"
Team:DTU-Denmark/Primers
From 2014.igem.org
(Difference between revisions)
| Line 12: | Line 12: | ||
<br> | <br> | ||
| - | <table border=" | + | <table border="1"> |
| - | <tr><td><b>Primer name </b></td><td><b>5'-sequence-3'</b></td><td><b>Description</b> | + | <tr><td><b>Primer name </b></td><td><b>5'-sequence-3'</b></td><td><b>Description</b></tr> |
| - | </tr> | + | |
| + | <tr><td>VF2</td><td>TGCCACCTGACGTCTAAGAA</td><td>Primer for sequencing insert in standard backbone</td></tr> | ||
Revision as of 12:30, 17 October 2014
- Home
- Overview
- Methods
- Achievements
- Team
At the Giant Jamboree, we received a gold medal and an Interlab Study Award. We also won the Overgrad Best Parts Collection.
Below is a list of primers used in the experimental work
| Primer name | 5'-sequence-3' | Description |
| VF2 | TGCCACCTGACGTCTAAGAA | Primer for sequencing insert in standard backbone |
