Team:SZU-China/Project/Kil

From 2014.igem.org

(Difference between revisions)
 
(One intermediate revision not shown)
Line 1: Line 1:
-
 
<!--[if lt IE 7 ]><html class="ie ie6" lang="zh-CN"><![endif]-->
<!--[if lt IE 7 ]><html class="ie ie6" lang="zh-CN"><![endif]-->
<!--[if IE 7 ]><html class="ie ie7" lang="zh-CN"><![endif]-->
<!--[if IE 7 ]><html class="ie ie7" lang="zh-CN"><![endif]-->
Line 154: Line 153:
width: 1050px
width: 1050px
}
}
-
img.x{
+
img.x {
-
position:absolute;
+
position: absolute;
-
top:10px;
+
top: 10px;
-
left:100px;
+
left: 100px;
}
}
-
div.x1{
+
div.x1 {
-
position:relative;
+
position: relative;
}
}
</style>
</style>
Line 167: Line 166:
<body class="home blog">
<body class="home blog">
<div class=" container">
<div class=" container">
-
<header id="zan-header">  
+
  <header id="zan-header">  
-
  <!--logo-->
+
    <!--logo-->
-
 
+
-
  <div class="x1"  >
+
      
      
-
     <img src="https://static.igem.org/mediawiki/2014/f/fd/Szunewtop.png">
+
     <div class="x1"  > <img src="https://static.igem.org/mediawiki/2014/f/fd/Szunewtop.png"> <a href="https://igem.org/Main_Page"><img class="x" src="https://static.igem.org/mediawiki/2014/f/f1/Szuigemlogo.png" ></a> </div>
-
    <a href="https://igem.org/Main_Page"><img class="x" src="https://static.igem.org/mediawiki/2014/f/f1/Szuigemlogo.png" ></a>
+
      
      
-
      
+
     <!--logoEnd-->  
-
  </div>
+
    <!--导航-->
-
 
+
    <nav class="navbar navbar-inverse" id="zan-nav" name="zan-nav">
-
  <!--logoEnd-->  
+
      <div class="container clearfix">
-
  <!--导航-->
+
        <div >
-
  <nav class="navbar navbar-inverse" id="zan-nav" name="zan-nav">
+
          <ul id="menu-navbar" class="nav navbar-nav">
-
    <div class="container clearfix">
+
            <li id="menu-item-215" class="menu-item menu-item-type-custom menu-item-object-custom  menu-item-home menu-item-215"><a title="Home" href="https://2014.igem.org/Team:SZU-China"><i class="fa fa-home"></i> Home</a></li>
-
      <div >
+
            <li id="menu-item-895" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-has-children menu-item-895 current-menu-item current_page_item"><a title="Project" ><i class=" fa fa-edit"></i> Project</a>
-
        <ul id="menu-navbar" class="nav navbar-nav">
+
              <ul class="dropdown-menu">
-
          <li id="menu-item-215" class="menu-item menu-item-type-custom menu-item-object-custom  menu-item-home menu-item-215"><a title="Home" href="https://2014.igem.org/Team:SZU-China"><i class="fa fa-home"></i> Home</a></li>
+
                <li id="menu-item-897" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-897"><a href="https://2014.igem.org/Team:SZU-China/Project/overview">Overview</a></li>
-
          <li id="menu-item-895" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-has-children menu-item-895 current-menu-item current_page_item"><a title="Project" ><i class=" fa fa-edit"></i> Project</a>
+
                <li id="menu-item-896" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-896"><a href="https://2014.igem.org/Team:SZU-China/Project/AlkalineCellulase">Alkaline Cellulase</a></li>
-
            <ul class="dropdown-menu">
+
                <li id="menu-item-898" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-898"><a href="https://2014.igem.org/Team:SZU-China/Project/Mdfa">Mdfa Antiporter</a></li>
-
             
+
                <li id="menu-item-899" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-899"><a href="https://2014.igem.org/Team:SZU-China/Project/Kil">Kil Protein</a></li>
-
              <li id="menu-item-897" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-897"><a href="https://2014.igem.org/Team:SZU-China/Project/overview">Overview</a></li>
+
                <li id="menu-item-900" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-900"><a href="https://2014.igem.org/Team:SZU-China/Project/ccdB">ccdB Suicide System</a></li>
-
              <li id="menu-item-896" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-896"><a href="https://2014.igem.org/Team:SZU-China/Project/AlkalineCellulase">Alkaline Cellulase</a></li>
+
                <li id="menu-item-901" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-901"><a href="https://2014.igem.org/Team:SZU-China/Project/Collaboration">Collaboration</a></li>
-
             
+
              </ul>
-
            <li id="menu-item-898" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-898"><a href="https://2014.igem.org/Team:SZU-China/Project/Mdfa">Mdfa Antiporter</a></li>
+
            </li>
-
              <li id="menu-item-899" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-899"><a href="https://2014.igem.org/Team:SZU-China/Project/Kil">Kil Protein</a></li>
+
            <li id="menu-item-938" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-has-children menu-item-938"><a  title="Team" ><i class="fa  fa-group"></i> Team</a>
-
              <li id="menu-item-900" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-900"><a href="https://2014.igem.org/Team:SZU-China/Project/ccdB">ccdB Suicide System</a></li>
+
              <ul class="dropdown-menu">
-
                <li id="menu-item-901" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-901"><a href="https://2014.igem.org/Team:SZU-China/Project/Collaboration">Collaboration</a></li>
+
                <li id="menu-item-997" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-997"><a href="https://2014.igem.org/Team:SZU-China/Team/member">Member</a></li>
-
            </ul>
+
                <li id="menu-item-996" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-996"><a href="https://2014.igem.org/Team:SZU-China/Team/Attribution">Attribution</a></li>
-
          </li>
+
                <li id="menu-item-940" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-940"><a href="https://2014.igem.org/Team:SZU-China/Team/Acknowledgment">Acknowledgment</a></li>
-
          <li id="menu-item-938" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-has-children menu-item-938"><a  title="Team" ><i class="fa  fa-group"></i> Team</a>
+
                <li id="menu-item-939" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-939"><a href="https://igem.org/Team.cgi?year=2014">Official team profile</a></li>
-
            <ul class="dropdown-menu">
+
               </ul>
-
              <li id="menu-item-997" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-997"><a href="https://2014.igem.org/Team:SZU-China/Team/member">Member</a></li>
+
            </li>
-
              <li id="menu-item-996" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-996"><a href="https://2014.igem.org/Team:SZU-China/Team/Attribution">Attribution</a></li>
+
            <li id="menu-item-676" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-has-children menu-item-676"><a><i class="fa fa-globe"></i> Human Practice</a>
-
              <li id="menu-item-940" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-940"><a href="https://2014.igem.org/Team:SZU-China/Team/Acknowledgment">Acknowledgment</a></li>
+
              <ul class="dropdown-menu">
-
              <li id="menu-item-939" class="menu-item menu-item-type-post_type menu-item-object-post menu-item-939"><a href="https://igem.org/Team.cgi?year=2014">Official team profile</a></li>
+
                <li id="menu-item-676" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-676"><a target="_blank" href="https://2014.igem.org/Team:SZU-China/HumanPractice/Overview">Overview</a></li>
-
                
+
                <li id="menu-item-677" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-677"><a target="_blank" href="https://2014.igem.org/Team:SZU-China/HumanPractice/CulturalFestival">Cultural Festival</a></li>
-
            </ul>
+
                <li id="menu-item-678" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-678"><a target="_blank" href="https://2014.igem.org/Team:SZU-China/HumanPractice/Communication">Communication</a></li>
-
          </li>
+
                <li id="menu-item-680" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-680"><a target="_blank" href="https://2014.igem.org/Team:SZU-China/HumanPractice/PaperMill">Paper Mill</a></li>
-
          <li id="menu-item-676" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-has-children menu-item-676"><a><i class="fa fa-globe"></i> Human Practice</a>
+
                <li id="menu-item-680" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-680"><a target="_blank" href="https://2014.igem.org/Team:SZU-China/HumanPractice/Survey">Survey</a></li>
-
            <ul class="dropdown-menu">
+
               </ul>
-
            <li id="menu-item-676" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-676"><a target="_blank" href="https://2014.igem.org/Team:SZU-China/HumanPractice/Overview">Overview</a></li>
+
            </li>
-
              <li id="menu-item-677" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-677"><a target="_blank" href="https://2014.igem.org/Team:SZU-China/HumanPractice/CulturalFestival">Cultural Festival</a></li>
+
            <li id="menu-item-607" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-607"><a title="Judging"><i class="fa fa-check"></i> Judging</a>
-
              <li id="menu-item-678" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-678"><a target="_blank" href="https://2014.igem.org/Team:SZU-China/HumanPractice/Communication">Communication</a></li>
+
              <ul class="dropdown-menu">
-
              <li id="menu-item-680" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-680"><a target="_blank" href="https://2014.igem.org/Team:SZU-China/HumanPractice/PaperMill">Paper Mill</a></li>
+
                <li class="menu-item menu-item-type-custom menu-item-object-custom"> <a target="_blank" href="https://2014.igem.org/Team:SZU-China/judging/achievement">Achievement</a></li>
-
              <li id="menu-item-680" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-680"><a target="_blank" href="https://2014.igem.org/Team:SZU-China/HumanPractice/Survey">Survey</a></li>
+
                <li class="menu-item menu-item-type-custom menu-item-object-custom"> <a target="_blank" href="https://2014.igem.org/Team:SZU-China/judging/biobrick">Biobrick</a></li>
-
                
+
                <li class="menu-item menu-item-type-custom menu-item-object-custom"> <a target="_blank" href="https://2014.igem.org/Team:SZU-China/Safety">Safety</a></li>
-
            </ul>
+
              </ul>
-
          </li>
+
            </li>
-
          <li id="menu-item-607" class="menu-item menu-item-type-custom menu-item-object-custom menu-item-607"><a title="Judging"><i class="fa fa-check"></i> Judging</a>
+
            <li id="menu-item-1070" class="menu-item menu-item-type-post_type menu-item-object-page menu-item-1070"><a href="https://2014.igem.org/Team:SZU-China/notebook"><i class="fa fa-book"></i>NoteBook</a></li>
-
            <ul class="dropdown-menu">
+
          </ul>
-
              <li class="menu-item menu-item-type-custom menu-item-object-custom"> <a target="_blank" href="https://2014.igem.org/Team:SZU-China/judging/achievement">Achievement</a></li>
+
        </div>
-
              <li class="menu-item menu-item-type-custom menu-item-object-custom"> <a target="_blank" href="https://2014.igem.org/Team:SZU-China/judging/biobrick">Biobrick</a></li>
+
      </div>
-
              <li class="menu-item menu-item-type-custom menu-item-object-custom"> <a target="_blank" href="https://2014.igem.org/Team:SZU-China/Safety">Safety</a></li>
+
    </nav>
-
            </ul>
+
    <p><!-- 导航结束 --> </p>
-
          </li>
+
  </header>
-
          <li id="menu-item-1070" class="menu-item menu-item-type-post_type menu-item-object-page menu-item-1070"><a href="https://2014.igem.org/Team:SZU-China/notebook"><i class="fa fa-book"></i>NoteBook</a></li>
+
  <div class="container2">
-
        </ul>
+
    <article class="zan-article">
 +
      <div class="related-title">
 +
        <h2>Kil Protein</h2>
       </div>
       </div>
-
    </div>
+
      <h3><b>BACKGROUND</b></h3>
-
  </nav>
+
      <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In wild-type E.coli exist a plasmid named colE1, the plasmid encodes colicin gene, the release of colicin gene, immune gene of Escherichia coli in chain( in plasmid colE1 were known as CEA, kil, Imm gene). The expression of kil gene can promote the colicin release to kill the other strain . This is because the expression of kil gene can significantly increase the bacterial outer membrane permeability, so as to effectively promote the secretion of periplasmic colicin secreted to the extracellular.</p>
-
  <p><!-- 导航结束 --> </p>
+
      <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We cloned kil gene, to construct a recombinant plasmid vector,to connect it to the downstream of alkaline cellulase gene,which was screened in the Saline Lake of Inner Mongolia.</p>
-
</header>
+
      <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Then we transformed the recombinant vector into the BL21 E.col., when a particular efficient promoter, they successively expression. Kil protein accumulate in the periplasmic space of the bacteria and the periplasmic space was increased and the membrane permeability of bacteria was improved, thereby the alkaline cellulase can secrete out of bacteria.It can reduce the enzyme extraction separation process and can solve the problem of large number of secreted alkaline cellulase.</p>
-
 
+
      <h3>1.The acquisition of kil gene</h3>
-
 
+
      <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; It has not wild-type Escherichia coli in our laboratory and we don't have the colE1 plasmid. Considering the length of the kil only 138bp, we obtain the gene sequence by ncbi and synthesize the total gene of kil.</p>
-
<div class="container2">
+
      <p>The 3 'end<br>
-
    <article class="zan-article">
+
        ATGAGGAAAAGATTTTTTGTGGGAATATTCGCGATAAACCTCCTTGTTGGATGTCAGGCTAACTATATACCTGATGTTCAGGGAGGGACCATCGCACCATCCTCCTCTTCTAAACTGACGGGGATCGCGGTTCAGTAG  The 5 'end<br>
-
    <div class="related-title"> <h2>Kil Protein</h2></div>
+
        Further, we need to design primers to monoclone kil gene by PCR.<br>
-
    <h3><b>BACKGROUND</b></h3>
+
        Up primer<br>
-
    <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In wild-type E.coli exist a plasmid named colE1, the plasmid encodes colicin gene, the release of colicin gene, immune gene of Escherichia coli in chain( in plasmid colE1 were known as CEA, kil, Imm gene). The expression of kil gene can promote the colicin release to kill the other strain . This is because the expression of kil gene can significantly increase the bacterial outer membrane permeability, so as to effectively promote the secretion of periplasmic colicin secreted to the extracellular.</p>
+
        5' ACCGGAATTCGCGGCCGCTTCTAGATGAGGAAAAGATTTTTTGTGGGAATATTCGCG 3'<br>
-
    <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We cloned kil gene, to construct a recombinant plasmid vector,to connect it to the downstream of alkaline cellulase gene,which was screened in the Saline Lake of Inner Mongolia.</p>
+
        Down primer<br>
-
    <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Then we transformed the recombinant vector into the BL21 E.col., when a particular efficient promoter, they successively expression. Kil protein accumulate in the periplasmic space of the bacteria and the periplasmic space was increased and the membrane permeability of bacteria was improved, thereby the alkaline cellulase can secrete out of bacteria.It can reduce the enzyme extraction separation process and can solve the problem of large number of secreted alkaline cellulase.</p>
+
        3'GACTGCCCCTAGCGCCAAGTCATCTACTAGTAGCGGCCGCTGCAGAATTCGGATGAATTCTAATA5'<br>
-
   
+
      </p>
-
    <h3>1.The acquisition of kil gene</h3>
+
      <div class="row">
-
    <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; It has not wild-type Escherichia coli in our laboratory and we don't have the colE1 plasmid. Considering the length of the kil only 138bp, we obtain the gene sequence by ncbi and synthesize the total gene of kil.</p>
+
        <div class="col-xs-offset-2"> <img src="https://static.igem.org/mediawiki/2014/a/a9/SzuK1.png"> </div>
-
    <p>The 3 'end<br>
+
      </div>
-
ATGAGGAAAAGATTTTTTGTGGGAATATTCGCGATAAACCTCCTTGTTGGATGTCAGGCTAACTATATACCTGATGTTCAGGGAGGGACCATCGCACCATCCTCCTCTTCTAAACTGACGGGGATCGCGGTTCAGTAG  The 5 'end<br>
+
      <div class="row">
-
Further, we need to design primers to monoclone kil gene by PCR.<br>
+
        <div class="col-xs-offset-5"> <img src="https://static.igem.org/mediawiki/2014/6/6b/SzuK2.png"> </div>
-
Up primer<br>
+
      </div>
-
5' ACCGGAATTCGCGGCCGCTTCTAGATGAGGAAAAGATTTTTTGTGGGAATATTCGCG 3'<br>
+
      <p align="center">Figure 1.The kil gene of PCR graph</p>
-
Down primer<br>
+
      <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure 1.shows that the result of kil gene of PCR is 203bp. This is the sum of the upstream and downstream primers and kil, so that the kil gene has been successfully monocloned.</p>
-
3'GACTGCCCCTAGCGCCAAGTCATCTACTAGTAGCGGCCGCTGCAGAATTCGGATGAATTCTAATA5'<br>
+
      <h3>2.The production of part of kil</h3>
-
</p>
+
-
 
+
-
 
+
-
<div class="row">
+
-
    <div class="col-xs-offset-2">
+
-
    <img src="https://static.igem.org/mediawiki/2014/a/a9/SzuK1.png">
+
-
    </div>
+
-
    </div>
+
-
<div class="row">
+
-
    <div class="col-xs-offset-5">
+
-
    <img src="https://static.igem.org/mediawiki/2014/6/6b/SzuK2.png">
+
-
    </div>
+
-
    </div>
+
-
    <p align="center">Figure 1.The kil gene of PCR graph</p>
+
-
    <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure 1.shows that the result of kil gene of PCR is 203bp. This is the sum of the upstream and downstream primers and kil, so that the kil gene has been successfully monocloned.</p>
+
-
    <h3>2.The production of part of kil</h3>
+
       <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We used the ecor1 and pst1 enzyme to double digest the kil gene, and then connected it to the psb1c3 plasmid,which has the same restriction site, so that a new component be made.The result shows in the figure 2.</p>
       <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We used the ecor1 and pst1 enzyme to double digest the kil gene, and then connected it to the psb1c3 plasmid,which has the same restriction site, so that a new component be made.The result shows in the figure 2.</p>
-
     
 
       <div class="row">
       <div class="row">
-
    <div class="col-xs-offset-3">
+
        <div class="col-xs-offset-3"> <img src="https://static.igem.org/mediawiki/2014/6/63/SzuK3.png"> </div>
-
    <img src="https://static.igem.org/mediawiki/2014/6/63/SzuK3.png">
+
      </div>
-
    </div>
+
      <div class="row">
-
    </div>
+
        <div class="col-xs-offset-4"> <img src="https://static.igem.org/mediawiki/2014/9/96/SzuK4.png"> </div>
-
    <div class="row">
+
      </div>
-
    <div class="col-xs-offset-4">
+
      <p align="center">Figure 2. 1% agarose gel electrophoresis map of kil gene part single and double enzyme digestion <br>
-
    <img src="https://static.igem.org/mediawiki/2014/9/96/SzuK4.png">
+
        Lane 1.EcoR1 and pst1 double digestion <br>
-
    </div>
+
        Lane 2.EcoR1 single digestion </p>
-
    </div>
+
      <div class="row">
-
   
+
        <div class="col-xs-offset-5"> <img src="https://static.igem.org/mediawiki/2014/9/93/SzuK5.png"> </div>
-
   
+
      </div>
-
    <p align="center">Figure 2. 1% agarose gel electrophoresis map of kil gene part single and double enzyme digestion
+
      <p align="center">Figure 3. 1% agarose gel electrophoresis map of kil gene part single and double enzyme digestion <br>
-
<br>Lane 1.EcoR1 and pst1 double digestion
+
        Lane 1.EcoR1 and pst1 double digestion <br>
-
<br>Lane 2.EcoR1 single digestion
+
        Lane 2.EcoR1 single digestion </p>
-
</p>
+
      <h3>3.Verification of kil secretion</h3>
-
   
+
      <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;To measure the ability of kil to exogenous protein secretion of alkaline cellulase,we determine the activity of alkaline cellulase by DNS colorimetric method.</p>
-
   
+
      <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;As shown in the figure, the more deeper color represents the more amount of alkaline cellulase secreting out of the Escherichia coli, which can express the secretion ability of kil is strong.</p>
-
    <div class="row">
+
      <div class="row">
-
    <div class="col-xs-offset-5">
+
        <div class="col-xs-offset-4"> <img src="https://static.igem.org/mediawiki/2014/d/dd/SzuK6.png"> </div>
-
    <img src="https://static.igem.org/mediawiki/2014/9/93/SzuK5.png">
+
      </div>
-
    </div>
+
      <p align="center">Figure 4.Determination of enzyme activity in cell supernatant and cells <br>
-
    </div>
+
        Lane 1.enzyme activity of cell supernatant with kil <br>
-
   
+
        Lane 2.enzyme activity of cells with kil <br>
-
    <p align="center">Figure 3. 1% agarose gel electrophoresis map of kil gene part single and double enzyme digestion
+
        Lane 3.enzyme activity of cell supernatant without kil <br>
-
<br>Lane 1.EcoR1 and pst1 double digestion    
+
        Lane 4.enzyme activity of cells without kil </p>
-
<br> Lane 2.EcoR1 single digestion
+
      <div class="row">
-
</p>
+
        <div class="col-xs-offset-4"> <img src="https://static.igem.org/mediawiki/2014/1/1e/SzuK7.png"> </div>
-
   
+
      </div>
-
    <h3>3.Verification of kil secretion</h3>
+
      <p align="center">Figure 5.Determination of enzyme activity in cell supernatant <br>
-
    <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;To measure the ability of kil to exogenous protein secretion of alkaline cellulase,we determine the activity of alkaline cellulase by DNS colorimetric method.</p>
+
        Lane 1.enzyme activity of cell supernatant without kil <br>
-
    <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;As shown in the figure, the more deeper color represents the more amount of alkaline cellulase secreting out of the Escherichia coli, which can express the secretion ability of kil is strong.</p>
+
        Lane 2.enzyme activity of cell supernatant with kil </p>
-
    <div class="row">
+
      <p> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The figure 4and 5 show that kil can secrete the Exogenous protein,but the mechanism of Kil protein increasing the permeability of bacterial outer membrane is not very clear. There is evidence that phospholipase A involves several links of kil secretion.The periplasmic protein secreting out of cell has many benefits. First of all, extracellular volume is much larger than the periplasmic space, can accumulate more objective protein. Secondly, the process of purifying  extracellular periplasmic proteins is much simpler than the purification of cell wall breaking.</p>
-
    <div class="col-xs-offset-4">
+
     </article>
-
    <img src="https://static.igem.org/mediawiki/2014/d/dd/SzuK6.png">
+
  </div>
-
    </div>
+
</div>
-
    </div>
+
<footer id="zan-footer">
-
   
+
-
   
+
-
    <p align="center">Figure 4.Determination of enzyme activity in cell supernatant and cells
+
-
<br>Lane 1.enzyme activity of cell supernatant with kil
+
-
<br>Lane 2.enzyme activity of cells with kil
+
-
<br>Lane 3.enzyme activity of cell supernatant without kil
+
-
<br>Lane 4.enzyme activity of cells without kil
+
-
 
+
-
</p>
+
-
   
+
-
   
+
-
    <div class="row">
+
-
    <div class="col-xs-offset-4">
+
-
    <img src="https://static.igem.org/mediawiki/2014/1/1e/SzuK7.png">
+
-
    </div>
+
-
    </div>
+
-
   
+
-
    <p align="center">Figure 5.Determination of enzyme activity in cell supernatant  
+
-
<br>Lane 1.enzyme activity of cell supernatant without kil
+
-
<br>Lane 2.enzyme activity of cell supernatant with kil
+
-
 
+
-
</p>
+
-
    <p>
+
-
    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The figure 4and 5 show that kil can secrete the Exogenous protein,but the mechanism of Kil protein increasing the permeability of bacterial outer membrane is not very clear. There is evidence that phospholipase A involves several links of kil secretion.The periplasmic protein secreting out of cell has many benefits. First of all, extracellular volume is much larger than the periplasmic space, can accumulate more objective protein. Secondly, the process of purifying  extracellular periplasmic proteins is much simpler than the purification of cell wall breaking.</p>
+
-
      
+
-
       
+
-
    </article>
+
-
    </div>
+
-
   
+
-
   
+
-
    <footer id="zan-footer">
+
   <section class="zan-link" id="zan-link">
   <section class="zan-link" id="zan-link">
     <div class="container">
     <div class="container">
Line 380: Line 330:
     <div class="container">For better browser experience,please use chrome or firefox.<br>
     <div class="container">For better browser experience,please use chrome or firefox.<br>
       ©2014 SZU-China  
       ©2014 SZU-China  
 +
<a rel="license" href="http://creativecommons.org/licenses/by-sa/3.0/"><img alt="Creative Commons License" style="border-width:0" src="https://i.creativecommons.org/l/by-sa/3.0/88x31.png" /></a><br />
 +
      This work is licensed under a <a rel="license" href="http://creativecommons.org/licenses/by-sa/3.0/">Creative Commons Attribution-ShareAlike 3.0 Unported License</a>.
       <!--统计代码开始-->  
       <!--统计代码开始-->  
       <script type="text/javascript">
       <script type="text/javascript">

Latest revision as of 02:31, 18 October 2014

SZU-China

BACKGROUND

      In wild-type E.coli exist a plasmid named colE1, the plasmid encodes colicin gene, the release of colicin gene, immune gene of Escherichia coli in chain( in plasmid colE1 were known as CEA, kil, Imm gene). The expression of kil gene can promote the colicin release to kill the other strain . This is because the expression of kil gene can significantly increase the bacterial outer membrane permeability, so as to effectively promote the secretion of periplasmic colicin secreted to the extracellular.

      We cloned kil gene, to construct a recombinant plasmid vector,to connect it to the downstream of alkaline cellulase gene,which was screened in the Saline Lake of Inner Mongolia.

      Then we transformed the recombinant vector into the BL21 E.col., when a particular efficient promoter, they successively expression. Kil protein accumulate in the periplasmic space of the bacteria and the periplasmic space was increased and the membrane permeability of bacteria was improved, thereby the alkaline cellulase can secrete out of bacteria.It can reduce the enzyme extraction separation process and can solve the problem of large number of secreted alkaline cellulase.

1.The acquisition of kil gene

       It has not wild-type Escherichia coli in our laboratory and we don't have the colE1 plasmid. Considering the length of the kil only 138bp, we obtain the gene sequence by ncbi and synthesize the total gene of kil.

The 3 'end
ATGAGGAAAAGATTTTTTGTGGGAATATTCGCGATAAACCTCCTTGTTGGATGTCAGGCTAACTATATACCTGATGTTCAGGGAGGGACCATCGCACCATCCTCCTCTTCTAAACTGACGGGGATCGCGGTTCAGTAG The 5 'end
Further, we need to design primers to monoclone kil gene by PCR.
Up primer
5' ACCGGAATTCGCGGCCGCTTCTAGATGAGGAAAAGATTTTTTGTGGGAATATTCGCG 3'
Down primer
3'GACTGCCCCTAGCGCCAAGTCATCTACTAGTAGCGGCCGCTGCAGAATTCGGATGAATTCTAATA5'

Figure 1.The kil gene of PCR graph

      Figure 1.shows that the result of kil gene of PCR is 203bp. This is the sum of the upstream and downstream primers and kil, so that the kil gene has been successfully monocloned.

2.The production of part of kil

      We used the ecor1 and pst1 enzyme to double digest the kil gene, and then connected it to the psb1c3 plasmid,which has the same restriction site, so that a new component be made.The result shows in the figure 2.

Figure 2. 1% agarose gel electrophoresis map of kil gene part single and double enzyme digestion
Lane 1.EcoR1 and pst1 double digestion
Lane 2.EcoR1 single digestion

Figure 3. 1% agarose gel electrophoresis map of kil gene part single and double enzyme digestion
Lane 1.EcoR1 and pst1 double digestion
Lane 2.EcoR1 single digestion

3.Verification of kil secretion

      To measure the ability of kil to exogenous protein secretion of alkaline cellulase,we determine the activity of alkaline cellulase by DNS colorimetric method.

      As shown in the figure, the more deeper color represents the more amount of alkaline cellulase secreting out of the Escherichia coli, which can express the secretion ability of kil is strong.

Figure 4.Determination of enzyme activity in cell supernatant and cells
Lane 1.enzyme activity of cell supernatant with kil
Lane 2.enzyme activity of cells with kil
Lane 3.enzyme activity of cell supernatant without kil
Lane 4.enzyme activity of cells without kil

Figure 5.Determination of enzyme activity in cell supernatant
Lane 1.enzyme activity of cell supernatant without kil
Lane 2.enzyme activity of cell supernatant with kil

      The figure 4and 5 show that kil can secrete the Exogenous protein,but the mechanism of Kil protein increasing the permeability of bacterial outer membrane is not very clear. There is evidence that phospholipase A involves several links of kil secretion.The periplasmic protein secreting out of cell has many benefits. First of all, extracellular volume is much larger than the periplasmic space, can accumulate more objective protein. Secondly, the process of purifying extracellular periplasmic proteins is much simpler than the purification of cell wall breaking.

Retrieved from "http://2014.igem.org/Team:SZU-China/Project/Kil"