Team:SZU-China/Project/Kil

BACKGROUND

      In wild-type E.coli exist a plasmid named colE1, the plasmid encodes colicin gene, the release of colicin gene, immune gene of Escherichia coli in chain( in plasmid colE1 were known as CEA, kil, Imm gene). The expression of kil gene can promote the colicin release to kill the other strain . This is because the expression of kil gene can significantly increase the bacterial outer membrane permeability, so as to effectively promote the secretion of periplasmic colicin secreted to the extracellular.

      We cloned kil gene, to construct a recombinant plasmid vector,to connect it to the downstream of alkaline cellulase gene,which was screened in the Saline Lake of Inner Mongolia.

      Then we transformed the recombinant vector into the BL21 E.col., when a particular efficient promoter, they successively expression. Kil protein accumulate in the periplasmic space of the bacteria and the periplasmic space was increased and the membrane permeability of bacteria was improved, thereby the alkaline cellulase can secrete out of bacteria.It can reduce the enzyme extraction separation process and can solve the problem of large number of secreted alkaline cellulase.

1.The acquisition of kil gene

       It has not wild-type Escherichia coli in our laboratory and we don't have the colE1 plasmid. Considering the length of the kil only 138bp, we obtain the gene sequence by ncbi and synthesize the total gene of kil.

The 3 'end
ATGAGGAAAAGATTTTTTGTGGGAATATTCGCGATAAACCTCCTTGTTGGATGTCAGGCTAACTATATACCTGATGTTCAGGGAGGGACCATCGCACCATCCTCCTCTTCTAAACTGACGGGGATCGCGGTTCAGTAG The 5 'end
Further, we need to design primers to monoclone kil gene by PCR.
Up primer
5' ACCGGAATTCGCGGCCGCTTCTAGATGAGGAAAAGATTTTTTGTGGGAATATTCGCG 3'
Down primer
3'GACTGCCCCTAGCGCCAAGTCATCTACTAGTAGCGGCCGCTGCAGAATTCGGATGAATTCTAATA5'

Figure 1.The kil gene of PCR graph

      Figure 1.shows that the result of kil gene of PCR is 203bp. This is the sum of the upstream and downstream primers and kil, so that the kil gene has been successfully monocloned.

2.The production of part of kil

      We used the ecor1 and pst1 enzyme to double digest the kil gene, and then connected it to the psb1c3 plasmid,which has the same restriction site, so that a new component be made.The result shows in the figure 2.

Figure 2. 1% agarose gel electrophoresis map of kil gene part single and double enzyme digestion
Lane 1.EcoR1 and pst1 double digestion
Lane 2.EcoR1 single digestion

Figure 3. 1% agarose gel electrophoresis map of kil gene part single and double enzyme digestion
Lane 1.EcoR1 and pst1 double digestion
Lane 2.EcoR1 single digestion

3.Verification of kil secretion

      To measure the ability of kil to exogenous protein secretion of alkaline cellulase，we determine the activity of alkaline cellulase by DNS colorimetric method.

      As shown in the figure, the more deeper color represents the more amount of alkaline cellulase secreting out of the Escherichia coli, which can express the secretion ability of kil is strong.

Figure 4.Determination of enzyme activity in cell supernatant and cells
Lane 1.enzyme activity of cell supernatant with kil
Lane 2.enzyme activity of cells with kil
Lane 3.enzyme activity of cell supernatant without kil
Lane 4.enzyme activity of cells without kil

Figure 5.Determination of enzyme activity in cell supernatant
Lane 1.enzyme activity of cell supernatant without kil
Lane 2.enzyme activity of cell supernatant with kil

      The figure 4and 5 show that kil can secrete the Exogenous protein，but the mechanism of Kil protein increasing the permeability of bacterial outer membrane is not very clear. There is evidence that phospholipase A involves several links of kil secretion.The periplasmic protein secreting out of cell has many benefits. First of all, extracellular volume is much larger than the periplasmic space, can accumulate more objective protein. Secondly, the process of purifying extracellular periplasmic proteins is much simpler than the purification of cell wall breaking.