Team:Harvard BioDesign/Parts
From 2014.igem.org
Nlarusstone (Talk | contribs) |
Nlarusstone (Talk | contribs) |
||
(7 intermediate revisions not shown) | |||
Line 70: | Line 70: | ||
<tr><td bgColor="#e7e7e7" colspan="3" height="1px"> </tr> | <tr><td bgColor="#e7e7e7" colspan="3" height="1px"> </tr> | ||
<tr> <td colspan="3" height="5px"> </td></tr> | <tr> <td colspan="3" height="5px"> </td></tr> | ||
- | + | </table> | |
<!--Parts Submitted to the Registry --> | <!--Parts Submitted to the Registry --> | ||
+ | <table width="70%" align="center"> | ||
<tr><td > <h3> Parts Submitted to the Registry </h3></td> | <tr><td > <h3> Parts Submitted to the Registry </h3></td> | ||
- | < | + | <tr><td> |
- | + | ||
- | + | ||
- | + | ||
- | <td | + | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
<ol> | <ol> | ||
<li>Part Name</li> | <li>Part Name</li> | ||
+ | <p><a href = "http://parts.igem.org/Part:BBa_K1457000">mRFP_Spycatcher</a></p> | ||
<li>Part type</li> | <li>Part type</li> | ||
+ | <p>Coding</p> | ||
<li>Creator</li> | <li>Creator</li> | ||
- | < | + | <p>Michelle Long, Nicholas Larus-Stone, Jonah Saltzman, Tiana Raphel</p> |
<li>Short Description (60 characters on what the DNA does)</li> | <li>Short Description (60 characters on what the DNA does)</li> | ||
+ | <p>This part is the coding sequence for a modified red fluorescent protein fused to 'Spycatcher' protein.</p> | ||
<li>Long Description (Longer description of what the DNA does)</li> | <li>Long Description (Longer description of what the DNA does)</li> | ||
+ | <p>Spycatcher specifically amide bonds to an orthogonal polypeptide sequence called 'Spytag'. This part can be used to bind and detect any engineered constructs displaying Spytag. In our specific system, it is engineered to bind csgA protein fused to spytag and is applied extracellularly to easily detect CsgA production. The red chromoprotein in this part is conjugated to the SpyCatcher peptide tag. This tag has been demonstrated to spontaneously form a covalent bond to the corresponding SpyTag domain when the two come close to one another in a solution (Zakeri 2011). Therefore, this construct can be used to tag any protein or protein complex fused to a SpyTag domain with a red chromoprotein, allowing the complex to absorb light around the 490nm wavelength.</p> | ||
<li>Design considerations</li> | <li>Design considerations</li> | ||
+ | <p>Included between the red chromoprotein and the SpyCatcher sequence is a short amino-acid linker sequence. This linker ensures that the SpyCatcher domain will be fully available to react with other SpyTag domains in the solution, and will be less likely to be unavailable to due the specific geometry of a direct chromoprotein-SpyCatcher fusion protein that lacks a linker sequence.</p> | ||
+ | <li>Sequence</li> | ||
+ | <p>atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtg | ||
+ | aaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagta | ||
+ | cggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaa | ||
+ | gacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtc | ||
+ | cggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaact | ||
+ | gaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggac | ||
+ | atcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgctgattacgacatcccaacgaccgaaa | ||
+ | acctgtattttcagggcgccatggttgataccttatcaggtttatcaagtgagcaaggtcagtccggtgatatgacaattgaagaagatagtgctaccca | ||
+ | tattaaattctcaaaacgtgatgaggacggcaaagagttagctggtgcaactatggagttgcgtgattcatctggtaaaactattagtacatggatttca | ||
+ | gatggacaagtgaaagatttctacctgtatccaggaaaatatacatttgtcgaaaccgcagcaccagacggttatgaggtagcaactgctattaccttta | ||
+ | cagttaatgagcaaggtcaggttactgtaaatggcaaagcaactaaaggtgacgctcatatttaaat</p> | ||
</ol> | </ol> | ||
- | + | </td></tr> | |
- | + | </table> | |
- | + | <table align="center"> | |
- | </ | + | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
<tr><td colspan="3" > <h3> Parts Table</h3></td></tr> | <tr><td colspan="3" > <h3> Parts Table</h3></td></tr> | ||
- | <tr><td width="45%" colspan="3" valign="top"> | + | <tr><td width="45%" colspan="3" valign="top"></td></tr> |
- | + | ||
</table> | </table> | ||
</html> | </html> | ||
- | <groupparts> | + | <groupparts>iGEM014 Harvard_BioDesign</groupparts> |
Latest revision as of 01:50, 18 October 2014
| ||||||||||
Parts Submitted to the Registry |
Coding Michelle Long, Nicholas Larus-Stone, Jonah Saltzman, Tiana Raphel This part is the coding sequence for a modified red fluorescent protein fused to 'Spycatcher' protein. Spycatcher specifically amide bonds to an orthogonal polypeptide sequence called 'Spytag'. This part can be used to bind and detect any engineered constructs displaying Spytag. In our specific system, it is engineered to bind csgA protein fused to spytag and is applied extracellularly to easily detect CsgA production. The red chromoprotein in this part is conjugated to the SpyCatcher peptide tag. This tag has been demonstrated to spontaneously form a covalent bond to the corresponding SpyTag domain when the two come close to one another in a solution (Zakeri 2011). Therefore, this construct can be used to tag any protein or protein complex fused to a SpyTag domain with a red chromoprotein, allowing the complex to absorb light around the 490nm wavelength. Included between the red chromoprotein and the SpyCatcher sequence is a short amino-acid linker sequence. This linker ensures that the SpyCatcher domain will be fully available to react with other SpyTag domains in the solution, and will be less likely to be unavailable to due the specific geometry of a direct chromoprotein-SpyCatcher fusion protein that lacks a linker sequence. atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtg aaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagta cggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaa gacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtc cggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaact gaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggac atcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgctgattacgacatcccaacgaccgaaa acctgtattttcagggcgccatggttgataccttatcaggtttatcaagtgagcaaggtcagtccggtgatatgacaattgaagaagatagtgctaccca tattaaattctcaaaacgtgatgaggacggcaaagagttagctggtgcaactatggagttgcgtgattcatctggtaaaactattagtacatggatttca gatggacaagtgaaagatttctacctgtatccaggaaaatatacatttgtcgaaaccgcagcaccagacggttatgaggtagcaactgctattaccttta cagttaatgagcaaggtcaggttactgtaaatggcaaagcaactaaaggtgacgctcatatttaaat |
Parts Table | ||
<groupparts>iGEM014 Harvard_BioDesign</groupparts>