Team:Goettingen/notebook wetlab/biobricks
From 2014.igem.org
Gwen Eleven (Talk | contribs) m |
Gwen Eleven (Talk | contribs) m |
||
(13 intermediate revisions not shown) | |||
Line 24: | Line 24: | ||
<ul> | <ul> | ||
<li><a href="/Team:Goettingen/notebook_wetlab">PepTag Team</a></li> | <li><a href="/Team:Goettingen/notebook_wetlab">PepTag Team</a></li> | ||
- | <li><a href="/Team:Goettingen/notebook_wetlab/biobricks"> | + | <li><a href="/Team:Goettingen/notebook_wetlab/biobricks">BioBrick Team</a></li> |
+ | <li><a href="/Team:Goettingen/notebook_wetlab/gfp">GFP Team</a></li> | ||
</ul> | </ul> | ||
</li> | </li> | ||
Line 32: | Line 33: | ||
- | <div class="proRP" id=" | + | <div class="proRP" id="BBWrap"> |
- | <h2> | + | <br /><h2>July</h2><br /> |
<p> | <p> | ||
- | - results sequencing:<br /> | + | - Used BioBricks from library:<br /> |
- | Trp1 AGGCCGCAGAATGTGCTCT<b>G</b>GATTCCGATGCTGACTTGCT<br /> | + | <img src="https://static.igem.org/mediawiki/2014/9/9b/Goettingen_TableBB1.png" width="600" /> |
- | Trp1*AGGCCGCAGAATGTGCTCT<b>A</b>GATTCCGATGCTGACTTGCT<br /> | + | - Tick with a tip a hole in plate and resolve the pellet in 10µl sterile water, red color was visible, pipeting up and down, wait 5 minutes and put 10 µl into a PCR cup and freeze it<br /> |
+ | - 1 µl is transformed into DH5α → plated on Cm or kan plates<br /> | ||
+ | - Transformation worked, pick colonies for o/n in LB + Cm to isolate BB-plasmids<br /> | ||
+ | - Isolation of plasmids<br /><br /> | ||
+ | <b>Agarose gel (1%):</b> | ||
+ | <img src="https://static.igem.org/mediawiki/2014/7/77/Goettingen_FigureBB2.png" width="300" /> | ||
+ | <br /> | ||
+ | </p> | ||
+ | |||
+ | <h2>August</h2><br /> | ||
+ | <p> | ||
+ | <b>→After several tries to construct our BioBricks on the described way we changed to seamless cloning technique</b><br /><br /> | ||
+ | - PCRs for seamless cloning:<br /> | ||
+ | <img src="https://static.igem.org/mediawiki/2014/6/63/Goettingen_TableBB2.png" width="650" /><br /> | ||
+ | <b>Agarose gels (1%):</b><br /> | ||
+ | <img src="https://static.igem.org/mediawiki/2014/b/b9/Goettingen_FigureBB3.png" width="300" /> | ||
+ | <img src="https://static.igem.org/mediawiki/2014/c/c6/Goettingen_FigureBB4.png" width="300" /> | ||
+ | - Purification of the products and measurement of the concentration of each product.<br /> | ||
+ | - Amplification of Leu2, Trp1 and 2-micron with 2 sets of primers to create mutated genes that loose restriction sites:<br /><br /> | ||
+ | |||
+ | 1. PCR to create for each gene 2 fragments that contain 15 bp overhangs to the other one.<br /> | ||
+ | 2. Use fusion PCR approach to fuse genes with silent mution together.<br /> | ||
+ | 3. Gel extract the rightly fused PCR product and use it in a normal PCR for amplification.<br /> | ||
+ | <img src="https://static.igem.org/mediawiki/2014/f/fb/Goettingen_FigureBB5.png" width="450" /> | ||
+ | - Purification and sequencing of this three samples <br /> | ||
+ | </p> | ||
+ | |||
+ | <br /><h2>September</h2><br /> | ||
+ | <p> | ||
+ | <b>- results sequencing:</b><br /><br /> | ||
+ | Trp1 AGGCCGCAGAATGTGCTCT<font color="#c33418"><b>G</b></font>GATTCCGATGCTGACTTGCT<br /> | ||
+ | Trp1*AGGCCGCAGAATGTGCTCT<font color="#c33418"><b>A</b></font>GATTCCGATGCTGACTTGCT<br /> | ||
<br /> | <br /> | ||
- | Leu2 TGGTCCTAAATGGGGTAC<b>C</b>GGTAGTGTTAGACCTGAACAA<br /> | + | Leu2 TGGTCCTAAATGGGGTAC<font color="#c33418"><b>C</b></font>GGTAGTGTTAGACCTGAACAA<br /> |
- | Leu2*TGGTCCTAAATGGGGTAC<b>A</b>GGTAGTGTTAGACCTGAACAA<br /> | + | Leu2*TGGTCCTAAATGGGGTAC<font color="#c33418"><b>A</b></font>GGTAGTGTTAGACCTGAACAA<br /> |
<br /> | <br /> | ||
2-micron GAAGTTCCTATACTTTCTAG****AGAATAGGAACTTCGGAATAGGAACTTC<br /> | 2-micron GAAGTTCCTATACTTTCTAG****AGAATAGGAACTTCGGAATAGGAACTTC<br /> | ||
- | 2-micron*GAAGTTCCTATACTTTCTAG<b>CTAG</b>AGAATAGGAACTTCGGAATAGGAACTTC<br /> | + | 2-micron*GAAGTTCCTATACTTTCTAG<font color="#c33418"><b>CTAG</b></font>AGAATAGGAACTTCGGAATAGGAACTTC<br /> |
<br /> | <br /> | ||
⇒ silent mutations delete the restriction sides<br /> | ⇒ silent mutations delete the restriction sides<br /> | ||
Line 66: | Line 98: | ||
</p> | </p> | ||
- | + | <div><a href="https://2014.igem.org/Team:Goettingen/notebook_wetlab" class="button_pre"><b>Previous</b></a><a href="https://2014.igem.org/Team:Goettingen/notebook_wetlab/gfp" class="button_next"><b>Next</b></a></div> | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | </ | + | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | </ | + | |
- | + | ||
</div> | </div> | ||
Latest revision as of 23:50, 17 October 2014
July
- Used BioBricks from library:
- Tick with a tip a hole in plate and resolve the pellet in 10µl sterile water, red color was visible, pipeting up and down, wait 5 minutes and put 10 µl into a PCR cup and freeze it
- 1 µl is transformed into DH5α → plated on Cm or kan plates
- Transformation worked, pick colonies for o/n in LB + Cm to isolate BB-plasmids
- Isolation of plasmids
Agarose gel (1%):
August
→After several tries to construct our BioBricks on the described way we changed to seamless cloning technique
- PCRs for seamless cloning:
Agarose gels (1%):
- Purification of the products and measurement of the concentration of each product.
- Amplification of Leu2, Trp1 and 2-micron with 2 sets of primers to create mutated genes that loose restriction sites:
1. PCR to create for each gene 2 fragments that contain 15 bp overhangs to the other one.
2. Use fusion PCR approach to fuse genes with silent mution together.
3. Gel extract the rightly fused PCR product and use it in a normal PCR for amplification.
- Purification and sequencing of this three samples
September
- results sequencing:
Trp1 AGGCCGCAGAATGTGCTCTGGATTCCGATGCTGACTTGCT
Trp1*AGGCCGCAGAATGTGCTCTAGATTCCGATGCTGACTTGCT
Leu2 TGGTCCTAAATGGGGTACCGGTAGTGTTAGACCTGAACAA
Leu2*TGGTCCTAAATGGGGTACAGGTAGTGTTAGACCTGAACAA
2-micron GAAGTTCCTATACTTTCTAG****AGAATAGGAACTTCGGAATAGGAACTTC
2-micron*GAAGTTCCTATACTTTCTAGCTAGAGAATAGGAACTTCGGAATAGGAACTTC
⇒ silent mutations delete the restriction sides
- Prepare seamless mixture (see protocol and formula) with I – VI
- Transformation of the whole reaction sample into DH5α.
- Grown colonies on plates → pick several colonies and grow over night.
- Colony PCR with primer on backbone and primer in insert
- plasmid isolation of positives
- Amplification of construct via PCR
- Gel extraction & Purification & seamless cloning with A-F
- Transformation into DH5α
- Pick colonies and isolate plasmids from overnight culture
- colony PCR to verify construct
- restriction of the two different plasmids and the fusion product of 2-micron ligation over night of the 2-micron behind restriction site in plasmid backbones
- Transformation into DH5α.
- Pick several colonies into 4 mL LB +Cm for overnight cultures.
- Colony PCR and isolation of plasmids.
- Chose positives for further work and shipping to the registry