"
Team:WLC-Milwaukee/Parts
From 2014.igem.org
Mwmortensen (Talk | contribs) |
Mwmortensen (Talk | contribs) |
||
| (10 intermediate revisions not shown) | |||
| Line 1: | Line 1: | ||
{{Team:WLC-Test}} | {{Team:WLC-Test}} | ||
| - | |||
<html> | <html> | ||
<div class="mainCont" style="width:85%"> | <div class="mainCont" style="width:85%"> | ||
<table> | <table> | ||
<tr><td> | <tr><td> | ||
| + | <p>Both of our submitted biobricks serve the same purpose of a platform for directional insertion behind pBAD (K1406000) or pLac (K1406001) and a strong Ribosomal binding site. Downstream from the combination of these parts, there is a NheI cutsite. This simple addition allows a simple insertion of any biobrick coding sequence into this part. To do this, the K1406000 or K1406001 is digested with NheI and PstI restriction enzymes, and the part to be inserted is digested with XbaI and PstI. XbaI and NheI have compatible sticky ends, and will form a "scar," which is no longer recognized by either XbaI or NheI when ligated together. The PstI cuts will reform a PstI cutsite, which will complete the 4 biobrick cutsites. The use of NheI internally forms a scar by design Therefore, no internal XbaI cutsites are left, which would violate the biobrick standard.</p> | ||
| + | <p style="word-wrap:break-word"> The sequence for the parts should be as follows, including the XbaI and PstI cutsites of biobrick prefix and suffix; NheI cutsites are bolded. K1406000:TCTAGAACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCAAGATAGTCCATAAGATTAG CGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCGTTTTTTTGG<b>GCTAGC</b>AAAGAGGAGAAAAATGCTAGCACTAGTCTGCAG | ||
| + | <br /><br /> | ||
| + | K1406001: TCTAGAAATTGTGAGCGGATAACAATTGACATTGTGAGCGGATAACAAGATACTGAGCA CAAAAGAGGAATTGACATTGTGAGCGGATAACAAGATACTGAGCACAAAAGAGGAGAAAAAT<b>GCTAGC</b>ACTAGTCTGCAG </p> | ||
| + | |||
</td></tr> | </td></tr> | ||
</table> | </table> | ||
</div> | </div> | ||
</html> | </html> | ||
| - | + | <groupparts>iGEM014 WLC-Milwaukee</groupparts> | |
| - | + | <!-- | |
<style type="text/css"> | <style type="text/css"> | ||
#groupparts {text-align: center; margin-left: auto; margin-right: auto;} | #groupparts {text-align: center; margin-left: auto; margin-right: auto;} | ||
</style> | </style> | ||
| - | |||
<table width="70%" align="center"> | <table width="70%" align="center"> | ||
| - | + | welcome box | |
<tr> | <tr> | ||
<td style="border:1px solid black;" colspan="3" align="center" height="150px" bgColor=#FF404B> | <td style="border:1px solid black;" colspan="3" align="center" height="150px" bgColor=#FF404B> | ||
| Line 30: | Line 33: | ||
<tr> <td colspan="3" height="5px"> </td></tr> | <tr> <td colspan="3" height="5px"> </td></tr> | ||
| - | |||
<tr> | <tr> | ||
| - | |||
<td align="center" colspan="3"> | <td align="center" colspan="3"> | ||
| Line 73: | Line 74: | ||
</table> | </table> | ||
| - | + | end navigation menu | |
</tr> | </tr> | ||
| Line 90: | Line 91: | ||
| - | + | ||
<tr><td > <h3> Parts Submitted to the Registry </h3></td> | <tr><td > <h3> Parts Submitted to the Registry </h3></td> | ||
<td ></td > | <td ></td > | ||
| Line 154: | Line 155: | ||
</table> | </table> | ||
| - | |||
<groupparts>iGEM013 WLC-Milwaukee</groupparts> | <groupparts>iGEM013 WLC-Milwaukee</groupparts> | ||
| + | --> | ||
Latest revision as of 03:31, 18 October 2014
|
|
Both of our submitted biobricks serve the same purpose of a platform for directional insertion behind pBAD (K1406000) or pLac (K1406001) and a strong Ribosomal binding site. Downstream from the combination of these parts, there is a NheI cutsite. This simple addition allows a simple insertion of any biobrick coding sequence into this part. To do this, the K1406000 or K1406001 is digested with NheI and PstI restriction enzymes, and the part to be inserted is digested with XbaI and PstI. XbaI and NheI have compatible sticky ends, and will form a "scar," which is no longer recognized by either XbaI or NheI when ligated together. The PstI cuts will reform a PstI cutsite, which will complete the 4 biobrick cutsites. The use of NheI internally forms a scar by design Therefore, no internal XbaI cutsites are left, which would violate the biobrick standard. The sequence for the parts should be as follows, including the XbaI and PstI cutsites of biobrick prefix and suffix; NheI cutsites are bolded. K1406000:TCTAGAACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCAAGATAGTCCATAAGATTAG CGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCGTTTTTTTGGGCTAGCAAAGAGGAGAAAAATGCTAGCACTAGTCTGCAG
|
