Team:NEFU China/Parts

From 2014.igem.org

(Difference between revisions)

Latest revision as of 12:01, 17 October 2014

General Description
Construction and Standardize

General Description

Abbreviations
B	smtB	Trans-acting regulator
OP	smtO-P	Smt operator/promoter region, a bi-directional promoter
A	smtA	Encoding MT-like protein that can sequester metal ions
C	amilCP	Encoding a chromoprotein that has a blue/purple color visible to the naked eye. A registered part from iGEM11_Uppsala-Sweden
R	RFP	Red Fluorescent Protein. A registered part from iGEM11_Uppsala-Sweden
Flo	Flocculation gene	It can improve the flocculent activity of our host cells (E. coli DH5α)
CP25		A constitutive strong promoter
CDS7		Encoding a short peptide that can bind to CdS and induce the formation of CdS nanocrystals
BCP		According to priority: smtB, smtO-P(omit here), amilCP
BRP		According to priority: smtB, smtO-P(omit here), RFP
OPA		According to priority: smtO-P, smtA
FCDS7		According to priority: flocculation gene, CP25(omit here), CDS7

This is a new coding region part. It encodes smtB protein that functions as a trans-acting regulator and binds at two inverted repeats in smt operator/promoter sites, a bi-directional promoter. In the original intact smt locus, this interaction leads to the repression of the gene smtA, orientated in the opposite direction of the gene smtB. Previous cases selected smtA whose product functions by encoding MT-like protein that can sequester metal ions to deplete heavy metal ions from environment, while we take advantage of the interaction between SmtB protein and smt operator/promoter, the bi-directional promoter. This part is essential for our designed function of detection. With BBa_K1509001(smt operator/promoter), it’s the core member of the cadmium sensor.

BBa_K1509001

This is a bi-directional promoter, a new non-coding region part. It contains two inverted repeats that are the binding sites of SmtB protein. And the activity of one direction of this promoter can be repressed after the interaction with SmtB protein. With BBa_K1509000(the gene smtB), it’s the core member of the cadmium sensor.

For Recycling

BBa_K1509003

This is a constitutive strong promoter, a new non-coding region part. The promoter was designated as CP25. CP25 is a stronge promoter in Lactococcus lactis.(Jensen and Hammer, 1998) In this article, they measured the activities of the CP promoters in E. coli and assayed the expression of a reporter gene(lacLM) to rank the activities of those CP promoters. The result suggests CP25 is the strongest promoter. We picked it and insert it upstream of the gene CDS7(BBa_K643000), a part registered by Columbia-Cooper in 2011 iGEM competition, to make sure the gene CDS7 can be transcript constantly.

For Flocculating

BBa_K1509002

This is a new coding region part. It is responsible for the flocculent ability of Bacillus sp. F2 and has been converted to E. coli JM109. It has been proved that strain of E. coli positive clone FC2 could express flocculent activity, with the flocculent efficiency of 90%, thus can be a good choice in environmental applications.(Guangyu Chang et al., 2007) The 1071bp gene consists of 29% T, 18% C, 25% G and 29% A. Considering the subsequent treatment of our reconstructed bacteria, we use this gene to enhance the flocculent activity of our bacteria. This is to make it easier to collect nanocrystals formed by our bacteria and also a second thought of the problem of secondary pollution. It’s very promising in future application.

Construction and Standardize

Abbreviations
B	smtB	Trans-acting regulator
OP	smtO-P	Smt operator/promoter region, a bi-directional promoter
A	smtA	Encoding MT-like protein that can sequester metal ions
C	amilCP	Encoding a chromoprotein that has a blue/purple color visible to the naked eye. A registered part from iGEM11_Uppsala-Sweden
R	RFP	Red Fluorescent Protein. A registered part from iGEM11_Uppsala-Sweden
Flo	Flocculation gene	It can improve the flocculent activity of our host cells (E. coli DH5α)
CP25		A constitutive strong promoter
CDS7		Encoding a short peptide that can bind to CdS and induce the formation of CdS nanocrystals
BCP		According to priority: smtB, smtO-P(omit here), amilCP
BRP		According to priority: smtB, smtO-P(omit here), RFP
OPA		According to priority: smtO-P, smtA
FCDS7		According to priority: flocculation gene, CP25(omit here), CDS7

Miniprep (default pSB1C3 with RFPBBa_E1010, pEASY-T5 cloning vector with BCP, OPA and FC) with TIANprep Mini Plasmid Kit.see protocol Part preparation by PCR (smtB, smtO-P and CP25)

primers	smtB	F		5’ CGGAATTCCTAGCGACACTCTTGTAAGTGATCG 3’
		R		5' GGACTAGTATGACAAAACCAGTGCTGCAG 3'
	smtO-P	F		5’ CGGAATTCGAGCCAATCACGGTTTGTCCACCCA 3’
		R		5’ AACTGCAGGACAGCAACTCCTTTGAATATCTGA 3’
	CP25	F		5’ CGGAATTCCTTTGGCAGTTTATTCTTGACA 3’
		R		5’ AACTGCAGAACAGTACTATGTGATTATACCAGC 3’
PCR system (50ul)				parameters
				procedure	temperature	time
premix taq(TaKaRa)			25ul	PreDenature	94 ℃	10 min
primer F			2ul	Denature	94 ℃	30 sec
primer R			2ul	Annealing	55 ℃	30 sec
plasmids diluted 100×			1ul	Extension	72 ℃	30 sec
dNTPs			included in premix	Final Elongation	72 ℃	10 min
buffer				Final Hold	16 ℃	∞
H₂O			20ul	Cycle	30 cycles

Part preparation by PCR (F, short for Flocculation)

primers	F		5’ GCTCTAGAATGAGTCTACTTGCTGTTTTGTTTT 3’
	R		5' AACTGCAGTTACGAATTCGAGCTCGGTAC 3'
PCR system (50ul)			parameters
			procedure	temperature	time
premix taq(TaKaRa)		25ul	PreDenature	94 ℃	10 min
primer F		2ul	Denature	94 ℃	30 sec
primer R		2ul	Annealing	55 ℃	30 sec
plasmids diluted 100×		1ul	Extension	72 ℃	1.5 min
dNTPs		included in premix	Final Elongation	72 ℃	10 min
buffer			Final Hold	16 ℃	∞
H₂O		20ul	Cycle	30 cycles

P1 parts’ PCR product 1,2. smtO-P; 3-6. smtB; 8-11. F; Marker (DL2000)

P2 PCR product of CP25; Marker (DL2000)

Double digestion (NEB)

SmtB

substrate

EcoR I

Spe I

Cutsmart

Buffer

H₂O

total

temperature

time

BBa_E1010

30ul

3ul

10ul

54ul

100ul

37℃

16 h

PCR product

30ul

3ul

10ul

54ul

100ul

37℃

16 h

SmtO-P, CP25

substrate

EcoR I

Pst I

1×H

Buffer

H₂O

total

temperature

time

BBa_E1010

30ul

3ul

10ul

54ul

100ul

37℃

16 h

PCR product

30ul

3ul

10ul

54ul

100ul

37℃

16 h

F

substrate

Xba I

Pst I

1×M

Buffer

H₂O

total

temperature

time

BBa_E1010

30ul

3ul

10ul

54ul

100ul

37℃

16 h

PCR product

30ul

3ul

10ul

54ul

100ul

37℃

16 h

Ligation (TaKaRa DNA Ligation Kit Ver.2.1see manual)

Solution I	-plasmid- & -Part-	total	temperature	time
5ul	5ul in total (see note)	10ul	16℃	30 min
Note:-plasmid-:-BCP-(mole number)=1:2~1:8

Transformationsee protocol

Colony PCR

PCR system (20ul)		parameters
PCR system (20ul)		procedure	temperature	time
premix taq(TaKaRa)	10ul	PreDenature	94 ℃	5 min
primer F	0.8ul	Denature	94 ℃	30 sec
primer R	0.8ul	Annealing	55 ℃	30 sec
template: pick a single colony and dip in H₂O	8.4ul	Extension	72 ℃	30 sec/1.5 min
template: pick a single colony and dip in H₂O	8.4ul	Final Elongation	72 ℃	10 min
dNTPs	included in premix	Final Hold	16 ℃	∞
buffer	included in premix	Cycle	30 cycles
Note:1. The template was heat denatured at 100℃ in metal bath, then freeze on ice for 2 min before running through parameters on the right. 2. Extension time: 30 sec for smtB, smtO-P and CP25; 1.5 min for F 3. Use corresponding primers

Miniprep (pSB1C3 with maybe smtB or smtO-P or F or CP25) with TIANprep Mini Plasmid Kit.see protocol

Double digestion (NEB) for detection (refer to the double digestion tables above for details)

plasmids with H₂O	enzyme1	enzyme2	buffer	total	temperature	time
16.8ul	0.6ul	0.6ul	2ul	20ul	37℃	16 h

The sequencing results are consistent with our designation.

@@ Line 30: / Line 30: @@
              <div class="collapse navbar-collapse" id="bs-example-navbar-collapse-1">
                <ul class="nav navbar-nav">
-   <li><a href="https://2014.igem.org/Team:NEFU:China">Home</a></li>
+   <li><a href="https://2014.igem.org/Team:NEFU_China">Home</a></li>
-  <li class="dropdown"><a href="#" class="dropdown-toggle" data-toggle="dropdown">Team <span class="caret"></span></a>
-    <ul class="dropdown-menu" role="menu">
-      <li><a href="https://2014.igem.org/Team:NEFU_China/Team#instructor">Instructors</a></li>
-      <li><a href="https://2014.igem.org/Team:NEFU_China/Team#student">Students</a></li>
-      <li><a href="https://2014.igem.org/Team:NEFU_China/Team#advisor">Acknowledgement</a></li>
-    </ul>
-  </li>
    <li class="dropdown active"> <a href="#" class="dropdown-toggle" data-toggle="dropdown">Project <span class="caret"></span></a>
      <ul class="dropdown-menu" role="menu">
@@ Line 68: / Line 61: @@
        <li><a href="https://2014.igem.org/Team:NEFU_China/Socialactivities">Social Activities</a></li>
        <li><a href="https://2014.igem.org/Team:NEFU_China/Survey">Survey</a></li>
+    </ul>
+  </li>
+  <li class="dropdown"><a href="#" class="dropdown-toggle" data-toggle="dropdown">Team <span class="caret"></span></a>
+    <ul class="dropdown-menu" role="menu">
+      <li><a href="https://2014.igem.org/Team:NEFU_China/Team#instructor">Instructors</a></li>
+      <li><a href="https://2014.igem.org/Team:NEFU_China/Team#student">Students</a></li>
+      <li><a href="https://2014.igem.org/Team:NEFU_China/Team#advisor">Acknowledgement</a></li>
      </ul>
    </li>
@@ Line 80: / Line 80: @@
          <div class="content" style="padding:10px;">
            <h2 class="subtitle"><a name="gd">General Description</a></h2 class="subtitle">
-           <table cellspacing="0" cellpadding="0" border="1">
+           <table class="table table-bordered table-hover">
-            <tbody>
+<thead>
-              <tr>
+  <tr>
-                <td width="577" colspan="3" valign="top"><p> <strong>Abbreviations</strong> </p></td>
+    <th colspan="3"><p>Abbreviations</p></th>
-              </tr>
+  </tr>
-              <tr>
+</thead>
-                <td width="49" valign="top"><p> B </p></td>
+  <tr>
-                <td width="115" valign="top"><p> smtB </p></td>
+    <td><p>B</p></td>
-                <td width="413" valign="top"><p> Trans-acting regulator </p></td>
+    <td><p>smtB</p></td>
-              </tr>
+    <td><p>Trans-acting regulator</p></td>
-              <tr>
+  </tr>
-                <td width="49" valign="top"><p> OP </p></td>
+  <tr>
-                <td width="115" valign="top"><p> smtO-P </p></td>
+    <td><p>OP</p></td>
-                <td width="413" valign="top"><p> Smt operator/promoter region, a &nbsp; bi-directional promoter </p></td>
+    <td><p>smtO-P</p></td>
-              </tr>
+    <td><p>Smt operator/promoter region, a    bi-directional promoter </p></td>
-              <tr>
+  </tr>
-                <td width="49" valign="top"><p> A </p></td>
+  <tr>
-                <td width="115" valign="top"><p> smtA </p></td>
+    <td><p>A</p></td>
-                <td width="413" valign="top"><p> Encoding MT-like protein that can &nbsp; sequester metal ions </p></td>
+    <td><p>smtA</p></td>
-              </tr>
+    <td><p>Encoding MT-like protein that can    sequester metal ions</p></td>
-              <tr>
+  </tr>
-                <td width="49" valign="top"><p> C </p></td>
+  <tr>
-                <td width="115" valign="top"><p> amilCP </p></td>
+    <td><p>C</p></td>
-                <td width="413" valign="top"><p> Encoding a chromoprotein that has a &nbsp; blue/purple color visible to the naked eye. A registered part from iGEM11_Uppsala-Sweden </p></td>
+    <td><p>amilCP</p></td>
-              </tr>
+    <td><p>Encoding a chromoprotein that has a    blue/purple color visible to the naked eye. A registered part from iGEM11_Uppsala-Sweden</p></td>
-              <tr>
+  </tr>
-                <td width="49" valign="top"><p> R </p></td>
+  <tr>
-                <td width="115" valign="top"><p> RFP </p></td>
+    <td><p>R</p></td>
-                <td width="413" valign="top"><p> Red Fluorescent Protein. </p>
+    <td><p>RFP</p></td>
-                  <p> A registered part from iGEM11_Uppsala-Sweden </p></td>
+    <td><p>Red Fluorescent Protein. <br>
-              </tr>
+      A registered part from iGEM11_Uppsala-Sweden</p></td>
-              <tr>
+  </tr>
-                <td width="49" valign="top"><p> Flo </p></td>
+  <tr>
-                <td width="115" valign="top"><p> Flocculation gene </p></td>
+    <td><p>Flo</p></td>
-                <td width="413" valign="top"><p> It can improve the flocculent activity of &nbsp; our host cells (<em>E.coli</em> JM 109) </p></td>
+    <td><p>Flocculation gene</p></td>
-              </tr>
+    <td><p>It can improve the flocculent activity of    our host cells (<em>E. coli</em> <em>DH5α</em>)</p></td>
-              <tr>
+  </tr>
-                <td width="164" colspan="2" valign="top"><p> CP25 </p></td>
+  <tr>
-                <td width="413" valign="top"><p> A constitutive strong promoter </p></td>
+    <td colspan="2"><p>CP25</p></td>
-              </tr>
+    <td><p>A constitutive strong promoter</p></td>
-              <tr>
+  </tr>
-                <td width="164" colspan="2" valign="top"><p> CDS7 </p></td>
+  <tr>
-                <td width="413" valign="top"><p> Encoding a short peptide that can bind to &nbsp; CdS and </p>
+    <td colspan="2"><p>CDS7</p></td>
-                  <p> &nbsp;induce the formation of CdS nanocrystals </p></td>
+    <td><p>Encoding a short peptide that can bind to    CdS and<br>
-              </tr>
+      induce the formation of CdS nanocrystals</p></td>
-              <tr>
+  </tr>
-                <td width="164" colspan="2" valign="top"><p> BCP </p></td>
+  <tr>
-                <td width="413" valign="top"><p> According to priority: smtB, smtO-P(omit &nbsp; here), amilCP </p></td>
+    <td colspan="2"><p>BCP</p></td>
-              </tr>
+    <td><p>According to priority: smtB, smtO-P(omit    here), amilCP</p></td>
-              <tr>
+  </tr>
-                <td width="164" colspan="2" valign="top"><p> BRP </p></td>
+  <tr>
-                <td width="413" valign="top"><p> According to priority: smtB, smtO-P(omit &nbsp; here), RFP </p></td>
+    <td colspan="2"><p>BRP</p></td>
-              </tr>
+    <td><p>According to priority: smtB, smtO-P(omit    here), RFP</p></td>
-              <tr>
+  </tr>
-                <td width="164" colspan="2" valign="top"><p> OPA </p></td>
+  <tr>
-                <td width="413" valign="top"><p> According to priority: smtO-P, smtA </p></td>
+    <td colspan="2"><p>OPA</p></td>
-              </tr>
+    <td><p>According to priority: smtO-P, smtA</p></td>
-              <tr>
+  </tr>
-                <td width="164" colspan="2" valign="top"><p> FCDS7 </p></td>
+  <tr>
-                <td width="413" valign="top"><p> According to priority: flocculation gene, &nbsp; CP25(omit here), CDS7 </p></td>
+    <td colspan="2"><p>FCDS7</p></td>
-              </tr>
+    <td><p>According to priority: flocculation gene,    CP25(omit here), CDS7</p></td>
-            </tbody>
+  </tr>
-          </table>
+</table>
            <h2 class="subtitle"><a name="fd">For Detecting</a></h2 class="subtitle">
            <h3><a href="http://parts.igem.org/Part:BBa_K1509000">BBa_K1509000</a></h3>
            <p>This is a new coding region part. It encodes smtB protein that functions as a trans-acting regulator and binds at two inverted repeats in smt operator/promoter sites, a bi-directional promoter. In the original intact smt locus, this interaction leads to the repression of the gene smtA, orientated in the opposite direction of the gene smtB. Previous cases selected smtA whose product functions by encoding MT-like protein that can sequester metal ions to deplete heavy metal ions from environment, while we take advantage of the interaction between SmtB protein and smt operator/promoter, the bi-directional promoter. This part is essential for our designed function of detection. With <a href="http://parts.igem.org/Part:BBa_K1509001">BBa_K1509001</a>(smt operator/promoter), it’s the core member of the cadmium sensor.</p>
-           <img src="https://static.igem.org/mediawiki/2014/a/aa/NEFU_China_BBa_K1509000.png" class="img-thumbnail">
+           <p style="text-align:center;"><img src="https://static.igem.org/mediawiki/2014/a/aa/NEFU_China_BBa_K1509000.png" width=40% class="img-thumbnail"></p>
            <h3><a href="http://parts.igem.org/Part:BBa_K1509001">BBa_K1509001</a></h3>
            <p>This is a bi-directional promoter, a new non-coding region part. It contains two inverted repeats that are the binding sites of SmtB protein. And the activity of one direction of this promoter can be repressed after the interaction with SmtB protein. With <a href="http://parts.igem.org/Part:BBa_K1509000">BBa_K1509000</a>(the gene smtB), it’s the core member of the cadmium sensor.</p>
-           <img src="https://static.igem.org/mediawiki/2014/0/02/NEFU_China_BBa_K1509001.png" class="img-thumbnail">
+           <p style="text-align:center;"><img src="https://static.igem.org/mediawiki/2014/0/02/NEFU_China_BBa_K1509001.png" width=40% class="img-thumbnail"></p>
            <h2 class="subtitle"><a name="fr">For Recycling</a></h2 class="subtitle">
            <h3><a href="http://parts.igem.org/Part:BBa_K1509003">BBa_K1509003</a></h3>
-           <p>This is a constitutive strong promoter, a new non-coding region part. The promoter was designated as CP25. CP25 is a stronge promoter in Lactococcus lactis.(Jensen and Hammer, 1998) In this article, they measured the activities of the CP promoters in E. Coli and assayed the expression of a reporter gene(lacLM) to rank the activities of those CP promoters. The result suggests CP25 is the strongest promoter. We picked it and insert it upstream of the gene CDS7(<a href="http://parts.igem.org/Part:BBa_K643000">BBa_K643000</a>), a part registered by Columbia-Cooper in 2011 iGEM competition, to make sure the gene CDS7 can be transcript constantly.</p>
+           <p>This is a constitutive strong promoter, a new non-coding region part. The promoter was designated as CP25. CP25 is a stronge promoter in Lactococcus lactis.(Jensen and Hammer, 1998) In this article, they measured the activities of the CP promoters in <em>E. coli</em> and assayed the expression of a reporter gene(lacLM) to rank the activities of those CP promoters. The result suggests CP25 is the strongest promoter. We picked it and insert it upstream of the gene CDS7(<a href="http://parts.igem.org/Part:BBa_K643000">BBa_K643000</a>), a part registered by Columbia-Cooper in 2011 iGEM competition, to make sure the gene CDS7 can be transcript constantly.</p>
-           <img src="https://static.igem.org/mediawiki/2014/8/8f/NEFU_China_BBa_K1509003.png" class="img-thumbnail">
+           <p style="text-align:center;"><img src="https://static.igem.org/mediawiki/2014/8/8f/NEFU_China_BBa_K1509003.png" width=40% class="img-thumbnail"></p>
            <h2 class="subtitle"><a name="ff">For Flocculating</a></h2 class="subtitle">
            <h3><a href="http://parts.igem.org/Part:BBa_K1509002">BBa_K1509002</a></h3>
-           <p>This is a new coding region part. It is responsible for the flocculent ability of Bacillus sp. F2 and has been converted to E.coli JM109. It has been proved that strain of E.coli positive clone FC2 could express flocculent activity, with the flocculent efficiency of 90%, thus can be a good choice in environmental applications.(Guangyu Chang et al., 2007) The 1071bp gene consists of 29% T, 18% C, 25% G and 29% A. Considering the subsequent treatment of our reconstructed bacteria, we use this gene to enhance the flocculent activity of our bacteria. This is to make it easier to collect nanocrystals formed by our bacteria and also a second thought of the problem of secondary pollution. It’s very promising in future application.</p>
+           <p>This is a new coding region part. It is responsible for the flocculent ability of Bacillus sp. F2 and has been converted to <em>E. coli</em> JM109. It has been proved that strain of <em>E. coli</em> positive clone FC2 could express flocculent activity, with the flocculent efficiency of 90%, thus can be a good choice in environmental applications.(Guangyu Chang et al., 2007) The 1071bp gene consists of 29% T, 18% C, 25% G and 29% A. Considering the subsequent treatment of our reconstructed bacteria, we use this gene to enhance the flocculent activity of our bacteria. This is to make it easier to collect nanocrystals formed by our bacteria and also a second thought of the problem of secondary pollution. It’s very promising in future application.</p>
-           <img src="https://static.igem.org/mediawiki/2014/1/17/NEFU_China_BBa_K1509002.png" class="img-thumbnail">
+           <p style="text-align:center;"><img src="https://static.igem.org/mediawiki/2014/1/17/NEFU_China_BBa_K1509002.png" width=40% class="img-thumbnail"></p>
            <h2 class="subtitle"><a name="cs">Construction and Standardize</a></h2 class="subtitle">
-           <table cellspacing="0" cellpadding="0" border="1">
+           <table align="center" cellspacing="0" cellpadding="0" border="1">
              <tbody>
                <tr>
@@ Line 193: / Line 193: @@
                  <td width="49" valign="top"><p> Flo </p></td>
                  <td width="115" valign="top"><p> Flocculation gene </p></td>
-                 <td width="413" valign="top"><p> It can improve the flocculent activity of &nbsp; our host cells (<em>E.coli</em> JM 109) </p></td>
+                 <td width="413" valign="top"><p> It can improve the flocculent activity of &nbsp; our host cells (<em>E. coli</em> <em>DH5α</em>) </p></td>
                </tr>
                <tr>
@@ Line 223: / Line 223: @@
            </table>
            <p>Miniprep (default pSB1C3 with RFP<a href="http://parts.igem.org/Part:BBa_E1010">BBa_E1010</a>, pEASY-T5 cloning vector with BCP, OPA and FC) with TIANprep Mini Plasmid Kit.<a>see protocol</a> Part preparation by PCR (smtB, smtO-P and CP25) </p>
-           <table cellspacing="0" cellpadding="0" border="1">
+           <table align="center" cellspacing="0" cellpadding="0" border="1">
              <tbody>
                <tr>
@@ Line 313: / Line 313: @@
            </table>
            <p>Part preparation by PCR (F, short for Flocculation)</p>
-           <table cellspacing="0" cellpadding="0" border="1">
+           <table align="center" cellspacing="0" cellpadding="0" border="1">
              <tbody>
                <tr>
@@ Line 383: / Line 383: @@
              </tbody>
            </table>
-           <img src="https://static.igem.org/mediawiki/2014/0/0d/NEFU_China_1236811DL2000.png" class="img-thumbnail">
+           <p style="text-align:center;"><img src="https://static.igem.org/mediawiki/2014/0/0d/NEFU_China_1236811DL2000.png" class="img-thumbnail"></p>
            <p>P1 parts’ PCR product 1,2. smtO-P; 3-6. smtB; 8-11. F; Marker (DL2000) </p>
-           <img src="https://static.igem.org/mediawiki/2014/d/dd/NEFU_China_cp25DL2000.png" class="img-thumbnail">
+           <p style="text-align:center;"><img src="https://static.igem.org/mediawiki/2014/d/dd/NEFU_China_cp25DL2000.png" class="img-thumbnail"></p>
            <p>P2 PCR product of CP25; Marker (DL2000)</p>
            <p>Double digestion (NEB)</p>
            <p>SmtB</p>
-           <table cellspacing="0" cellpadding="0" border="1">
+           <table align="center" cellspacing="0" cellpadding="0" border="1">
              <tbody>
                <tr>
@@ Line 427: / Line 427: @@
            </table>
            <p>SmtO-P, CP25</p>
-           <table cellspacing="0" cellpadding="0" border="1">
+           <table align="center" cellspacing="0" cellpadding="0" border="1">
              <tbody>
                <tr>
@@ Line 465: / Line 465: @@
            </table>
            <p>F</p>
-           <table cellspacing="0" cellpadding="0" border="1">
+           <table align="center" cellspacing="0" cellpadding="0" border="1">
              <tbody>
                <tr>
@@ Line 503: / Line 503: @@
            </table>
            <p>Ligation (TaKaRa DNA Ligation Kit Ver.2.1see manual)</p>
-           <table cellspacing="0" cellpadding="0" border="1">
+           <table align="center" cellspacing="0" cellpadding="0" border="1">
              <tbody>
                <tr>
@@ Line 526: / Line 526: @@
            <p>Transformationsee protocol</p>
            <p>Colony PCR</p>
-           <table cellspacing="0" cellpadding="0" border="1">
+           <table align="center" cellspacing="0" cellpadding="0" border="1">
              <tbody>
                <tr>
@@ Line 592: / Line 592: @@
            <p>Miniprep (pSB1C3 with maybe smtB or smtO-P or F or CP25) with TIANprep Mini Plasmid Kit.see protocol</p>
            <p>Double digestion (NEB) for detection (refer to the double digestion tables above for details)</p>
-           <table cellspacing="0" cellpadding="0" border="1">
+           <table align="center" cellspacing="0" cellpadding="0" border="1">
              <tbody>
                <tr>
@@ Line 625: / Line 625: @@
 $(".biography").tooltip();
 $(document).ready(function(){
-	$(".fixed-nav").height($("#p3").height());
+  $(".fixed-nav").height($("#p3").height());
-	var $liCur = $(".navbar ul li.active");
+  var $liCur = $(".navbar ul li.active");
-	curP = $liCur.position().left,
+  curP = $liCur.position().left,
-	curW = $liCur.outerWidth(true),
+  curW = $liCur.outerWidth(true),
-	$slider = $(".curBg"),
+  $slider = $(".curBg"),
-	$navBox = $(".nav");
+  $navBox = $(".nav");
-	$targetEle = $(".navbar ul li a"),
+  $targetEle = $(".navbar ul li a"),
-	$slider.animate({
+  $slider.animate({
-		"left":curP,
+    "left":curP,
-		"width":curW
+    "width":curW
-	});
+  });
-	$targetEle.mouseenter(function () {
+  $targetEle.mouseenter(function () {
-		var $_parent = $(this).parent(),
+    var $_parent = $(this).parent(),
-			_width = $_parent.outerWidth(true),
+      _width = $_parent.outerWidth(true),
-			posL = $_parent.position().left;
+      posL = $_parent.position().left;
-			$slider.stop(true, true).animate({
+      $slider.stop(true, true).animate({
-				"left":posL,
+        "left":posL,
-				"width":_width
+        "width":_width
-			  }, "fast");
+        }, "fast");
-			});
+      });
-			$navBox.mouseleave(function (cur, wid) {
+      $navBox.mouseleave(function (cur, wid) {
-			cur = curP;
+      cur = curP;
-			wid = curW;
+      wid = curW;
-			$slider.stop(true, true).animate({
+      $slider.stop(true, true).animate({
-				"left":cur,
+        "left":cur,
-				"width":wid
+        "width":wid
-			}, "fast");
+      }, "fast");
-	});
+  });
-	$(".left-nav li").click(function(){
+  $(".left-nav li").click(function(){
-		$(this).addClass("left-nav-active").siblings().removeClass("left-nav-active");
+    $(this).addClass("left-nav-active").siblings().removeClass("left-nav-active");
-	});
+  });
-	window.onscroll = function (){
+  window.onscroll = function (){
-		var top = document.documentElement.scrollTop ? document.documentElement.scrollTop : document.body.scrollTop;
+    var top = document.documentElement.scrollTop ? document.documentElement.scrollTop : document.body.scrollTop;
-		var width = $(".left").width();
+    var width = $(".left").width();
-      	if(top>=0){
+        if(top>=0){
-			$(".fixed-nav").addClass("fixed-nav-fixed").width(width);
+      $(".fixed-nav").addClass("fixed-nav-fixed").width(width);
-		}else{
+    }else{
-			$(".fixed-nav").removeClass("fixed-nav-fixed");
+      $(".fixed-nav").removeClass("fixed-nav-fixed");
-		}
+    }
-	}
+  }
 })
 </script>
 </html>