"
Team:DTU-Denmark/Primers
From 2014.igem.org
(Difference between revisions)
| (7 intermediate revisions not shown) | |||
| Line 2: | Line 2: | ||
<html> | <html> | ||
| - | <style> td {padding:10px} </style> | + | <style> td {padding:10px; border:2px solid black;} |
| + | table{background-color:transparent; border-collapse: collapse; box-shadow: 0 0 5px black;</style> | ||
<body> | <body> | ||
<div class="pagescontent"> | <div class="pagescontent"> | ||
| Line 12: | Line 13: | ||
<br> | <br> | ||
| - | <table | + | <table> |
<tr><td><b>Primer name </b></td><td><b>5'-sequence-3'</b></td><td><b>Description</b></tr> | <tr><td><b>Primer name </b></td><td><b>5'-sequence-3'</b></td><td><b>Description</b></tr> | ||
Latest revision as of 12:42, 17 October 2014
- Home
- Overview
- Methods
- Achievements
- Team
At the Giant Jamboree, we received a gold medal and an Interlab Study Award. We also won the Overgrad Best Parts Collection.
Below is a list of primers used in the experimental work
| Primer name | 5'-sequence-3' | Description |
| VF2 | TGCCACCTGACGTCTAAGAA | Primer for sequencing insert in standard backbone |
| VR | ATTACCGCCTTTGAGTGAGC | Reverse primer for sequencing insert in standard backbone |
| P3 | ATTCCGCUAAGGATGATTTCTGGAATTCGCGG | Primer attaching on backbone upstream BioBrick prefix |
| P4 | ACCTTGCCCUTTTTTGCCGGACTGCAGCGGC | Primer attaching on backbone downstream BioBrick suffix |
| P5 | TGGCGCCCGAACAGGGACTTGA | Reverse primer attaching upstream terminator for in vitro template amplification |
| P6 | TAATACGACTCACTATAGGGAGAGCCCGGATAGCTCAGTCGGT | Primer with T7 promoter tail for in vitro transcription template aplification |
| P7 | TTGCCGGACTGCAGCGGCCGCTACTAGTATGGCGCCCGAACAGGGACTT | Reverse primer attaching upstream of the terminator with a primer tail including BioBrick suffix |
