"
Team:WLC-Milwaukee/Parts
From 2014.igem.org
Mwmortensen (Talk | contribs) |
Mwmortensen (Talk | contribs) |
||
| Line 5: | Line 5: | ||
<tr><td> | <tr><td> | ||
<p>Both of our submitted biobricks serve the same purpose of a platform for directional insertion behind pBAD (K1406000) or pLac (K1406001) and a strong Ribosomal binding site. Downstream the combination of these parts, there is a NheI cutsite. This simple addition allows a simple insertion of any biobrick coding sequence into this part. To do this, the K1406000 or K1406001 is digested with NheI and PstI restriction enzymes, and the part to be inserted is digested with XbaI and PstI. XbaI and NheI have compatible sticky ends, and will form a "scar," no longer recognized by either XbaI or NheI, when ligated together. The PstI cuts will reform a PstI cutsite, which will complete the 4 biobrick cutsites. The use of NheI internally forms a scar by design, so no internal XbaI cutsites are left, which would violate the biobrick standard.</p> | <p>Both of our submitted biobricks serve the same purpose of a platform for directional insertion behind pBAD (K1406000) or pLac (K1406001) and a strong Ribosomal binding site. Downstream the combination of these parts, there is a NheI cutsite. This simple addition allows a simple insertion of any biobrick coding sequence into this part. To do this, the K1406000 or K1406001 is digested with NheI and PstI restriction enzymes, and the part to be inserted is digested with XbaI and PstI. XbaI and NheI have compatible sticky ends, and will form a "scar," no longer recognized by either XbaI or NheI, when ligated together. The PstI cuts will reform a PstI cutsite, which will complete the 4 biobrick cutsites. The use of NheI internally forms a scar by design, so no internal XbaI cutsites are left, which would violate the biobrick standard.</p> | ||
| - | <p style="word-wrap:break-word"> The sequence for the parts should be as follows, including the XbaI and PstI cutsites of biobrick prefix and suffix; NheI cutsites are bolded. K1406000:TCTAGAACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCAAGATAGTCCATAAGATTAG | + | <p style="word-wrap:break-word"> The sequence for the parts should be as follows, including the XbaI and PstI cutsites of biobrick prefix and suffix; NheI cutsites are bolded. K1406000:TCTAGAACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCAAGATAGTCCATAAGATTAG CGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCGTTTTTTTGG<b>GCTAGC</b>AAAGAGGAGAAAAATGCTAGCACTAGTCTGCAG |
| - | CGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCGTTTTTTTGG<b>GCTAGC</b>AAAGAGGAGAAAAATGCTAGCACTAGTCTGCAG | + | |
<br /> | <br /> | ||
| - | K1406001: | + | K1406001: TCTAGAAATTGTGAGCGGATAACAATTGACATTGTGAGCGGATAACAAGATACTGAGCA CAAAAGAGGAATTGACATTGTGAGCGGATAACAAGATACTGAGCACAAAAGAGGAGAAAAAT<b>GCTAGC</b>ACTAGTCTGCAG </p> |
</td></tr> | </td></tr> | ||
Revision as of 23:55, 17 October 2014
|
|
Both of our submitted biobricks serve the same purpose of a platform for directional insertion behind pBAD (K1406000) or pLac (K1406001) and a strong Ribosomal binding site. Downstream the combination of these parts, there is a NheI cutsite. This simple addition allows a simple insertion of any biobrick coding sequence into this part. To do this, the K1406000 or K1406001 is digested with NheI and PstI restriction enzymes, and the part to be inserted is digested with XbaI and PstI. XbaI and NheI have compatible sticky ends, and will form a "scar," no longer recognized by either XbaI or NheI, when ligated together. The PstI cuts will reform a PstI cutsite, which will complete the 4 biobrick cutsites. The use of NheI internally forms a scar by design, so no internal XbaI cutsites are left, which would violate the biobrick standard. The sequence for the parts should be as follows, including the XbaI and PstI cutsites of biobrick prefix and suffix; NheI cutsites are bolded. K1406000:TCTAGAACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCAAGATAGTCCATAAGATTAG CGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCGTTTTTTTGGGCTAGCAAAGAGGAGAAAAATGCTAGCACTAGTCTGCAG
|
