style="font-family:Arial;">Peptone</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0.135%</span> | + | <span style="font-family:Arial;">0.135%</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">K</span><span style="; valign: sub;">2</span><span style=";">HPO</span><span style="; valign: sub;">4</span> | + | <span style="font-family:Arial;">K</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">HPO</span><span style="font-family:Arial;valign:sub;">4</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0.195%</span> | + | <span style="font-family:Arial;">0.195%</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">KH</span><span style="; valign: sub;">2</span><span style=";">PO</span><span style="; valign: sub;">4</span> | + | <span style="font-family:Arial;">KH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">PO</span><span style="font-family:Arial;valign:sub;">4</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0.065%</span> | + | <span style="font-family:Arial;">0.065%</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">NaCl</span> | + | <span style="font-family:Arial;">NaCl</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0.025%</span> | + | <span style="font-family:Arial;">0.025%</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td style=" | + | <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">Glycerol</span> | + | <span style="font-family:Arial;">Glycerol</span> |
</p> | </p> | ||
</td> | </td> | ||
- | <td style=" | + | <td style="width:284px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> |
- | <p style=";"> | + | <p style="font-family:Arial;"> |
- | <span style=";">0.1%</span> | + | <span style="font-family:Arial;">0.1%</span> |
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
- | <tr style="height: | + | <tr style="height:0;"> |
- | <td style=" | + | <td style="width:277px;border:none;"></td> |
- | <td style=" | + | <td style="width:276px;border:none;"></td> |
</tr> | </tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
- | <p style="; font-size: | + | <p style="font-family:Times New Roman;font-size:16px;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p | + | <p > |
- | <span style=" | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">The concentration of sucrose: </span><span >0%, 10%</span> |
</p> | </p> | ||
- | <p style="; font-size: 16px;"> | + | <p style="font-family:Times New Roman;font-size:16px;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p | + | <p > |
- | <span style=" | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">The method of preparing liquid medium containing different concentrations of sucrose:</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">1.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">1.</span><span style="font-size:14px;"> </span><span >Prepare the medium with corresponding ingredients amount in the table above.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">2.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">2.</span><span style="font-size:14px;"> </span><span >Add corresponding amount of solid sucrose into the liquid medium</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">3.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">3.</span><span style="font-size:14px;"> </span><span >Wait for sterilization.</span> |
</p> | </p> | ||
- | <p style="; font-size: | + | <p style="font-family:Times New Roman;font-size:16px;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p | + | <p > |
- | <span style=" | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">Mid-log-phase cell suspensions preparation: </span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">1.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">1.</span><span style="font-size:14px;"> </span><span >Overnight culture of</span><span > the required strain grow at 37</span><span >°C in Medium A</span><span style="font-family:Arial;font-size:16px;valign:sup;"> </span><span >(I</span><span >mproved) containing appropriate</span><span > chloramphenicol.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">2.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">2.</span><span style="font-size:14px;"> </span><span >Dilute the overnight culture at the ratio of 1:100 in fresh culture (half Medium A), then incubate the culture </span><span >under the condition of 37°C, 200 rpm</span><span >, until its OD590 reaches 0.2. </span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">3.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">3.</span><span style="font-size:14px;"> </span><span >Stock in 4°C.</span> |
</p> | </p> | ||
- | <p style="; font-size: | + | <p style="font-family:Times New Roman;font-size:16px;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p | + | <p > |
- | <span style=" | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">The method of preparing semi-solid medium</span><span style="font-family:Arial;font-weight:700;font-size:16px;"> with a cross</span><span style="font-family:Arial;font-weight:700;font-size:16px;"> (0.25% agar)</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">1.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">1.</span><span style="font-size:14px;"> </span><span >Prepare the medium with corresponding ingredients amount in the table above.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">2.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">2.</span><span style="font-size:14px;"> </span><span >Put the</span><span > </span><span >medium</span><span > containing agar, the liquid medium containing sucrose and plenty of deionized water </span><span >into the autoclave for 121</span><span >°C, 20 minutes.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">3.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">3.</span><span style="font-size:14px;"> </span><span >After sterilization, put the medium</span><span >s and the deionized water</span><span > into a drying oven for around 10 minutes.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">4.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">4.</span><span style="font-size:14px;"> </span><span >Take 15</span><span > </span><span >mL</span><span > of the medium</span><span > containing agar</span><span > into a 25</span><span > </span><span >mL</span><span > erlenmeyer flask</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">5.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">5.</span><span style="font-size:14px;"> </span><span >Add 15</span><span > </span><span >μL </span><span >chloramphenicol</span><span > into the erlenmeyer flask.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">6.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">6.</span><span style="font-size:14px;"> </span><span >Pour the mixture into a </span><span >Petri dish (85 mm dia.)</span><span > as quickly as possible.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">7.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">7.</span><span style="font-size:14px;"> </span><span >Leave the </span><span >plate </span><span >air-dried for 90 min in laminar flow clean bench.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">8.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">8.</span><span style="font-size:14px;"> </span><span >After solidification of the media, </span><span >draw a cross composed of two stra</span><span >ight lines on the plate, by the way of</span><span > Intensive RBI (1 μL</span><span >/mm). O</span><span >ne straight line is</span><span > </span><span >dotted with water, the other is</span><span > dotted with liquid medium containing 10% sucrose.</span><span > The length of the lines is</span><span > 6 centimeters.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">9.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">9.</span><span style="font-size:14px;"> </span><span >Leave th</span><span >e plate dried in air for 15 min </span><span >in laminar flow clean bench.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">10.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">10.</span><span style="font-size:14px;"> </span><span >C</span><span >ell suspensions from mid-log-phase cultures (</span><span >3</span><span > </span><span >μL</span><span >) is</span><span > inoculated </span><span >at </span><span >the cross point</span><span >.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">11.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">11.</span><span style="font-size:14px;"> </span><span >Leave th</span><span >e plate dried in air for 15 min </span><span >in laminar flow clean bench.</span> |
</p> | </p> | ||
- | <p style=" | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | <span style="font-size: 14px;">12.</span><span style="font-size: 14px;"> </span><span | + | <span style="font-size:14px;">12.</span><span style="font-size:14px;"> </span><span >Leave the plate incubated at 37</span><span >°C</span><span >.</span><span > During the period of time, </span><span >take pictures of the colony.</span> |
</p> | </p> | ||
- | <p style="; font-size: 14px;"> | + | <p style="font-family:Times New Roman;font-size:14px;"> |
- | + | <br/> | |
</p> | </p> | ||
- | <p style="; font-size: | + | <p style="font-family:Arial;font-size:21px;text-align:left;"> |
- | + | <span style="font-family:Arial;font-weight:700;font-size:21px;">Osicllation timer</span> | |
</p> | </p> | ||
- | <p style=" | + | <p > |
- | + | <span style="font-family:Arial;font-weight:700;font-size:16px;">Medium: </span><span >Luria–Bertani (LB) medium</span><span > </span><span style="font-family:Arial;font-size:16px;valign:sup;">[4]</span> | |
</p> | </p> | ||
- | < | + | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;"> |
- | < | + | <tbody> |
+ | <tr class="firstRow"> | ||
+ | <td colspan="3" style="width:553px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;text-align:center;"> | ||
+ | <span style="font-family:Arial;">Luria–Bertani (LB) medium</span><span style="font-family:Arial;">/100</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">mL</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Ingredients</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td colspan="2" style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Quantities</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td colspan="2" style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Yeast Extract</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">0.25</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td colspan="2" style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Bacto Tryptone</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">0.5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td colspan="2" style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">NaCl</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">0.5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td colspan="2" style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Glycerol </span><span style="font-family:Arial;valign:sup;">1</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">0.5</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;">g</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr style="height:11px;"> | ||
+ | <td colspan="2" style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">0.1 M HEPES </span><span style="font-family:Arial;valign:sup;">2</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">3-4 mL</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr style="height:10px;"> | ||
+ | <td colspan="2" style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">NaOH</span><span style="font-family:Arial;"> </span><span style="font-family:Arial;valign:sup;">3</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:276px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Until </span><span style="font-family:Arial;">pH 8.0</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr style="height:0;"> | ||
+ | <td style="width:277px;border:none;"></td> | ||
+ | <td style="width:0px;border:none;"></td> | ||
+ | <td style="width:276px;border:none;"></td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | <p style="font-family:Times New Roman;font-size:16px;"> | ||
+ | <br/> | ||
</p> | </p> | ||
- | <p | + | <p > |
- | <span | + | <span >Note</span><span > :</span> |
</p> | </p> | ||
- | <p style="; font-size: | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | + | <span style="font-size:14px;">1.</span><span style="font-size:14px;"> </span><span >Glycerol is used as the carbon source.</span> | |
</p> | </p> | ||
- | <p style="; font-size: 14px;"> | + | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> |
- | & | + | <span style="font-size:14px;">2.</span><span style="font-size:14px;"> </span><span >3-4 mL</span><span > </span><span >0.1 M HEPES</span><span > </span><span >is added after rich defined medium is utilized, </span><span >serving</span><span > for</span><span > minimizing the effects of pH.</span> |
+ | </p> | ||
+ | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> | ||
+ | <span style="font-size:14px;">3.</span><span style="font-size:14px;"> </span><span >NaOH is added until PH of the medium reaches 8.0.</span> | ||
+ | </p> | ||
+ | <p style="font-family:Times New Roman;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:0em;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | <p > | ||
+ | <span style="font-family:Arial;font-weight:700;font-size:16px;">Experiments </span> | ||
+ | </p> | ||
+ | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> | ||
+ | <span style="font-size:14px;">1.</span><span style="font-size:14px;"> </span><span >Pour 10 mL</span><span > of the </span><span >medium</span><span > above</span><span > containing 0.25% agar (Difco, Bacto agar)</span><span > into a Petridish</span><span > to prepare </span><span >semi-solid medium</span><span >.</span> | ||
+ | </p> | ||
+ | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> | ||
+ | <span style="font-size:14px;">2.</span><span style="font-size:14px;"> </span><span >Leave the </span><span >plate </span><span >air-dried for 90 min in laminar flow clean bench </span><span >at room temperature</span><span >.</span> | ||
+ | </p> | ||
+ | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> | ||
+ | <span style="font-size:14px;">3.</span><span style="font-size:14px;"> </span><span >S</span><span >pot medium culture in</span><span > half thick</span><span >ness in the centern of the plate.</span> | ||
+ | </p> | ||
+ | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;margin-left:24px;text-indent:-24px;"> | ||
+ | <span style="font-size:14px;">4.</span><span style="font-size:14px;"> </span><span >Cultivate at 37</span><span >°C.</span> | ||
+ | </p> | ||
+ | <p style="font-family:Times New Roman;font-size:14px;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | <p style="font-family:Arial;font-size:21px;"> | ||
+ | <span style="font-family:Arial;font-weight:700;font-size:21px;">Aptamer key-lock</span> | ||
+ | </p> | ||
+ | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;"> | ||
+ | <span >PCR System</span> | ||
+ | </p> | ||
+ | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;"> | ||
+ | <tbody> | ||
+ | <tr class="firstRow"> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;text-align:center;"> | ||
+ | <span style="border:1px none #fff;"><span style="font-family:Arial;color:#fff;">Template</span></span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">1 </span><span style="font-family:Arial;">μL</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">Forward Primer</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">1 </span><span style="font-family:Arial;">μL</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">Reverse Primer</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">1 </span><span style="font-family:Arial;">μL</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">dNTP Mixture</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">4 </span><span style="font-family:Arial;">μL</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">10×PCR Buffer</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">5 </span><span style="font-family:Arial;">μL</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">rTaq (TakaRa)</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">1 </span><span style="font-family:Arial;">μL</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">ddH</span><span style="font-family:Arial;valign:sub;">2</span><span style="font-family:Arial;">O</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">37 </span><span style="font-family:Arial;">μL</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">Total Volume</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:277px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">50 </span><span style="font-family:Arial;">μL</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr style="height:0;"> | ||
+ | <td style="width:277px;border:none;"></td> | ||
+ | <td style="width:277px;border:none;"></td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | <p style="font-family:Times New Roman;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;"> | ||
+ | <span >The </span><span >source and formation</span><span > of the idea</span> | ||
+ | </p> | ||
+ | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;"> | ||
+ | <tbody> | ||
+ | <tr class="firstRow"> | ||
+ | <td style="width:190px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Designation</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:183px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Sequence</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:190px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">theophylline Aptamer</span><span style="font-family:Arial;valign:sup;">1</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:183px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">GGU GAU ACC AGC AUC GUC UUG AUG CC</span><span style="font-family:Arial;">CUUG GCA GC</span><span style="font-family:Arial;">A CC</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:190px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">theophylline Aptamer_RBS_AUG</span><span style="font-family:Arial;valign:sup;">1</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:183px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">GGU GAU ACC AGC AUC GUC UUG AUG CC CUU GGC AGC ACC CC G CUG CAA GAC AAC AAG AUG</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:190px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">crRNA</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:183px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">CGU CUU GAU UCC UUC UUU</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:190px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">RBS</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:183px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">AGG AGG AAA</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:190px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">taRNA</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:183px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">GCA GAA CUA AGG AAG AAA</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr style="height:0;"> | ||
+ | <td style="width:190px;border:none;"></td> | ||
+ | <td style="width:183px;border:none;"></td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | <p style="font-family:Times New Roman;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;"> | ||
+ | <span >Sequence</span> | ||
+ | </p> | ||
+ | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;width:567px;border-collapse:collapse;border:none;"> | ||
+ | <tbody> | ||
+ | <tr class="firstRow"> | ||
+ | <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Designation</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Sequence( 5’-3’)</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Length</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Lock Templates</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACGAATTT<br/>CTTTCTTCCTTAG TTCTGCCTAAGGAGGAAA | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">91 bp</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Forward Primer</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCCCTATCAGTGA | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">50 bp</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Reverse primer</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | GTTTCTTCCTGCAGCGGCCGCTACTAGTATTTCCTCCTTAGGCAGAACT | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">49 bp</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Aptamer key </span><span style="font-family:Arial;">Templates</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACGAATTTCGGTGAT<br/>ACCAGCATCGTCTTGATGCCCTTGGCAGCACCCTGCGTAAAGAAGGAATCAAGACG | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">123 bp</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Forward primer</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCCCTATCAGTGATAGAGATTGA | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">53 bp</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Reverse primer</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | GTTTCTTCCTGCAGCGGCCGCTACTAGTACGTCTTGATTCCTTCTTTACGCA | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">52 bp</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">New RBS Templates</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACTAC<br/>TAGAGAGGAGGAAA | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">71 bp</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Forward primer</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCCCTATCAGTGA | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">50 bp</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:104px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">Reverse primer</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:397px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | GTTTCTTCCTGCAGCGGCCGCTACTAGTATTTCCTCCTCTCTAGTAGTG | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:66px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;"> | ||
+ | <span style="font-family:Arial;">49 bp</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr style="height:0;"> | ||
+ | <td style="width:104px;border:none;"></td> | ||
+ | <td style="width:397px;border:none;"></td> | ||
+ | <td style="width:66px;border:none;"></td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;"> | ||
+ | <span >PCR Condition</span><span >s</span> | ||
+ | </p> | ||
+ | <p style="font-family:Arial;font-size:16px;;text-indent:2em;text-align:justify;text-indent:0em;"> | ||
+ | <span >Lock</span> | ||
+ | </p> | ||
+ | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;"> | ||
+ | <tbody> | ||
+ | <tr class="firstRow"> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">1</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">94°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">5 min</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">2</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">94°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">30 s</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td rowspan="3" style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">30 loops</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">3</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">55°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">30 s</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">4</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">72°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">30 s</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr style="height:5px;"> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">5</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">72°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">10 min</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr style="height:5px;"> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">6</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">15°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">5 min</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr style="height:0;"> | ||
+ | <td style="width:137px;border:none;"></td> | ||
+ | <td style="width:149px;border:none;"></td> | ||
+ | <td style="width:140px;border:none;"></td> | ||
+ | <td style="width:127px;border:none;"></td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | <p style="font-family:Times New Roman;font-size:16px;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | <p > | ||
+ | <span >Aptamer K</span><span >ey</span> | ||
+ | </p> | ||
+ | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;"> | ||
+ | <tbody> | ||
+ | <tr class="firstRow"> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">1</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">94°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">5 min</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">2</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">94°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">30 s</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td rowspan="3" style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">30 loops</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">3</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">52</span><span style="font-family:Arial;">°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">30 s</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">4</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">72°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">30 s</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr style="height:5px;"> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">5</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">72°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">10 min</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr style="height:5px;"> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">6</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">15°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">5 min</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr style="height:0;"> | ||
+ | <td style="width:137px;border:none;"></td> | ||
+ | <td style="width:149px;border:none;"></td> | ||
+ | <td style="width:140px;border:none;"></td> | ||
+ | <td style="width:127px;border:none;"></td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | <p style="font-family:Times New Roman;font-size:16px;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | <p > | ||
+ | <span >New RBS</span> | ||
+ | </p> | ||
+ | <table style="styleName:Table Grid;font-size:16px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;border-insideH:1px solid #fff;border-insideV:1px solid #fff;styleName:Normal Table;margin-left:0px;cellpadding:0px 7px 0px 7px;border-collapse:collapse;border:none;"> | ||
+ | <tbody> | ||
+ | <tr class="firstRow"> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">1</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">94°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">5 min</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:1px solid #fff;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">2</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">94°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">30 s</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td rowspan="3" style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">30 loops</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">3</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">55°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">30 s</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">4</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">72°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">30 s</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr style="height:5px;"> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">5</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">72°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">10 min</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr style="height:5px;"> | ||
+ | <td style="width:137px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:1px solid #fff;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">6</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:149px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial,MS Mincho;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">15°C</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:140px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <span style="font-family:Arial;">5 min</span> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td style="width:127px;vertical-align:top;padding:0px 7px 0px 7px;border-top:none;border-left:none;border-bottom:1px solid #fff;border-right:1px solid #fff;"> | ||
+ | <p style="font-family:Arial;;text-indent:2em;text-align:justify;text-indent:0em;text-align:center;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr style="height:0;"> | ||
+ | <td style="width:137px;border:none;"></td> | ||
+ | <td style="width:149px;border:none;"></td> | ||
+ | <td style="width:140px;border:none;"></td> | ||
+ | <td style="width:127px;border:none;"></td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | <p style="font-family:Times New Roman;font-size:21px;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | <p style="font-family:Times New Roman;font-size:21px;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | <p style="font-family:Times New Roman;font-size:21px;"> | ||
+ | <br/> | ||
+ | </p> | ||
+ | <p style="font-size: 18px;"> | ||
+ | <b>References</b> | ||
+ | </p> | ||
+ | <p> | ||
+ | [1]Adler J. A method for measuring chemotaxis and use of the method to determine optimum conditions for chemotaxis by Escherichia coli[J]. Journal of General Microbiology, 1973, 74(1): 77-91. | ||
+ | </p> | ||
+ | <p> | ||
+ | [2] S T, JP. G. Guiding bacteria with small molecules and RNA[J]. Journal of the American Chemical Society, 2007, (21):6807-6811. | ||
+ | </p> | ||
+ | <p> | ||
+ | [3] Kawaji, H., T. Mizuno, and S. Mizushima. "Influence of molecular size and osmolarity of sugars and dextrans on the synthesis of outer membrane proteins O-8 and O-9 of Escherichia coli K-12." Journal of bacteriology 140.3 (1979): 843-847. | ||
+ | </p> | ||
+ | <p> | ||
+ | [4] Liu C, Fu X, Liu L, et al. Sequential establishment of stripe patterns in an expanding cell population[J]. Science, 2011, 334(6053): 238-241. | ||
</p> | </p> | ||
- | <p | + | <p> |
- | + | [5] Topp S, Gallivan J P. Guiding bacteria with small molecules and RNA[J]. Journal of the American Chemical Society, 2007, 129(21): 6807-6811. | |
</p> | </p> | ||
- | <p | + | <p> |
- | < | + | <br/> |
</p> | </p> | ||
- | <p style="font-size: | + | <p style="font-size: 50px;"> |
| | ||
</p> | </p> | ||
Line 2,411: | Line 3,422: | ||
</script> | </script> | ||
<script type="text/javascript" src="https://2014.igem.org/wiki/index.php?title=Team:XMU-China/main_js&action=raw&ctype=text/javascript"></script> | <script type="text/javascript" src="https://2014.igem.org/wiki/index.php?title=Team:XMU-China/main_js&action=raw&ctype=text/javascript"></script> | ||
+ | |||
+ | <div id="side_bar"> | ||
+ | <ul id="side_bar_main_1"> | ||
+ | <li class="sidebar_main" id="side_bar_judging"> | ||
+ | <h3><a href="https://2014.igem.org/Team:XMU-China/Notebook_Protocol">Protocol</a></h3> | ||
+ | </li> | ||
+ | </ul> | ||
+ | <img id="side_bar_img_x" src="https://static.igem.org/mediawiki/2014/2/24/Xmu_sidebar_x.png" /> | ||
+ | <ul id="side_bar_main_2"> | ||
+ | <li class="sidebar_main"> | ||
+ | <h3><a href="https://2014.igem.org/Team:XMU-China/Notebook_Labnotes">Lab notes</a></h3> | ||
+ | </li> | ||
+ | <li class="sidebar_main" id="side_bar_safety"> | ||
+ | <h3><a href="https://2014.igem.org/Team:XMU-China/Notebook_Calendar">Calendar</a></h3> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
</body> | </body> | ||
</html> | </html> | ||
{{:Team:XMU-China/UFO}} | {{:Team:XMU-China/UFO}} | ||
{{:Team:XMU-China/footer}} | {{:Team:XMU-China/footer}} |
Latest revision as of 03:40, 18 October 2014
Protocols
General Considerations
E. coli Strains
E. coli strain DH5α, was offered by XMU-China iGEM 2013.
E. coli strain CL-1, whose gene of cheZ had been knocked out, was offered generously by iGEMer JianDong Huang and Lizhong Liu, from Department of Biochemistry, The University of Hong Kong.
Antibiotic
Antibiotic |
Stock Concentration (mg/mL) |
Final Concentration (μg/mL) |
Solvent |
Chloramphenicol |
50 |
50 |
Absolute ethyl alcohol |
Ampicillin |
50 |
100 |
ddH2O |
Kanamycin |
50 |
50 |
ddH2O |
Tetracycline |
50 |
50 |
Absolute ethyl alcohol |
All the antibiotics above require filtration to sterilize.
Stock in -20°C
LB Liquid Medium
Ingredients |
Percent (g/mL) |
Yeast Extract |
0.5% |
Tryptone |
1% |
NaCl |
1% |
LB Solid Medium
Ingredients |
Percent (g/mL) |
Yeast Extract |
0.5% |
Tryptone |
1% |
NaCl |
1% |
Agar |
1.5% |
LB Semi-Solid Medium
Ingredients |
Percent (g/mL) |
Yeast Extract |
0.5% |
Tryptone |
1% |
NaCl |
1% |
Agar |
0.25% |
Preparation of Competent Cell (TaKaRa Competent Cell Preparation Kit)
Activate the E. coli strain on LB-plate from glycerol stock under the condition of 37°C for 12 hours.
Pre-culture a single colony in 5 mL LB liquid medium under the condition of 37°C, 200 rpm for 12 hours.
Add 200 μL pre-culture bacteria into 20 mL LB liquid medium. Culture under the condition of 37°C, 200 rpm for 2 hours.
Place on ice for 30 min.
Subpackage the 20 mL culture medium into 1.5 mL sterile centrifuge tube, each centrifuge tube containing 1 mL.
Centrifuge at 1500×g for 5 min at 4°C, then discard supernatant.
Re-suspend each centrifuge tube gently with 100 μL Solution A, which has been precooled in ice.
Centrifuge at 1500×g for 5 min at 4°C, then discard supernatant.
Re-suspend each centrifuge tube gently with 100 μL Solution B, which has been precooled in ice.
Stock in -20°C
Transformation
Add 1 μL purified plasmid or 10 μL ligation system into 100 μL fresh competent cells, which is contained in 1.5 mL centrifuge tube. Then mix gently.
Leave on ice for 30 minutes.
Heat shock at 42°C for 90 seconds.
Leave on ice for 10 minutes immediately.
Add 400 μL fresh LB medium into the centrifuge tube.
Incubate for 2 hours under the condition of 37°C, 200 rpm.
Note: If the resistance of vector is ampicillin, incubation time is shortened to 1 hour.
Spread 100 μL culture medium on a LB solid medium plate, which contains appropriate antibiotics.
Incubate overnight at 37°C
Confirmation
1. Plasmid Extraction (Omega Plasmid Mini Kit)
Add 1 mL overnight suspension culture into a 1.5 mL sterile centrifuge tube. Centrifuge at 10000 x g for 1 min, then discard supernatant.
Repeat the step above several times, until the amount of bacteria is appropriate.
Re-suspend cells gently with 250 μL Solution I/RNase A.
Add 250 μL Solution II into each centrifuge tube. Mix gently by inverting 4-6 times to obtain cleared lysate.
Add 350 μL Solution III into each centrifuge tube. Mix well to form protein precipitate.
Centrifuge at ≥13000 x g for 10 min.
Transfer cleared lysate into a HiBind Mini Column placed in a 2 mL collection tube.
Centrifuge at 10000 x g for 1 min. Discard liquid.
Wash the HiBind Mini Column with 500 μL HB Buffer. Centrifuge at 10000 x g for 1 min. Discard liquid.
Using the same collection tube, wash the HiBind Mini Column with 700 Μl DNA Wash Buffer, which is diluted with ethanol. Centrifuge at 10000 x g for 1 min. Discard liquid.
Wash the HiBind Mini Column a second time with an additional 700 μL DNA Wash Buffer. Centrifuge at 10000 x g for 1 min. Discard liquid.
Centrifuge the empty HiBind Mini Column at ≥ 13000 x g for 2 min to spin-dry.
Place the HiBind Mini Column into a sterile 1.5 mL centrifuge tube.
Add 30 μL sterile ultrapure water directly into the HiBind Mini Column. Sit at room temperature for 2 minutes. Centrifuge at maximum speed (≥ 13000 x g) for 1 min to elute DNA.
2. Digestion for Confirmation
Reaction condition: 37°C for 2 hours.
Single Digestion |
|
Double Digestion |
||
Plasmid |
5 μL |
Plasmid |
5 μL |
|
EcoR I |
0.5 μL |
Xba I |
0.5 μL |
|
|
|
Pst I |
0.5 μL |
|
10×H Buffer |
1 μL |
10×M Buffer |
1 μL |
|
ddH2O |
3.5 μL |
ddH2O |
3 μL |
|
Total Volume |
10 μL |
Total Volume |
10 μL |
|
3. DNA gel electrophoresis (take 20 mL as example)
Dilute 50×TAE to 1×TAE with ddH2O.
Measure 20 mL 1×TAE buffer.
Pour 1×TAE buffer into an erlenmeyer flask.
Weigh 0.2g agarose to make 1% DNA gel.
Pour agarose into the erlenmeyer flask.
Make agarose melt by microwave, lasting for 105 seconds until melt completely.
Cool for 5 minutes.
Assemble gel pouring apparatus by inserting gate into slots.
Pour agarose gel into gel tray.
Bring a piece of silver paper on the top of the gel pouring apparatus.
Wait for 30-40 minutes to solidify the DNA agarose gel.
Ligation
1. Digestion for Ligation
Reaction condition: 37°C for 2.5 hours.
Insert(A) + Vector(B) |
Vector (A) + Insert (B)
|
||||||
Insert(A) |
30 μL |
Vector(B) |
30 μL |
Insert(B) |
30 μL |
Vector(A) |
30 μL |
EcoR I |
3 μL |
EcoR I |
4.5 μL |
Xba I |
3 μL |
Spe I |
4.5 μL |
Spe I |
3 μL |
Xba I |
4.5 μL |
Pst I |
3 μL |
Pst I |
4.5 μL |
10×H Buffer |
4 μL |
10×M Buffer |
4 μL |
10×M Buffer |
4 μL |
10×H Buffer |
4 μL |
ddH2O |
0 μL |
ddH2O |
7 μL |
ddH2O |
0 μL |
ddH2O |
7 μL |
Total Volume |
40 μL |
Total Volume |
50 μL |
Total Volume |
40 μL |
Total Volume |
50 μL |
2. Gel Extraction of DNA (Omega Gel Extraction Kit)
Perform DNA gel electrophoresis to fractionate DNA fragments.
When adequate separation of bands has occurred, excise the DNA fragments of interest carefully.
Weigh in sterile 1.5 mL centrifuge tube.
Add corresponding volume of Binding Buffer (XP2) into the centrifuge tube.
Heat the DNA/gel mixture at 55-65°C for 7 min, until the gel melt completely.
Put a HiBind DNA Mini Column in a 2 mL collection tube. Add the DNA/gel solution to the HiBind DNA Mini Column.
Centrifuge at 10000 x g for 1 min at room temperature. Discard the flow-through liquid.
Add 300 μL Binding Buffer (XP2) into the centrifuge tube. Centrifuge at 10000 x g for 1 minute at room temperature. Then discard the flow-through liquid.
Add 700 μL SPW Wash Buffer (diluted with absolute ethanol). Centrifuge at 10000 x g for 1 minute at room temperature. Then discard the flow-through liquid.
Repeat the previous step.
Centrifuge the empty HiBind Mini Column at ≥ 13000 x g for 2 min to spin-dry.
Place the HiBind Mini Column into a sterile 1.5 mL centrifuge tube.
Add 30 μL Elution Buffer directly into the HiBind Mini Column. Sit at room temperature for 2 minutes. Centrifuge at maximum speed (≥ 13000 x g) for 1 min to elute DNA.
3. Ligation
Reaction condition: 16°C for 5-12 hours.
Measure the concentration of DNA fragments and vector which are going to be ligated.
Calculate the volume of insert fragments and vector which should be added, based on the formula:
Add DNA fragments, vector, ligation buffer and T4 Ligase together in an EP tube as the table below.
Insert Fragments |
V1 μL |
Vector |
V2 μL |
10×Ligation Buffer |
1 μL |
T4 Ligase |
1 μL |
Add ddH2O until the total volume equals 10.0 μL |
|
Note: Mixing the ligation system well by pipetting up and down gently is necessary.
General PCR (Polymerase Chain Reaction)
PCR System
Template |
1 μL |
Forward Primer |
2 μL |
Reverse Primer |
2 μL |
dNTP Mixture |
2 μL |
10×PCR Buffer |
5 μL |
rTaq (TakaRa) |
1 μL |
ddH2O |
37 μL |
Total Volume |
50 μL |
PCR Condition
1 |
94°C |
5 min |
|
2 |
94°C |
30 s |
30 loops |
3 |
Tm°C |
30 s |
|
4 |
72°C |
1 min/kb |
|
5 |
72°C |
10 min |
|
6 |
15°C |
5 min |
|
Conic curve formation
Medium: M63 [1] semi-solid medium preparation
M63 semi-solid medium/100 mL |
|
Ingredients |
Quantities |
KH2PO4 |
1.36 g |
KOH |
0.42 g |
(NH4)2SO4 |
0.2 g |
MgSO4 |
0.012 g |
Agar( gel strength>750 g/cm2) |
0.25 g |
H2O 1 |
96 mL |
Glycerol |
0.2 mL |
FeSO4 2 |
10.84*10-4 g |
D-glucose |
0.4 g |
Asp 3 |
6.6*10-6 g |
Met, Leu, His, Thr (0.015 g/mL) 4 |
1 mL |
Note:
1. Add 0.25 g Agar into a erlenmeyer flask first, then pour into 96 mL H2O, shaking up, continue to add glycerol using pipette.
2. Add 10 μL 0.1 g/mL FeSO4 solution into the medium.
3. Add 10 μL 66 mg/mL Asp solution into the medium.
4. Met, Leu, His, Thr could be premixed for convenience, and the amino acid should be added by injector through 0.22 μm filter membrane. Pay attention that this process must be carried out after high temperature sterilization of the M63 semi-solid medium.
I. Mix-doting bacteria, inductor and inhibitor on M63 semi-solid medium plate [2]
1. Pour 20 ml M63 semi-solid medium on a plate, leave the plate air-dried for 90 min in laminar flow clean bench.
2. Dot 15 μL inductor (IPTG) or inhibitor (L-Arabinose) on the plate through pipette, take care when insert the tip into the medium. Leave the plate air-dried for 20 min in laminar flow clean bench.
3. Dot 3 μL culture medium at the same position of the inductor (IPTG) or inhibitor (L-Arabinose), leave the plate air-dried for 5 min in laminar flow clean bench.
4. Seal the plate.
II. Lineation of inductor and inhibitor on the M63 semi-solid medium plate
1. Pour 20 mL M63 semi-solid medium on a plate, leave the plate air-dried for 90 min in laminar flow clean bench.
2. Inhale 15 μL inductor (IPTG) or inhibitor (L-Arabinose), doting along the line pre-pianted carefully, bear in mind don’t destroy the semi-solid medium when moving along the line.
3. Leave the plate air-dried for 90 min in laminar flow clean bench.
4. Repeat the process mix-doting bacteria, inductor and inhibitor on M63 semi-solid medium plate.
Characterization the activity of promoter and efficiency of RBS by chemotaxis
culture
1. Add 50 μL bacterium solution (pLac-RBS (1.0)-CheZ-TT, pLac-RBS (0.3)-CheZ-TT, pLac-RBS (0.01)-CheZ-TT,) into 5 mL fresh LB liquid medium, in which chloromycetin concentration is 50 μg/ml.
2. Culture overnight under the condition of 37°C, 200 rpm.
3. Add 50 μL bacterium solution from the LB liquid medium above to another 5 mL fresh LB liquid medium, in which chloromycetin concentration is 50 μg/mL.
4. Culture under the condition of 37°C, 200 rpm for 3 hours. Stock it in 4°C.
5. Prepare M63 semi-solid medium as above.
6. Draw three dots on a M63 semi-solid medium plate first, then inoculate the three kinds of bacterium solution at the three dots, respectively. The volume of the inoculated bacterium solution is 3 μL.
7. Culture in incubator at 37°C.
Measurement
1. Use a ruler to measure the radius of colony from the bottom of the semi-solid medium plate. The initial colony radius is recorded as R1, and the radiuses measured at 12h, 24h, 30h, 36h, 42h... as R2, R3, R4, R5, R6, R7…
2. Record time and diameter in a table.
3. Process data with excel.
Black hole
Plasmid Construction
All DNA parts applied in these experiments came from the MIT Registry of Standard Biological Parts. The new BioBrick part, PompC-cheZ (BBa_K1412010) was formed by ligating the pre-existing parts, PompC (BBa_R0082) and cheZ (BBa_K629003). The E.Z.N.A.TM Plasmid Mini Kit I (200) was used according to the manufacturer’s instructions to extract plasmid DNA. BioBrick parts were digested with restriction enzymes, EcoRI, Xba I, Spe I, and Pst I to produce ‘sticky ends’ that were used to combine BioBrick parts. Digested DNA was purified using 1% agarose gel electrophoresis followed by gel purification with the E.Z.N.A.TM Gel Extraction Kit (200). BioBrick parts with matching ‘sticky ends’ were ligated using T4 ligase produced by Takara Biotechnology (Dalian) Co., Ltd. (Takara Dalian). Plasmid DNA was transformed into DH5α
first. Then we began a new circulation consisting of extracting plasmids, digestion and DNA gel electrophoresis to confirm the success of the ligation. Finally, the construct was sequenced for verification.
Construction of E. coli strain CL-1
The new biobrick part, PompC-cheZ (BBa_K1412010) on pSB1C3 was introduced into E. coli strain CL-1, whose gene of cheZ had been knocked out.
I. Gradient Plate Experiments (semi-solid medium, Cm 50μg/ml)
Medium: Medium A [3] (Improved)
Ingredients |
Percent (g/mL) |
Yeast Extract |
0.26% |
Peptone |
0.27% |
K2HPO4 |
0.37% |
KH2PO4 |
0.13% |
NaCl |
0.05% |
Glycerol |
0.2% |
Sucrose concentration gradient: 0~20%, the concentration gradient was 2%.
Mid-log-phase cell suspensions preparation:
1. Overnight culture of the required strain grow at 37 °C in Medium A (Improved) containing appropriate chloramphenicol.
2. Dilute the overnight culture at the ratio of 1:100 in fresh culture (Medium A), then incubate the culture under the condition of 37°C, 200 rpm, until its OD590 reaches 0.2.
3. Stock in 4°C.
The method of preparing gradient semi-solid medium (0.25% agar)
1. Prepare 100% sucrose solution.
2. Prepare the medium with tripled ingredients amount.
3. Put the 100% sucrose solution, the prepared medium and plenty of deionized water into the autoclave for 121°C, 20 minutes.
4. After sterilization, put the 100% sucrose solution, the prepared medium and the deionized water into a drying oven for around 10 minutes.
5. Take 5 mL tripled Medium A (Improved) into a 25 mL erlenmeyer flask, then add appropriate volume of 100% sucrose solution into the erlenmeyer flask, while the shortage will be complemented by deionized water to make the total volume to be 15 mL.
6. Add 15 μL chloramphenicol into the erlenmeyer flask.
7. Pour the mixture into a Petri dish (85 mm dia.) as quickly as possible.
8. Leave the plate air-dried for 90 min in laminar flow clean bench.
9. After solidification of the media, cell suspensions from mid-log-phase cultures (3 μL) were inoculated in the center of the plate.
10. Leave the plate dried in air for 15 min in laminar flow clean bench.
11. Leave the plate incubated at 37°C. During the period of time, measure the diameters of the colony and take them down.
II. Plates Crossed Experiments (semi-solid medium, Cm 50μg/ml)
Medium: half Medium A (Improved)
Ingredients |
Percent (g/mL) |
Yeast Extract |
0.13% |
Peptone |
0.135% |
K2HPO4 |
0.195% |
KH2PO4 |
0.065% |
NaCl |
0.025% |
Glycerol |
0.1% |
The concentration of sucrose: 0%, 10%
The method of preparing liquid medium containing different concentrations of sucrose:
1. Prepare the medium with corresponding ingredients amount in the table above.
2. Add corresponding amount of solid sucrose into the liquid medium.
3. Wait for sterilization.
Mid-log-phase cell suspensions preparation:
1. Overnight culture of the required strain grow at 37°C in Medium A (Improved) containing appropriate chloramphenicol.
2. Dilute the overnight culture at the ratio of 1:100 in fresh culture (half Medium A), then incubate the culture under the condition of 37°C, 200 rpm, until its OD590 reaches 0.2.
3. Stock in 4°C.
The method of preparing semi-solid medium with a cross (0.25% agar)
1. Prepare the medium with corresponding ingredients amount in the table above.
2. Put the medium containing agar, the liquid medium containing sucrose and plenty of deionized water into the autoclave for 121°C, 20 minutes.
3. After sterilization, put the mediums and the deionized water into a drying oven for around 10 minutes.
4. Take 15 mL of the medium containing agar into a 25 mL erlenmeyer flask.
5. Add 15 μL chloramphenicol into the erlenmeyer flask.
6. Pour the mixture into a Petri dish (85 mm dia.) as quickly as possible.
7. Leave the plate air-dried for 90 min in laminar flow clean bench.
8. After solidification of the media, draw a cross composed of two straight lines on the plate, by the way of Intensive RBI (1 μL/mm). One straight line is dotted with water, the other is dotted with liquid medium containing 10% sucrose. The length of the lines is 6 centimeters.
9. Leave the plate dried in air for 15 min in laminar flow clean bench.
10. Cell suspensions from mid-log-phase cultures (3 μL) is inoculated at the cross point.
11. Leave the plate dried in air for 15 min in laminar flow clean bench.
12. Leave the plate incubated at 37°C. During the period of time, take pictures of the colony.
Osicllation timer
Medium: Luria–Bertani (LB) medium [4]
Luria–Bertani (LB) medium/100 mL |
||
Ingredients |
Quantities |
|
Yeast Extract |
0.25 g |
|
Bacto Tryptone |
0.5 g |
|
NaCl |
0.5 g |
|
Glycerol 1 |
0.5 g |
|
0.1 M HEPES 2 |
3-4 mL |
|
NaOH 3 |
Until pH 8.0 |
|
Note :
1. Glycerol is used as the carbon source.
2. 3-4 mL 0.1 M HEPES is added after rich defined medium is utilized, serving for minimizing the effects of pH.
3. NaOH is added until PH of the medium reaches 8.0.
Experiments
1. Pour 10 mL of the medium above containing 0.25% agar (Difco, Bacto agar) into a Petridish to prepare semi-solid medium.
2. Leave the plate air-dried for 90 min in laminar flow clean bench at room temperature.
3. Spot medium culture in half thickness in the centern of the plate.
4. Cultivate at 37°C.
Aptamer key-lock
PCR System
Template |
1 μL |
Forward Primer |
1 μL |
Reverse Primer |
1 μL |
dNTP Mixture |
4 μL |
10×PCR Buffer |
5 μL |
rTaq (TakaRa) |
1 μL |
ddH2O |
37 μL |
Total Volume |
50 μL |
The source and formation of the idea
Designation |
Sequence |
theophylline Aptamer1 |
GGU GAU ACC AGC AUC GUC UUG AUG CCCUUG GCA GCA CC |
theophylline Aptamer_RBS_AUG1 |
GGU GAU ACC AGC AUC GUC UUG AUG CC CUU GGC AGC ACC CC G CUG CAA GAC AAC AAG AUG |
crRNA |
CGU CUU GAU UCC UUC UUU |
RBS |
AGG AGG AAA |
taRNA |
GCA GAA CUA AGG AAG AAA |
Sequence
Designation |
Sequence( 5’-3’) |
Length |
Lock Templates |
TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACGAATTT |
91 bp |
Forward Primer |
GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCCCTATCAGTGA |
50 bp |
Reverse primer |
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTTCCTCCTTAGGCAGAACT |
49 bp |
Aptamer key Templates |
TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACGAATTTCGGTGAT |
123 bp |
Forward primer |
GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCCCTATCAGTGATAGAGATTGA |
53 bp |
Reverse primer |
GTTTCTTCCTGCAGCGGCCGCTACTAGTACGTCTTGATTCCTTCTTTACGCA |
52 bp |
New RBS Templates |
TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACTAC |
71 bp |
Forward primer |
GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCCCTATCAGTGA |
50 bp |
Reverse primer |
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTTCCTCCTCTCTAGTAGTG |
49 bp |
PCR Conditions
Lock
1 |
94°C |
5 min |
|
2 |
94°C |
30 s |
30 loops |
3 |
55°C |
30 s |
|
4 |
72°C |
30 s |
|
5 |
72°C |
10 min |
|
6 |
15°C |
5 min |
|
Aptamer Key
1 |
94°C |
5 min |
|
2 |
94°C |
30 s |
30 loops |
3 |
52°C |
30 s |
|
4 |
72°C |
30 s |
|
5 |
72°C |
10 min |
|
6 |
15°C |
5 min |
|
New RBS
1 |
94°C |
5 min |
|
2 |
94°C |
30 s |
30 loops |
3 |
55°C |
30 s |
|
4 |
72°C |
30 s |
|
5 |
72°C |
10 min |
|
6 |
15°C |
5 min |
|
References
[1]Adler J. A method for measuring chemotaxis and use of the method to determine optimum conditions for chemotaxis by Escherichia coli[J]. Journal of General Microbiology, 1973, 74(1): 77-91.
[2] S T, JP. G. Guiding bacteria with small molecules and RNA[J]. Journal of the American Chemical Society, 2007, (21):6807-6811.
[3] Kawaji, H., T. Mizuno, and S. Mizushima. "Influence of molecular size and osmolarity of sugars and dextrans on the synthesis of outer membrane proteins O-8 and O-9 of Escherichia coli K-12." Journal of bacteriology 140.3 (1979): 843-847.
[4] Liu C, Fu X, Liu L, et al. Sequential establishment of stripe patterns in an expanding cell population[J]. Science, 2011, 334(6053): 238-241.
[5] Topp S, Gallivan J P. Guiding bacteria with small molecules and RNA[J]. Journal of the American Chemical Society, 2007, 129(21): 6807-6811.